Soybean Seeds Research Articles

Evaluating the impact of Cold plasma on Seedling Growth properties, seed germination, and soybean antioxidant enzyme activity.

Cold atmospheric pressure plasma (CAP) has garnered significant attention in recent years for its potential applications in biomedical, environmental, and agricultural fields. Cold plasma treatment exhibits a variety of effects in agricultural applications, including impacts on seed germination and seedling growth; however, further research is required. Soybean serves as a fundamental source of nutrients for both animals and humans. Soybean seeds possess impermeable and thick testae, which results in prolonged germination times and suboptimal germination rates. The soybeans exhibit low uniformity. As a result, poor crop establishment and yield reduction are inevitable outcomes. Therefore, the purpose of this study was to examine the effects of Iranian soybean cultivars, such as Sari, Saba, Arian, Katoul, and Williams, on seedling growth properties, seed germination, and antioxidant enzyme activity, using argon at time intervals of 30, 60, 180, 300, and 420s. Cold plasma treatment significantly enhanced germination potential from 1.18 to 66.97%, germination index from 0.50 to 60.09%, germination rate from 1.78 to 32.17%, seedling length from 2.70cm to 78.13cm, root length from 2.87cm to 56.13cm, and seedling dry weight from 1.80g to 36.63g. Additionally, CAT activity increased from 0.88- to 4.40-fold, SOD activity from 0.86- to 5.89-fold, and APX activities from 0.40- to 4.01-fold compared to the control treatment. The findings indicated that the samples exhibited optimal results at treatment durations of 60 and 180s. The influence of plasma on the antioxidant responses of seedlings, seed germination, and growth characteristics was contingent upon the duration of treatment. Cold plasma, when applied for an appropriate duration, may enhance soybean seedling growth characteristics and seed germination.

Seedborne Fungal Detection Differs with Seed Assay Method, and Fungal Diversity and Abundance Are Impacted by Fungicide Treatment, Harvest Timing, and Storage Environment

Previous studies have shown that foliar fungicides increase the abundance of Diaporthe spp. in mature soybean seeds, thereby reducing seed quality and potentially increasing seedling, stem, and pod disease in subsequent plantings. To mitigate this, we examined a fungicide containing mefentrifluconazole, fluxapyroxad, and pyraclostrobin applied during the R3 growth stage. We compared the seedborne fungal community from soybeans harvested at full maturity and 2 to 3 weeks later to assess fungal colonization. Six trials were conducted in Iowa and South Dakota in 2021 and 2022. Asymptomatic, recently harvested seed was assayed using either an agar-plate or a seed-blotter test, and the results were compared. The agar-plate method involved disinfesting seeds in sodium hypochlorite and ethanol and then transferring them to acidified water agar plates. Fungal isolates were identified using morphology and DNA sequences. This method detected 562 fungal isolates from 25 species and 14 genera. Dry conditions reduced seed infection, but a 2-week delay in harvest increased the likelihood of Alternaria and Cercospora infection in nontreated controls. The seed-blotter test involved disinfesting seeds, placing them on blotter paper, and incubating them. This assay detected higher numbers of fungal infected seed, with Aspergillus as the dominant genus. Storage conditions significantly impacted fungal presence, with more Aspergillus in seeds stored in a shed than in the cooler. Both assay methods showed that the fungicide treatment reduced the number of seeds infected with Alternaria, Cercospora, and Aspergillus. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Prevalence of Seed-Borne Fungi on Soybean (Glycine max L. Merr.) Seeds Stored Under Medium-Term Cold Room Facilities: Implications for Genebanks

This study examined the prevalence of seed-borne fungi in polyethylene plastic-packaged soybean seeds stored in a genebank and identified factors influencing their incidence. Twenty-four seed lots were sampled from the collection stored at 10 °C in the World Vegetable Center genebank in Arusha, Tanzania. The seeds used were those regenerated and harvested in 2015, 2016, and 2017. A seed health test was conducted for sterilized seeds on potato dextrose agar, sterilized seeds on top of the paper, and unsterilized seeds on top of the paper. Seven-year-old sterilized seeds plated on top of the paper exhibited the highest germination percentage (74 ± 7.09%) and lowest fungal incidence (7.00 ± 4.41%). Conversely, seven-year-old unsterilized seeds plated on top of the paper had the lowest germination (22.00 ± 6.97%) and highest fungal incidence (79.00 ± 8.31%). Older seed lots showed significantly higher equilibrium seed moisture content (Eqmc), though seed age had no significant influence on germination percentage or fungal incidence. Seed germination percentage showed a significant negative relationship with Eqmc, though Eqmc had no significant effect on fungal incidence. Meanwhile, germination percentage showed a significant negative relationship with fungal incidence. Six fungi isolates were identified using their morphological features from soybean seed samples: Absidia glauca, Aspergillus niger, Fusarium spp., Mucor hiemalis, Pestalotiopsis versicolor, and Sordaria macrospora. It is concluded that high fungal incidence negatively affects seed germination but is not significantly correlated with seed moisture content. The dry and cold storage conditions in the genebank, while effective in extending seed longevity, can unintentionally allow seed-borne mycoflora to persist. Although fungi may not actively proliferate under these conditions, they may do so when favorable conditions are restored, such as during germination tests, and consequently may compromise seed viability. Therefore, this study emphasizes the importance of increased systematic seed health checks before storage in genebanks to ensure optimal seed quality, and the replacement of all polyethylene plastic bags to aluminium foil packaging.

Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.

Optical detection of single and multiple seeding using an innovative shape-recognition algorithm

The ability to accurately and continuously monitor seeding quality allows farmers to improve their seeding practices, maintain appropriate seed spacing, and maximize crop productivity. The precise detection and counting of individual seeds, especially those that pass through and overlap in pairs or multiples, is a major challenge in developing seed monitoring systems. In this research, a novel shape-based algorithm is presented that utilizes seven pairs of 3-mm infrared LEDs to efficiently recognize and count both single seeds and overlapping seeds. The outputs of the receivers were converted to binary signals by comparing them to samples taken when no seed flow was present. Each infrared receiver acted as a pixel, and to recognize and count multiple seeds, their outputs were temporarily stored in a matrix with seven columns. When the seeds passed the sensor, their outputs were analyzed together using an innovative and systematic clustering algorithm. This enables shape-based processing and recognition of passing seeds regardless of type and size, effectively reducing counting errors. The developed system was subjected to testing using seven different seed types on a conveyor belt, while one seed type underwent testing on a precision corn seeder in the laboratory. The results indicated a high level of agreement between the sensor data and the actual seed rates. The average counting accuracy for popcorn, hybrid corn, chickpea, pinto beans, coated tomato, mung beans, and soybean seeds on the conveyor belt platform was 0.99, 0.99, 0.98, 0.96, 0.8, 0.99, and 0.99, respectively. The results showed that the accuracy of the algorithm increases with increasing sphericity and size of the seeds relative to the distance between the adjacent LEDs. Moreover, the counting accuracy exceeded 97% for all rates on the precision corn seeder platform, with an average accuracy of 0.986.

SHORT-ROOT specifically functions in the chalazal region to modulate assimilate partitioning into seeds.

Nourishing the embryo with endosperm and enclosing both embryo and endosperm in the seed coat are two important evolutionary innovations. Seed coat is conventionally viewed as a protective layer that functions after the seed has matured. Here, we challenge this notion by showing that a subregion of the seed coat, termed the chalazal seed coat (CZSC), is geared to gate seed nutrition loading in developing seeds. The CZSC develops the coordinative system comprising the apoplastic isolation, mediated by the restricted suberization, and the active transport, mediated by the specific expression of a variety of transporters, at as early as the globular embryo stage in both Arabidopsis and soybean seeds. This coordinated system in the CZSC disrupts the vascular continuum to the maternal tissues and forces the nutrient transport into selective and active absorption. We further reveal that the precision of the spatiotemporal suberin deposition and transporter expression is controlled by the regulatory hierarchy of SHR-MYBs cascades. Our results provide a mechanistic insight into the assimilate accumulation in dicot seeds.

Contrasting germination behavior of nodding broomrape towards soybean seeds- and sprouts-extract is associated with their corresponding phytohormones, sugars and isoflavones contents

Contrasting germination behavior of nodding broomrape towards soybean seeds- and sprouts-extract is associated with their corresponding phytohormones, sugars and isoflavones contents

Influence of terrain slopes on the longitudinal distribution of soybean seeds of two different seeders

Soybean is a widespread crop in world agriculture and is also of great importance for Brazilian agriculture and economy. Sowing with the correct longitudinal distribution of seeds plays an important role in the optimum development of the crop. A sowing can be influenced by dosing mechanisms, conductor tubes, soil covering, and different terrain slopes. Thus, this article presents the performance of two seeders (Semeato® Multiple SSM 27 ROTO and John Deere® 1111A), submitted to terrain slopes of +23%, 0%, and -23%, regarding seed distribution in the population and the percentage of acceptable, faulty, and multiple spacing. The in loco experimental data presented is scarce in the literature and may be useful for application in other lands. While for Semeato® Multiple SSM 27 ROTO, 0% and +23 slopes presented higher multiple spacing averages, for John Deere® 1111A, the slopes did not influence the multiple spacing occurrence. Nonetheless, in the studied area, the Semeato® Multiple SSM 27 ROTO presented results for the plant population closer to the desired reality.

Effects of nano-MoO3 on growth, quality and toxicity of soybean.

Metal nanoparticles are widely used in agricultural production. As a new type of molybdenum fertilizer, MoO3NPs have the properties of nanomaterials and the characteristics of molybdenum nutrition. Previous studies have focused on their role in promoting crop growth. However, it is unknown whether excessive MoO3NPs will affect crop quality and nutritional value. In this study, the effects of different concentrations of MoO3NPs (0, 0.15, 0.5, 1.0, 5.0, 10, 50, 100 mg kg-1) on the growth and quality of soybean were investigated by pot experiments to analyze the plant effects caused by MoO3NPs. The results showed that the effects of MoO3NPs treatment on plant biomass and nodule number were promoted at low concentrations (0.15-5 mg kg-1) and inhibited at high concentrations (10-100 mg kg-1). According to the logistic distribution model, it was predicted that MoO3NPs would have the strongest toxic effect on soybean flowering stage. The contents of MoO3NPs which reduced the yield of soybean by 10% and 20% were 12.38 and 30.81 mg kg-1. NP0.15 could significantly improve the total amount of amino acids in grains, while NP100 reduced the total amount of amino acids in grains, both of them significantly increasing the contents of linolenic acid and linoleic acid in soybean seeds. A change of MoO3NPs concentration had no negative effect on the nutritional value of soybean grains. The research could lead to a better understanding of the potential impact of nutritional changes caused by MoO3NPs on human health. © 2024 Society of Chemical Industry.

Effect of Modified Atmospheric Storage on Seed Longevity of Soybean [Glycine max (L.) Merr.

Seed quality is crucial for boosting seed production and productivity. However, soybean seeds are inherently short lived, quickly loses viability even under optimal storage conditions. Therefore, maintaining their quality during storage is of prime importance. Keeping these in view a laboratory experiment was conducted to study the effect of modified atmospheric storage on seed quality of soybean (cv. DSb 34). The freshly harvested seeds with initial moisture content of 7.6% were stored in different modified atmospheric gaseous combinations for nine months from November 2023- August 2024. Results indicated that the seeds stored with gaseous combination of 90 % CO2: 4 % O2: 6 % N2 in 700 gauge polyethylene bag maintained better seed quality in terms of germination (86.77%), shoot length (14.49 cm), root length (12.58 cm), dry weight(0.995g/ 10 seedlings), seedling vigour index I (2349) and II (86.34) upto the end of nine months storage period by recording higher total dehydrogenase (0.438 OD value), α- amylase (10.72 µmol of maltose released min-¹ ml-1 of enzyme) and catalase activity (1.364 µmol H₂O₂ decomposed minˉ¹gˉ¹ protein) compared to all other gaseous combinations and control. Hence, this technique can be used to maintain seed longevity with little deterioration, ensuring the quality of seeds even after extended storage period.

Identification of Candidate Genes for Soybean Storability via GWAS and WGCNA Approaches

Soybean (Glycine max (L.) Merr.) is an important crop for both food and feed, playing a significant role in agricultural production and the human diet. During long-term storage, soybean seeds often exhibit reduced quality, decreased germination, and lower seedling vigor, ultimately leading to significant yield reductions in soybean crops. Seed storage tolerance is a complex quantitative trait controlled by multiple genes and is also influenced by environmental factors during seed formation, harvest, and storage. This study aimed to evaluate soybean germplasms for their storage tolerance, identify quantitative trait nucleotides (QTNs) associated with seed storage tolerance traits, and screen for candidate genes. The storage tolerance of 168 soybean germplasms was evaluated, and 23,156 high-quality single nucleotide polymorphism (SNP) markers were screened and analyzed through a genome-wide association study (GWAS). Ultimately, 14 QTNs were identified as being associated with seed storage tolerance and were distributed across the eight chromosomes of soybean, with five QTNs (rs25887810, rs27941858, rs33981296, rs44713950, and rs18610980) being newly reported loci in this study. In the linkage disequilibrium regions of these SNPs, 256 genes were identified. By combining GWAS and weighted gene co-expression network analysis (WGCNA), eight hub genes (Glyma.03G058300, Glyma.04G1921100, Glyma.04G192600, Glyma.04G192900, Glyma.07G002000, Glyma.08G329400, Glyma.16G074600, Glyma.16G091400) were jointly identified. Through the analysis of expression patterns, two candidate genes (Glyma.03G058300, Glyma.16G074600) potentially involved in seed storage tolerance were ultimately identified. Additionally, haplotype analysis revealed that natural variations in Glyma.03G058300 could affect seed storage tolerance. The findings of this research provide a theoretical foundation for understanding the regulatory mechanism underlying soybean storage.

Sustainable biomass derived natural surfactant of soybean seeds in fly ash industrial waste utilization for carbon storage: Evaluation of environmental impact

The rising carbon emissions challenge global environmental sustainability and climate stability. This study aims to advance climate change mitigation by integrating fly ash and natural surfactant into CO2 sequestration strategies. Fly ash, a by-product of industrial processes, presents an opportunity for innovative reuse. By combining fly ash with a natural surfactant extracted from soybean seeds, both industrial waste management and greenhouse gas reduction can be addressed. The surfactant was characterized using Fourier transform infrared spectroscopy, scanning electron microscopy, surface tension, and electrical conductivity measurements, confirming saponin presence with a critical micelle concentration of 0.3 wt%. Pressure decay studies revealed that a (5 wt% fly ash + NS) demonstrated the highest CO2 absorption, supported by microscopic analysis. Further research on optimizing reaction conditions and kinetics of mineralization could enhance this method’s efficiency and scalability for broader application.

Quantitative and qualitative damage caused by Halyomorpha halys (Hemiptera: Pentatomidae) on soybean crop at different growth stages

The brown marmorated stink bug Halyomorpha halys, an invasive species native to East Asia, is now present and abundant on soybean throughout Europe where it has become a major pest damaging the crop. Because a better understanding of the impact of H. halys is crucial to implement effective and sustainable pest management, the present study aimed to assess the stages at which soybean is most susceptible to H. halys attacks, and the qualitative and quantitative alterations caused by its feeding on soybean seeds. Therefore, soybean plants were exposed to stink bug adults for 2 weeks at different development stages and were examined at harvest for damage. Stay-green syndrome occurred most severely as a result of H. halys attacks at soybean development stages R4-R5. In the same period, the bug feeding activity significantly reduced the number of seeds per pod, thus indicating a higher damage rate at the R4-R5 stage when soybean surveillance should be intensified in order to properly target pest management strategies. The lower number of seeds per pod corresponded to an increase in the seed weight due to plant compensation mechanisms, leading to grain yields that did not differ in relation to the time of attack or the rate of damaged seeds. However, while not causing overall a loss of weight production, H. halys attacks were shown to cause qualitative damage to soybean seeds, especially by altering protein content and mobilizing several primary metabolites from storage macromolecules, which will have to be considered depending on the intended use of the production.

Co-Inoculation of Soybean Seeds with Azospirillum and/or Rhizophagus Mitigates the Deleterious Effects of Waterlogging in Plants under Enhanced CO2 Concentrations

Co-Inoculation of Soybean Seeds with Azospirillum and/or Rhizophagus Mitigates the Deleterious Effects of Waterlogging in Plants under Enhanced CO2 Concentrations

Germination of soybean seeds after low-temperature storage and its dependence on weather and climate conditions in the places of reproduction of accessions

Background. Soybean (Glycine max (L.) Merr.) is a microbiotic whose seeds quickly lose germination in uncontrolled conditions at room temperatures. This determines the need to preserve accessions in special conditions. Low temperature storage (LTS) allows to maintain high seed germination ability, but not for all accessions. Therefore, it is relevant to assess the results of LTS at the VIR Genebank and to make an attempt to determine the best geographical conditions for growing plants and harvesting seeds that will be subjected to LTS. Materials and methods. The work was carried out on 312 soybean accessions from the VIR collection, originating from almost the entire area of soybean cultivation. The accessions used in the research were reproduced at three VIR experiment stations (ES), namely Adler ES, Kuban ES (Krasnodar Territory) and the Far East ES (Primorsky Territory). The seeds were harvested in 1999 to 2017 and stored in sealed foil laminated bags at –10°C from 2002 to 2021. The accessions were removed from LTS and germination assessed in 2022. Results. At the beginning of LTS, seed germination (Gi) ranged from 12 to 100% (averaging 79.1%), while that after LTS (Gr) ranged from 1 to 97% (57.8% on average). The retention of germination ability was expressed as the germination index (GI = Gr / Gi), which ranged from 0.02 to 1.73 (an average of 0.72). All the indicators of germination in the range of up to 20 years of LTS were not associated with the duration of LTS and with the number of years before LTS (0.5-4 years in our research). The climatic conditions characteristic of the place of reproduction had a significant impact on Gi and Gr, but not on GI. The average Gi of seeds obtained at the Adler ES and Kuban ES did not differ significantly (77.4% and 75.7%), while that of seeds harvested at the Far East ES was significantly higher (84.0%). Gr of the accessions from the Far East ES (64.3%) was also greater than that of accessions from the Kuban ES (52.2%) and Adler ES (57.2%). The excessively high sum of temperatures above 10°C (recorded in some years at all stations) reduced Gi, Gr but had little effect on GI. The highest values of Gi, Gr, and GI were demonstrated by the accessions maturing in 101-120 days. Additionally drying of the most late-ripening accessions (later than 140 days) in sheaves under an awning yielded seeds with high germination ability and good LTS tolerance. Conclusion. The seeds from different places of reproduction of accessions differed in germination before and after LTS, and, on an average, the highest values were demonstrated by the seeds harvested at the Far East ES, where the temperature regime is closer to the optimal one for soybeans. The seed germination index showed relative independence from the conditions of reproduction of accessions, including the climate and weather conditions, as well as the initial germination ability and LTS duration.

Application of Pyroligneous Acid as a Plant Growth Stimulant Can Improve the Nutritional Value of Soybean Seed

Farmers today are using biochemical treatments to improve their crop yields. Commercialized organic biostimulants exist in the form of pyroligneous acid generated by burning agricultural waste products. During the 2023 growing season, we demonstrated that soil treatment with a commercial pyroligneous acid product, Coriphol™, manufactured by Corigin Solutions, Inc., stimulated plant growth and significantly improved yield with an optimal treatment dose of 2 gal. acre−1. In the present work, we examined the effect of this treatment on soybean nutritional content using seed harvested from the 2023 season. Total mean seed protein content for untreated control plants was 32.26 ± 0.49% of dry mass and increased 10.8% to 35.64 ± 0.64% with treatment. This increase resulted in a net reduction in total free amino acid content, although levels of the essential dietary amino acid, lysine, were boosted 6-fold. Total lipid content was unaffected by treatment with mean levels of 21.61 ± 0.70% of dry mass noted. Treatment, however, reduced saturated fatty acid content by roughly 40%, and reduced the polyunsaturated content of linoleic acid in favor of the monounsaturated fatty acid, oleic acid. Finally, Coriphol™ treatment did not impact seed content of eight essential micronutrients including Na, Mg, K, Ca, Fe, Ni, Cu, and Mo, but did significantly boost Zn and Mn levels. Altogether, these results demonstrate that soil treatment with the growth stimulant Coriphol™ has the potential to improve the dietary nutritional value of soybean.

Knockdown of β-conglycinin α' and α subunits alters seed protein composition and improves salt tolerance in soybean.

Soybean is an important plant source of protein worldwide. Increasing demands for soybean can be met by improving the quality of its seed protein. In this study, GmCG-1, which encodes the β-conglycinin α' subunit, was identified via combined genome-wide association study and transcriptome analysis. We subsequently knocked down GmCG-1 and its paralogues GmCG-2 and GmCG-3 with CRISPR-Cas9 technology and generated two stable multigene knockdown mutants. As a result, the β-conglycinin content decreased, whereas the 11S/7S ratio, total protein content and sulfur-containing amino acid content significantly increased. Surprisingly, the globulin mutant exhibited salt tolerance in both the germination and seedling stages. Little is known about the relationship between seed protein composition and the salt stress response in soybean. Metabonomics and RNA-seq analysis indicated that compared with the WT, the mutant was formed through a pathway that was more similar to that of active salicylic acid biosynthesis; however, the synthesis of cytokinin exhibited greater defects, which could lead to increased expression of plant dehydrin-related salt tolerance proteins and cell membrane ion transporters. Population evolution analysis suggested that GmCG-1, GmCG-2, and GmCG-3 were selected during soybean domestication. The soybean accessions harboring GmCG-1Hap1 presented relatively high 11S/7S ratios and relatively high salt tolerance. In conclusion, knockdown of the β-conglycinin α and α' subunits can improve the nutritional quality of soybean seeds and increase the salt tolerance of soybean plants, providing a strategy for designing soybean varieties with high nutritional value and high salt tolerance.

Screening Germplasms and Detecting Quantitative Trait Loci for High Sucrose Content in Soybean

Sucrose is a desirable component of processed soybean foods and animal feed, and thus, its content is used as an important characteristic for assessing the quality of soybean seeds. However, few studies have focused on the quantitative trait loci (QTLs) associated with sucrose regulation in soybean seeds. This study aims to measure the sucrose content of 1014 soybean accessions and identify genes related to high sucrose levels using QTL analysis. Colorimetric analysis based on the enzymatic reaction of invertase (INV) and glucose oxidase (GOD) was employed to test the germplasms. A total of six high-sucrose genetic resources (IT186230, IT195321, IT263138, IT263276, IT263286, and IT276521) and two low-sucrose genetic resources (IT025668 and IT274054) were identified. Two F2:3 populations, IT186230 × IT025668 and Ilmi × IT186230, were then established from these germplasms. QTL analysis identified four QTLs (qSUC6.1, qSUC11.1, qSUC15.1, and qSUC17.1), explaining 7.3–27.6% of the phenotypic variation in the sugar content. Twenty candidate genes were found at the four QTLs. Notably, Glyma.17G152300, located in the qSUC17.1 QTL region, exhibited a 17-fold higher gene expression in the high-sucrose germplasm IT186230 compared to the control germplasm Ilmi, confirming its role as a major gene regulating the sucrose content in soybean. These results may assist in marker-assisted selection for breeding programs that aim to develop soybean lines with a higher sucrose content.

Tyrosinase Inhibitory Activity of Crude Procyanidin Extract from Green Soybean Seed and the Stability of Bioactive Compounds in an Anti-Aging Skin Care Formulation

Green soybean (Glycine max L.) seed contains a high procyanidin content and high antioxidant activity. Moreover, ultrasound-assisted extraction (UAE) has proved to be advantageous in providing high extraction efficiency. Hence, this study aimed to extract procyanidins from green soybean seeds (GSSs) using UAE. This study also evaluated the inhibitory activities of tyrosinase and the cytotoxic effects of crude procyanidin extract. The extract exhibited maximum levels of bioactive components and antioxidant capacity when subjected to a temperature of 15 °C and an extraction time of 20 min. The crude procyanidin extract at a concentration of 10 mg/mL inhibited the tyrosinase enzyme by more than 60%, and the half-maximal inhibitory concentration (IC50) value obtained for the extract was 6.85 ± 0.81 mg/mL. This result was much greater than the IC50 value obtained for kojic acid (0.089 ± 0.08 mg/mL), which was used as a positive control. For the cytotoxicity assessment, the results indicated that the crude procyanidin extract showed no cytotoxicity and actually stimulated the growth of human skin fibroblast cells. More than 80% of the bioactive compounds (total phenolic content (TPC), total flavonoid content (TFC), procyanidin content (PC)) and antioxidant activities (DPPH and FRAP) of the crude extract powder were retained at 38.68 ± 0.01 mg GAE/g, 16.07 ± 0.01 mg CAE/g, 9.24 ± 0.01 mg PC/g, 359.8 ± 0.72 μM Trolox eq/g, and 1640 ± 2.86 μM Trolox eq/g, respectively, after 12 weeks of storage at 25 °C. The crude procyanidin extract powder was then included in a facial serum formulation and tested for pH value and physical evaluation. The stability of the crude procyanidin extract facial serum was shown to be greater for bioactive compounds and antioxidant activity when stored at a temperature of 4 °C than when stored at a temperature of 25 °C. These results suggest that the GSS extracts obtained via ultrasonication show promise for use in cosmeceutical formulations for whitening skincare products.

Determination of Moisture Sorption Isotherm using Brunauer-Emmett-Teller (BET) and Guggenheim-Anderson-de Boer (GAB) Models, Germination Capacity and Index Vigor of Soybean during Storage

Understanding the interaction between the equilibrium moisture content of a product and the surrounding air is crucial for guaranteeing product quality and preserving its characteristics throughout storage. The study of this tendency may be conducted utilizing sorption isotherms. This research aimed to study the moisture sorption characteristics of soybeans during storage, identify the most suitable mathematical model for the experimental data, and examine the relationship between the germination capacity and vigor index of soybeans with their moisture content and water activity. Moisture sorption characteristics of soybean, Anjasmara variety, were investigated at temperatures of 30ᵒC, 40ᵒC, and 50ᵒC, and water activities of 0.08 to 0.80, and were modelled using two different mathematical models, Brunauer-Emmett-Teller (BET) and Guggenheim-Anderson-de Boer (GAB). Both two mathematical models, BET and GAB, were found to effectively describe the moisture sorption data based on regression analyses and goodness of fit. Each model was statistically evaluated by coefficient of determination and deviation standard. The moisture sorption behaviour of soybean seeds displayed a sigmoidal pattern. The GAB models have been suggested to estimate the moisture content at certain humidity levels at 30ᵒC, 40ᵒC, and 50ᵒC temperatures. The BET models were suitable for temperatures between 30ᵒC and 40oC. The vigor and germination indicated exhibited a progressive and optimal trend at a water activity level of 0.32, followed by a decline at all three temperatures.