South American Fruit Fly Research Articles

Male Courtship Behavior of the South American Fruit Fly,Anastrepha fraterculus, from an Argentinean Laboratory Strain

The South American fruit fly Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is a pest of fruit species of warm regions of the Americas, including Argentina. Some authors claim that this taxon includes a group of cryptic species. In order to evaluate possible targets of sexual selection, it is necessary to analyze ethological aspects of male courtship and identify particular steps that strongly influence mating success. A mating test designed to evaluate behavioral differences between insects that achieve copulation (successful males) and those that did not mate (unsuccessful males) could also be relevant for the possible implementation of control programs based on sterile insect technique. Reared insects need to be evaluated periodically, since genetic drift and artificial selection associated with rearing conditions could have a detrimental effect on their ability to compete for matings in nature. In this study, courtship behavior of A. fraterculus males from a laboratory strain was analyzed for the first time through video recordings. Three components for the activities were identified: calling, wing positions, and movements. Also, the time that males spent on each step of the courtship was registered, including the last activities before attempting copulation. Data showed that mating achievement occurs relatively quickly; 65% of the successful males reached copulation within the first ten minutes after the male and female were placed together. Behavioral differences were detected between successful and unsuccessful males. The former group tended to invest more time in activities directly related with mating (Spin, Arrowhead, Attempt); however, as courtship progressed, unsuccessful males increased the time dedicated to activities not directly associated to mating (Call 0, Relax,Stationary). There was not a single sequence of activities leading to success, but the analysis of the last activities performed before mating attempts indicated that the most frequent position before successful attempts was Arrowhead, occurring in 68% of cases, whereas in unsuccessful males this position was observed only 18% of the time before mounting. Although the behavior of the strain analyzed here should be compared with that of natural populations, one would not expect to observe significant differences as compatibility and competitiveness with wild collected flies was previously shown under field cage conditions. Behavioral tests such as those applied here might be important to assess quality of mass reared strains for sterile insect technique implementation programs.

Multiple mating in Anastrepha fraterculus females and its relationship with fecundity and fertility

The occurrence of female remating has been widely reported in insects and the frequency at which it occurs and the factors driving females’ remating behavior have been shown to be both species specific and variable within species. Herein, we studied the remating behavior of females from a well established laboratory colony and a wild population of the South American fruit fly, Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae), under laboratory conditions. Latency to first mating (number of days from the onset of the experiment until the first copula) was shorter for remating females than for females that did not remate. Two-day fecundity was higher for females that did remate than for monogamous females. Egg hatch was sustained after remating and was not affected by the number of times the female mated. However, when females willing to remate were prevented from doing so, percent egg hatch showed a significant drop. These results and the fact that remating occurred more often in more fecund females than in less fecund ones suggest that remating may be a response to sperm depletion. Remating frequency was similar in laboratory and wild flies, but 2-day fecundity was higher for laboratory than for wild females of similar mating status. Also, the length of the refractory period (time between first and second copulation) was longer for wild than for laboratory females. Differences between strains could be the result of artificial selection. Results are discussed from a theoretical and applied perspective in the context of direct benefits to females.

Factors affecting Anastrepha fraterculus female receptivity modulation by accessory gland products

In the context of the sterile insect technique (SIT), mass-rearing and male irradiation are imperative. Post-teneral treatments such as the addition of protein in adult′s male diet and male hormonal treatment are used to improve sexual performance and to accelerate sexual maturation. In this work we investigated the effect of male accessory glands products (AGPs) on female receptivity of the South American fruit fly Anastrepha fraterculus (Wiedemann), and the effect of strain rearing history, male irradiation, male diet and hormonal treatment on AGPs. Injections of aqueous extracts of male accessory glands into the abdomen of females reduced their receptivity. The AGPs from laboratory males were more effective in inhibiting female receptivity, compared to AGPs from wild males, irrespective of females’ origin. The AGPs from fertile males were more effective than AGPs from sterile males. The AGPs from protein-fed males were more effective than AGPs from sugar-fed males. Finally, the AGPs of males treated with juvenile hormone were less effective in inhibiting female receptivity than AGPs of untreated males. We conclude that inhibition of sexual receptivity of A. fraterculus mated females is mediated by products in male accessory gland’s and the way that these products act vary widely according to the effect of extrinsic factors. We discuss the results in the perspective of the SIT application for A. fraterculus.

Management of protein intake in the fruit fly Anastrepha fraterculus

This work tested if carbohydrates and proteins ingestion is regulated in the South American fruit fly, Anastrepha fraterculus, to optimize survival and reproduction. Adult food treatments were established by providing sugar and hydrolyzed yeast in various combinations either alone or mixed at a standard 3:1 ratio (sugar:hydrolyzed yeast). Individual food consumption was assessed and related to survival patterns. The effects of adult feeding on fecundity and fertility patterns were investigated in groups of flies. Sugar consumption was the lowest in the treatment where it was provided with hydrolyzed yeast at a fixed 3:1 ratio. Consumption of hydrolyzed yeast did not differ between this treatment and the one in which this solution was complemented with one solution of sugar. It seems that a mixture of sugar and hydrolyzed yeast at a fixed ratio of 3:1, respectively, restricts extra ingestion of sugar; most probably because of negative response of the fly to overconsumption of protein. Survival was affected by the treatments, being lower in those cases where protein was at the fixed ratio. Group experiments revealed that protein restriction expanded longevity and decreased egg production. In contrast, egg production was enhanced when flies were kept continuously with a mixture of yeast and sugar plus an extra source of sugar, and this was not in detriment of survival. Our results suggest that fixed sugar-protein ratios in which protein is in excess affects fitness components such as longevity and reproduction. These findings are discussed from a theoretical and applied perspective in the context of pest control by means of the sterile insect technique.

Laboratory evaluation of phytosanitary products used for control of the South American fruit fly, Anastrepha fraterculus, in organic farming

The South American fruit fly, Anastrepha fraterculus (Wied.), is one of the principal pests of fruit crops in Brazil. While organic farms use several compounds to control fruit flies, such as oils, plant extracts and soaps, there is little scientific evidence of their effectiveness. Our main goal was to evaluate the phytosanitary products used in organic orchards on A. fraterculus under laboratory conditions. Four multiples (0.25×, 0.5×, 1× and 2×) of the manufacturer-recommended concentrations of Rotenat CE ® (extract of Derris spp. with rotenone 5%) (600 ml 100 l −1), Pironat ® (pyroligneous extract) (250 ml 100 l −1), Biopirol 7M ® (pyroligneous extract) (200 ml 100 l −1), Organic neem ® (neem oil 80%) (500 ml 100 l −1), Natuneem ® (neem oil – 1500 ppm of azadirachtin) (500 ml 100 l −1) and lime sulfur (20% S + 9% Ca) (5000 ml 100 l −1) were tested on A. fraterculus via ingestion and direct contact, topical application and residual application. We subsequently tested deterrence effects of the same products on oviposition. Organic Neem ®, Natuneem ®, lime sulfur, Pironat ®, and Biopirol 7M ® showed no insecticidal effect on the South American fruit fly. Only Rotenat CE ® (1200 ml 100 l −1) showed an effect (71.6% mortality) following ingestion/contact. Lime sulfur, Pironat ® and Biopirol 7M ® did not prevent oviposition of A. fraterculus on artificial fruits.

Diagnóstico da área cultivada com uva fina de mesa (Vitis vinifera L) sob cobertura plástica e do manejo de pragas

Neste trabalho, foi realizado o censo das áreas cultivadas com uvas finas de mesa sob cultivo protegido e a identificação das principais espécies de pragas e estratégias de controle empregadas pelos produtores, no município de Caxias do Sul-RS. Na safra de 2007/2008, foram identificados os produtores envolvidos com a atividade no município e através de entrevista presencial e semiestruturada ao estabelecimento produtivo, registrou-se a área cultivada e variedades. Para produtores com cultivo de áreas superiores a 2.000m² da cultivar Itália, com dois anos ou mais de produção, foi aplicado outro questionário na safra de 2008/2009 com o objetivo de levantar as informações referentes: a) espécies de insetos e ácaros-praga que danificam as uvas finas de mesa na propriedade, segundo o viticultor; b) conhecer a realidade do manejo de insetos e ácaros-praga na cultura; c) verificar os parâmetros que o produtor utiliza para a aplicação de inseticidas; d) conhecer os produtos aplicados, e e) identificar o tipo de assistência técnica recebida pelo viticultor. Foram identificados 43 produtores de uvas finas de mesa sob cultivo protegido com área total cultivada de 30,36 ha, sendo 70,31% desta área da cultivar Itália. As pragas mais importantes mencionadas pelos produtores foram tripes - Frankliniella rodeos Moulton e a mosca-das-frutas-sul-americana Anastrepha fraterculus (Wied). O manejo realizado para controle destas pragas é através da aplicação de inseticidas com os ingredientes ativos acefato e fentiona, respectivamente, com base em calendário. Os principais problemas enfrentados para implementar estratégias de manejo de pragas no cultivo são a falta de assistência técnica, a ausência de metodologias confiáveis para o monitoramento e o reduzido número de inseticidas autorizados para a cultura.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Injúrias causadas por mosca-das-frutas sul-americana em cultivares de videira

A mosca-das-frutas sul-americana, Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae), é uma das principais pragas da fruticultura no Brasil. O objetivo deste estudo foi identificar a suscetibilidade quanto à queda e deformação de bagas de diferentes cultivares/espécies de uva pela injúria causada pela oviposição de A. fraterculus. O trabalho foi realizado em vinhedos das cultivares 'Cabernet Sauvignon' (Vitis vinifera), 'Moscato Embrapa' (75% de V. vinifera) e 'Isabel' (Vitis labrusca), localizados em Bento Gonçalves (RS), na safra 2006/2007. Dois casais de A. fraterculus foram confinados por cacho, em gaiolas de tecido voile, durante os estádios fenológicos de grão ervilha, início da compactação, início da maturação e maturação plena dos cachos. Queda significativa de bagas devido ao ataque de A. fraterculus foi registrada na cultivar 'Cabernet Sauvignon' quando a infestação foi realizada nos estádios fenológicos de grão ervilha e início da compactação de cacho; estádios de grão ervilha em 'Moscato Embrapa'; e nos estádios de grão ervilha, início da compactação e início da maturação do cacho na cultivar 'Isabel'. Foi registrada deformação de bagas quando as infestações foram realizadas nos estádios de grão ervilha e início da compactação de cacho em 'Cabernet Sauvignon', 'Moscato Embrapa' e 'Isabel'. O desenvolvimento larval até a fase de pupa foi observado somente na cultivar 'Moscato Embrapa'.

Percepção química e visual de Anastrepha fraterculus (Diptera, Tephritidae) em laboratório

A mosca-das-frutas-sul-americana, Anastrepha fraterculus (Wiedemann, 1830), é uma das principais pragas da fruticultura no Brasil. Durante a alimentação, as larvas fazem galerias nos frutos, alterando o sabor e prejudicando a produção e comercialização dos mesmos. O presente trabalho teve como objetivo estudar fatores envolvidos na escolha do hospedeiro por A. fraterculus. Foram avaliadas as respostas eletroantenográficas de machos e fêmeas a extratos etanólicos de frutos verdes e maduros de pessegueiro - Prunus persica, cultivar Chimarrita (Rosaceae), pitangueira - Eugenia uniflora (Myrtaceae), guabirobeira - Campomanesia xanthocarpa (Myrtaceae) e araçazeiro - Psidium cattleianum (Myrtaceae). Foram também observadas as influências da cor (amarela, verde e vermelha) e da composição do substrato de oviposição (polpas de araçá, guabiroba, pitanga e pêssego) na fecundidade da espécie. As respostas eletroantenográficas de fêmeas foram significativamente distintas para os extratos de guabiroba verde e madura, araçá maduro e pitanga verde. Em antenas de machos, as maiores despolarizações médias foram registradas em resposta aos extratos de guabiroba verde e madura, araçá verde e maduro e pitanga verde. As respostas eletrofisiológicas geradas não diferiram estatisticamente entre os sexos, para todos os tratamentos. A cor do substrato não afetou a oviposição. As fêmeas ovipositaram mais nos substratos contendo polpa de pêssego e de guabiroba, quando comparados aos respectivos controles.

Flutuação populacional de adultos de Anastrepha fraterculus (Wied.) em cultivo protegido e convencional de videira

A mosca-das-frutas sul-americana, Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae), é considerada praga-chave das fruteiras de clima temperado na região Sul do Brasil. No entanto, poucas informações encontram-se disponíveis quando a espécie está associada à cultura da videira. Neste trabalho, foi avaliado o efeito da cobertura plástica sobre a população de adultos de A. fraterculus durante o ciclo de cultivo da videira cv. Moscato Giallo. O experimento foi conduzido nos ciclos de 2005/06 e 2006/07, em vinhedo comercial localizado em Flores da Cunha-RS (latitude 29° 06' sul, longitude 51° 20' oeste e altitude de 541 m), coberto com plástico impermeável tipo ráfia (160 µm) de 12 fileiras com 35 m, deixando-se cinco fileiras sem cobertura (controle). Os adultos foram monitorados nas duas áreas com armadilhas McPhail, utilizando-se como atrativo de proteína hidrolisada (BioAnastrepha®) a 5%, no período de outubro a abril, nos dois ciclos. O pico populacional da espécie, nos dois ciclos, foi observado no período de maturação da uva. Não foram registradas diferenças significativas nas capturas entre as áreas, concluindo-se que a cobertura plástica não afeta a mobilidade e a flutuação populacional de A. fraterculus em cultivo protegido de videira.

Efficacy of indigenous entomopathogenic nematodes (Rhabditida: Heterorhabditidae, Steinernematidae), from Rio Grande do Sul Brazil, against Anastrephafraterculus (Wied.) (Diptera: Tephritidae) in peach orchards

Laboratory, greenhouse, and field experiments were performed with the objective of selecting efficient indigenous strains of entomopathogenic nematodes (EPNs) from Rio Grande do Sul (RS) state, Brazil, for controlling the South American fruit fly, Anastrepha fraterculus (Wied.). Laboratory experiments were conducted in 24 well-plates filled with sterile sand and one insect per well. In greenhouse experiments, plastic trays filled with soil collected from the field were used, while in field experiments, holes were made in soil under the edge of peach tree canopies. Among 19 EPN strains tested, Heterorhabditis bacteriophora Poinar RS88 and Steinernema riobrave Cabanillas, Poinar, & Raulston RS59 resulted in higher A. fraterculus larval (pre-pupal) and pupal mortality, with LD 90 of 1630, 457 and 2851, 423 infective juveniles (IJs)/cm 2, respectively. Greenhouse experiments showed no differences in pupal mortality at 250 and 500 IJs/cm 2 of either nematode. In the field, H. bacteriophora RS88 and S. riobravae RS59 sprayed individually over natural and artificially infested fruit (250 IJs/cm 2) resulted in A. fraterculus larval mortality of 51.3%, 28.1% and 20%, 24.3%, respectively. There was no significant difference in A. fraterculus pupal mortality sprayed with an aqueous suspension of either nematode; however, when using infected insect cadavers, H. bacteriophora RS88 was more efficient than S. riobrave RS59. Our results showed that H. bacteriophora RS88 was more virulent to insect larvae, with an efficient host search inside the infested fruit and control of pupae in the soil after being applied by aqueous suspension or infected cadavers.

Structural map of the polytene chromosomes from the salivary glands of South American fruit flyAnastrepha fraterculusWied (Diptera, Tephritidae)

Abstract This work presents a preliminary map showing the polytenized autosomic chromosomes from the salivary glands of South American fruit flies Anastrepha fraterculus (Wied) (Diptera, Tephritidae) sampled in Argentina, where it is a serious pest of commercial fruits. We base their identification on constant morphological structures (landmarks) and features of each autosome. The chromosome number is 2n= 10+XX/XY, but due to the intimate pairing between the two homologues, the number of observed elements is reduced to half of the autosome number, in polytenized tissues. Besides widening the cytological knowledge of the species, this map will allow the identification of chromosome rearrangements and would help to elucidate the taxonomic identity of A. fraterculus from other geographic origins.

DEMOGRAPHIC AND QUALITY CONTROL PARAMETERS OF ANASTREPHA FRATERCULUS (DIPTERA: TEPHRITIDAE) MAINTAINED UNDER ARTIFICIAL REARING

The integration of the sterile insect technique (SIT) in the management of the South American fruit fly Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) is a promising alternative to chemically-based control in those areas where it is sympatric with Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) or other tephritid species for which the SIT is being used. Implementation of the SIT requires the development of a cost effective mass-rearing protocol. In this work, we present demographic and quality control parameters for the A. fraterculus strain reared at the Estación Experimental Agroindustrial Obispo Colombres, Tucumán, Argentina. Considering the rearing cage as the reproduction unit, we observed that fecundity is optimal during the first 3 weeks after the onset of oviposition. Fertility was constant during this period. During 2003 and 2004, some improvements were made to the existing rearing protocol, which resulted in increased larval viability, pupal weight, and adult emergence. Current weekly egg production is 1 million per week. These eggs are used to maintain the colony and to assess quality parameters. Finally, research needs leading to improved yields and fly quality are discussed.

COMPARISON OF LONGEVITY BETWEEN A LABORATORY STRAIN AND A NATURAL POPULATION OF ANASTREPHA FRATERCULUS (DIPTERA: TEPHRITIDAE) UNDER FIELD CAGE CONDITIONS

The South American fruit fly Anastrepha fraterculus (Wiedemann) is one of the most destructive fruit pests in this region, infesting major fruit crops. Implementation of the sterile insect technique (SIT) as part of an area-wide integrated approach against this species requires information on the survival of mass-reared and sterilized insects in the field and their ability to mate with wild females. The survival rates in field cages of both non-irradiated and irradiated laboratory flies were compared with that of wild flies. Both types of laboratory flies survived longer than their wild counterparts over the 8 days under the experimental conditions. The irradiation dose (70 Gy) did not affect survival of the laboratory reared flies. Our results improve the prospect of integrating the SIT into the control of A. fraterculus populations in Argentina.

INDUCTION OF STERILITY IN ANASTREPHA FRATERCULUS (DIPTERA: TEPHRITIDAE) BY GAMMA RADIATION

Abstract In relation to the application of the sterile insect technique (SIT) for the South American fruit fly Anastrepha fraterculus (Wiedemann), we analyzed the effect on adult fertility of different doses of gamma irradiation and the age of pupae at the time of irradiation. In a first experiment, we applied doses of 50, 70, and 90 Gy to pupae at 24, 48, 72, and 96 h before adult emergence. In a second experiment we irradiated pupae 48 h before emergence with 20, 40, and 60 Gy and estimated male and female fertility and sperm transfer by irradiated males. The results indicated pupal age at irradiation does not significantly affect male fertility. If males irradiated with 60 Gy are crossed to non-irradiated females the fertility is about 1%. Females irradiated with 40 Gy did not lay eggs independently of the male to which they mated. No significant effects of radiation were observed with respect to the ability of males to transfer sperm. A dose of 70 Gy applied 48 h before adult emergence induces 100% st...

THE ESTABLISHMENT OF ACERATONEUROMYIA INDICA (HYMENOPTERA: EULOPHIDAE) IN THREE BIOGEOGRAPHICAL REGIONS OF ARGENTINA

Fil: Ovruski Alderete, Sergio Marcelo. Consejo Nacional de Investigaciones Cientificas y Tecnicas. Centro Cientifico Tecnologico Conicet - Tucuman. Planta Piloto de Procesos Industriales Microbiologicos; Argentina

Optimal Low-pressure Conditions for Long-term Storage of Fresh Commodities Kill Caribbean Fruit Fly Eggs and Larvae

U.S. regulations prevent importation of fresh horticultural commodities that have not received an approved quarantine treatment assuring 99.999% (Probit 9) mortality of potentially invasive insect pests. Because imported mangoes (Mangifera indica) are likely to be infested by the caribbean fruit fly (Anastrepha suspensa) and other tropical fruit flies in the Americas, such as the mexican fruit fly (A. ludens), guava fruit fly (A. striata), inga fruit fly (A. distincta), south american fruit fly (A. fraterculus), sapote fruit fly (A. serpentina), and the west indian fruit fly (A. obliqua), they must be hot-water treated prior to shipment in order to satisfy quarantine requirement. Hot water treatment often damages the fruit, especially if it is not fully mature. Hypobaric [low pressure (LP)] intermodal shipping containers developed by the VacuFresh Corp. preserve fresh commodities, such as horticulturally mature mangoes, far longer than is possible using other technologies. We tested the ability of caribbean fruit fly eggs and larvae to survive simulated optimal hypobaric conditions for shipment of mangoes [15 and 20 mm mercury (Hg), ≥98% relative humidity, 13 °C (the lowest, safe nonchilling temperature)]. Caribbean fruit fly eggs or larvae were maintained on agar media, flushed with one air change per hour at the storage pressure, and shielded with Mylar to prevent radiant heat uptake and limit evaporative cooling. Nearly 98% of the eggs and larvae were killed within 1 week at 15 and 20 mm Hg in nine replicated experiments. All eggs were killed by 11 days with a predicted kill of 99.999% of the eggs by 9.4 days in 15 mm Hg and 10.6 days in 20 mm Hg LP (based on Probit 9 statistical analysis), whereas a substantial number of eggs survived to 14 days at atmospheric pressure (760 mm Hg). Shipment of fresh produce using this technology promises to provide quarantine control while preserving the freshness of fully mature tropical fruits and vegetables.

Effectiveness of Metarhizium anisopliae against immature stages of Anastrepha fraterculus fruitfly (Diptera : Tephritidae)

The study evaluated the effectiveness of Metarhizium anisopliae var. anisopliae (Hyphomycetes : Moniliales) strain E9, isolated from the pasture spittlebug Deois flavopicta (Hemiptera : Cercopidae), against larvae, prepupae and pupae stage and emergent adults of Anastrepha fraterculus, the South American fruitfly. The bioassay was carried out simulating field conditions, on autoclaved (AS) and non-autoclaved (NAS) soil from typical citrus orchards in the State of Sao Paulo, Southeastern region of Brazil. Various concentrations of conidia were incorporated into the soil the mortality, calculated based on the percentage of adult emergence, was 86% for the highest conidia concentrations: 2.52 x 1010 for AS and 2.52 x 1010 for NAS. The lethal concentration (LC50), expressed as conidia concentration, was 8.44 x 109 conidia/g of soil (S) for AS and 12.23 x 109 conidia/g of soil for NAS.

Controle químico de Anastrepha fraterculus (Wied.) (Diptera: Tephritidae) em laboratório

O efeito de quatro novos grupos químicos de inseticidas incluindo avermectina (benzoato de emamectina), éter piretróide (etofemprox), neoniconitnóide (imidacloprid, thiacloprid e thiamethoxan) e naturalyte (spinosad) foram avaliados em laboratório (25 ± 3ºC, umidade relativa de 70 ± 10% e fotofase de 12 horas), visando ao controle de adultos e ovos/larvas de Anastrepha fraterculus comparando-os com os fosforados fenthion e thrichlorphon. O benzoato de emamectina não foi eficiente no controle de adultos de A. fraterculus via contato e ingestão. O etofenprox, imidacloprid, spinosad e thiamethoxan foram eficientes no controle de adultos de A. fraterculus via contato e ingestão, proporcionando maior mortalidade via ingestão. Os novos inseticidas não provocaram mortalidade significativa de ovos/larvas de A. fraterculus localizados no interior de maçãs, enquanto que os fosforados fenthion e thrichlorphon resultaram em 100% de mortalidade das fases imaturas e adultos. Os novos inseticidas apresentam potencial para uso nas iscas tóxicas, substituindo os fosforados para o controle de adultos.

Opiine and Eucoiline (Hymenoptera: Braconidae and Figitidae, respectively) parasitoids ofAnastrepha fraterculus(Diptera: Tephritidae) in citrus orchard areas in Corrientes, northeastern Argentina

Anastrepha fraterculus(Wiedemann), the South American fruit fly, andCeratitis capitata(Wiedemann), the Mediterranean fruit fly, are the only economically important Tephritidae species present in the citrus-growing areas in the province of Corrientes, northeastern Argentina. Both fruit fly species severely limit the export of fruit because of quarantine restrictions in importing countries. In this Argentinean region,C. capitatahas been reported mostly infesting cultivatedCitrusspecies such asC. sinensisL. (Osbeck) (Rutaceae) andC. paradisiMacfadyn (Rutaceae), whereasA. fraterculushas been found almost exclusively in wild guava (Psidium guajavaL. (Myrtaceae)), a wild host plant (Turica and Mallo 1961).