South Africa Research Articles

Effects of Human Resource Management Practices on Corporate Entrepreneurship at a State Agency in South Africa

Organisations face rapid changes brought about by economic, political, social and technological changes. These changes compel organisations to review their business strategies and turn to CE as an ultimate source of competitive advantage. Furthermore, the human resource management (HRM) function is crucial in formulating competencies and supporting organisations in achieving their strategic objectives. This study sought to determine the effects of HRM practices on CE at a South African state-owned agency. The study adopted a qualitative single case study design using semi-structured interviews through Microsoft Teams. A purposive sample of nine top management and human resources employees participated in the study. The interviews were recorded and subsequently analysed using ATLAS.ti 23. The study shows that three HRM practices, namely, recruitment and selection, training and development, and performance appraisal, positively affect the adoption of CE at the North West Development Corporation (NWDC) in South Africa. The study provides practical guidance on how state agencies can effectively invest and promote entrepreneurial behaviour for optimal performance. The study contributes to the body of knowledge by proposing a revised conceptual framework for increasing CE in HRM systems for internal innovation performance by incorporating HRM practices. This framework includes HRM practices such as job design, recruitment, training, performance appraisal, and compensation. Furthermore, the study introduces organisational development as a strategic contributor to the successful implementation of this framework.

Spectres of reparation in South Africa: an interview with Jaco Barnard-Naudé

Spectres of reparation in South Africa: an interview with Jaco Barnard-Naudé

Social restitution: tools and actions to rehumanise and transform injustice

Restitution has predominantly been described as a legal rather than a social action in international law, as well as in South Africa’s history of truth, reconciliation and redress policies after the end of apartheid. Introducing the concept of ‘social restitution’ this paper argues for a reimagined and wider understanding of restitution to address the need for social justice in the spaces between the law court and individual acts of charity, and between policies for redress and personal antipathy against these. Social restitution can be defined as intentional voluntary actions and attitudes developed through dialogue based on a sense of moral obligation aimed at addressing the damage done to individuals and communities by unjust actions and legacies of the past. Drawing on international debates about and understandings of the meaning of restitution, social restitution is shown to be both continuous with legal restitution and distinguished from it through its voluntary nature, its potential to be forward-looking rather than punitive, generative rather than accusatory, and offering everyday opportunities to bridge the gap between ‘knowing’ about injustice and ‘acting’ to repair it. Following this discussion, the latter part of the paper outlines the need for new categories of actors in contexts of injustice beyond those of victim, perpetrator and bystander (the Hilberg triangle of actors), introducing the ideas of beneficiaries and resisters; argues for the potential social restitution has as a mechanism for rehumanising all actors; and offers recommendations for how engaged action-oriented dialogues might contribute to achieving this aim, while noting the limits and dangers of dialogue. It draws on an empirical study on the meaning and actions of restitution conducted with black and white adult South Africans in making some of its arguments.

Challenges regarding the implementation of cervical cancer screening guidelines in Limpopo province, South Africa.

The World Health Organization's (WHO) call to eliminate cervical cancer is essential in improving structures and processes at primary healthcare facilities by galvanising change in providing cervical cancer screening services. The main objective of this study was to explore challenges affecting the implementation of cervical cancer screening guidelines in selected districts in Limpopo Province. The study was carried out at primary health care services (PHCs) in Vhembe and Mopani districts, Limpopo province. Qualitative non-experimental research design of an exploratory, descriptive and contextual nature of a qualitative paradigm to understand cervical cancer screening programme challenges from healthcare professionals' perspectives. The study population comprised two males and 16 female professional registered nurses working in Limpopo province's PHC services. The sample size was 18 professional nurses. A face-to-face interview guided by unstructured questionnaires was undertaken to elicit information regarding the implementation of cervical cancer screening services. Captured data were analysed using Tesch's open-coding method. The study revealed that the cervical cancer guidelines were not effectively implemented as there were contradictions and gaps when applying the guidelines about the management of HIV and AIDS, age restrictions and gestation. Furthermore, structural factors contributed to the inadequacy rate and failure to reach the set targets. Primary health care is an essential health care and human right; therefore, the government should ensure that guidelines and policies are supported financially and that professional nurses are capacitated for the efficient implementation of services.Contribution:Addressing the inequalities in the implementation of social policies for the prevention of cervical cancer prevention and improving the nurses' knowledge and practice behaviour regarding cervical cancer prevention are imperative.

Employing Reflexivity in Sexuality Socialisation Research: A Methodological Contribution from Psychosocial Studies

In this paper, we describe and demonstrate the value of adopting a psychosocial methodology to explore unique sexual socialisation experiences emphasising the role of reflexivity. Psychosocial methodology emerges from Psychosocial Studies, a “transdisciplinary” area interested in phenomena from “both” a social and personal perspective and in this paper is employed to investigate how sexual socialisation is shaped by psychological processes “and” social relations, and how these can be “thought together” (Frosh & Vyrgioti, 2022). Psychosocial data analytic strategies involve applying narrative and discursive psychology alongside psychoanalytic concepts to understand the possible reasons for a participant’s investment in particular discourses, understanding these investments as serving unique unconscious defensive purposes, alongside social functions. To illustrate this, we use data from a Free Association Narrative Interview with an isiXhosa-speaking “Black” socioeconomically disadvantaged woman in South Africa about her experiences of sexuality socialisation within her sister-sister relationship. We show how a psychosocial emphasis traverses traditional boundaries between discourse and affect, talk and experience, researcher and researched, moving across disciplinary spaces. Furthermore, we pay attention to what is frequently considered the background of research – the study context; the emotional quality of the interview encounter between the researcher and participant; the researchers’ relationship with one another and their contribution to both the data production and analysis. This emphasis on reflexivity in psychosocial methodology is consistent with the political and philosophical position of Psychosocial Studies that is critical of the reification of disciplinary knowledge.

South Africa’s solidarity fund: navigating the shores of uncertainty and crisis

South Africa’s solidarity fund: navigating the shores of uncertainty and crisis

Insights into mycobacteriome composition in Mycobacterium bovis-infected African buffalo (Syncerus caffer) tissue samples

Animal tuberculosis significantly challenges global health, agriculture, and wildlife conservation efforts. Mycobacterial cultures are resource-intensive, time-consuming, and challenged by heterogeneous populations. In this study, we employed a culture-independent approach, using targeted long-read-based next-generation sequencing (tNGS), to investigate the mycobacterial composition in 60 DNA samples extracted from Mycobacterium bovis infected culture-confirmed African buffalo tissue. We detected mycobacterial DNA in 93.3% of the samples and the sensitivity for detecting Mycobacterium tuberculosis complex (MTBC) was 91.7%, demonstrating a high concordance of our culture-independent tNGS approach with mycobacterial culture results. In five samples, we identified heterogenous mycobacterial populations with various non-tuberculous mycobacteria, including members of the Mycobacterium avium complex (MAC), M. smegmatis, and M. komaniense. The latter Mycobacterium species was described in South Africa from bovine nasal swabs and environmental samples from the Hluhluwe-iMfolozi Park, which was the origin of the buffalo samples in the present study. This finding suggests that exposure to environmental mycobacteria may confound detection of MTBC in wildlife. In conclusion, our approach represents a promising alternative to conventional methods for detecting mycobacterial DNA. This high-throughput technique enables rapid differentiation of heterogeneous mycobacterial populations, which will contribute valuable insights into the epidemiology, pathogenesis, and microbial synergy during mycobacterial infections.

Respiratory conditions and health symptoms associated with air pollution amongst children aged six years and below in Melusi Informal Settlement, Tshwane Metropolitan Municipality, South Africa: a cross-sectional study

BackgroundRespiratory conditions and health symptoms associated with air pollution in children are a major public health concern, as their immune systems and lungs are not yet fully developed. This study aimed to assess self-reported respiratory conditions and health symptoms associated with air pollution sources amongst children aged six years and below in Melusi informal settlement, Tshwane Metropolitan Municipality, South Africa.MethodsWith a quantitative cross-sectional study design, parents/caregivers of children aged six years and below (n = 300) from eight Early Childhood Development Centres were invited to participate in the study. This study employed complete sampling, and data was collected using the modified International Study of Asthma and Allergies in Children. The chi-square and multiple logistic regression models were used to analyze data, with p < 0.05 in the adjusted odds ratios considered as being statistically significant.ResultsThree models were run to examine the predictors of wheezing in the past 12 months, dry cough, and itchy-watery eyes. The model for asthma was excluded, as only seven participants reported having asthma. Wheeze in the past 12 months was associated with participants living in the area for more than three years (OR 2.96 95%CI: 1.011–8.674). Furthermore, having a dog in the house in the past 12 months was associated with wheeze in the past 12 months (OR 5.98 95%CI: 2.107–16.967). There was an association between duration of stay in a residence and dry cough prevalence (OR 5.63 95%CI: 2.175–14.584). Trucks always or frequently passing near homes was associated with itchy-watery eyes (OR 3.27 95%CI: 1.358–7.889). 59% (59%) of participants perceived the indoor air quality in their homes to be good, while 6% perceived it as poor. In contrast, 36% of participants perceived the outdoor air quality to be good, and 19.7% perceived it as poor.ConclusionThe association between perceived air pollution exposure, self-reported respiratory conditions, and health symptoms amongst children is complex. Further research is required to better understand the multifaceted nature of air pollution and its impact on the health of children.

Evaluating a hypofractionated radiotherapy schedule for prostate cancer at an institution in South Africa

Background: Hypofractionated radiotherapy (HFRT) in the treatment of prostate cancer (PCa) has logistical and cost advantages, especially in a resource constrained setting. Studies have demonstrated equivalent efficacy with HFRT schedules using Intensity Modulated Radiation Therapy (IMRT) as treatment modality. However, higher rates of acute and late gastrointestinal (GI) and genitourinary (GU) toxicity have been reported when compared to conventionally fractionated radiotherapy (CFRT). In this study, we evaluate the efficacy and toxicity rates of a HFRT schedule using 3D conformal radiotherapy (RT) as treatment modality.Aim: With this study, we aim to describe the safety and outcomes of a definitive HFRT schedule used for localised PCa. We hypothesise that there is no difference in the biochemical relapse rate and incidence rates of normal tissue toxicities between patients receiving CFRT and HFRT schedules.Setting: This RT schedule was used at Tygerberg Academic Hospital in South Africa for the treatment of localised prostate cancer.Methods: This is a retrospective study in which the records of patients diagnosed with localised PCa were reviewed. Patients were treated with either CFRT regimen to a total of 74Gy in 37 daily fractions for 5 days a week or a HFRT regimen to a total of 65Gy in 26 daily fractions for 4 days per week.Results: In all, 116 patients were included in the study with a median follow-up of 57.2 months from the start of RT. No statistically significant differences in overall survival (OS) and biochemical relapse-free survival were found between the two schedules. A significant difference in acute GI toxicity was observed, with a higher incidence noted in the HFRT schedule. No significant differences were observed in late GI toxicity or in early and late GU toxicities.Conclusion: This study observes a hypofractionated regimen using three-dimensional conformal radiation therapy (3DCRT) with similar efficacy and RT-related toxicities to CFRT.Contribution: The HFRT schedule used in this study could be useful in hospitals with limited access to resources.

Navigating Uncharted Territory: A post Covid-19 Exploration of the Resilience of Women Owned Small Businesses in the Wake of the Pandemic

Resilience has long been acknowledged in the literature as a crucial aspect of the entrepreneur's character and personality. Additionally, it is acknowledged as a vital component of the entrepreneurial process that propels businesses to great outcomes. However, to the researchers’ knowledge, there remains limited understanding regarding how women-owned small businesses in South Africa withstand and function during challenging social and economic crises like the COVID-19 pandemic. In the post-modern period we live in today, women will inevitably play an important part in business and economic development, and they are eager to become involved and make a difference in their communities. The COVID-19 pandemic has intensified the challenges faced by female entrepreneurs in growing their businesses. This research focuses on investigating how resilient South African women entrepreneurs have been in response to the pandemic. Drawing from resilience theory, the study employed a qualitative approach to gather and analyze data from a group of 15 women entrepreneurs based in the Eastern Cape Province of South Africa, using thematic analysis. The following four themes emerged from the findings; business agility; optimistic outlook; leveraged digital technology; and business networks. This research enhances existing resilience theory by integrating fresh insights gathered from the resilience strategies employed by female entrepreneurs in times of crisis. Results from the study are also expected to contribute to sustaining South African women owned small businesses and empowering their resilience, despite adversities.

Absorption of PCDD/F Emissions in Flue Gas Using Activated Carbon Injections in South Africa

Absorption of PCDD/F Emissions in Flue Gas Using Activated Carbon Injections in South Africa

Mild cognitive impairment and suicidal ideation among adults aged 65 years or older from low- and middle-income countries.

Mild cognitive Impairment (MCI) is a unique indicator of underlying distress that may be strongly associated with suicide risk. Despite this, to date, no study has examined the association between MCI and suicidal ideation. Therefore, the present study aimed to examine the association between MCI and suicidal ideation among adults aged ≥65 years from six low- and middle-income countries (LMICs) (China, Ghana, India, Mexico, Russia, South Africa). Cross-sectional, nationally representative data from the World Health Organization's Study on Global Ageing and Adult Health were analyzed. MCI was defined using the National Institute on Aging-Alzheimer's Association criteria. Self-reported information on past 12-month suicidal ideation was collected. Multivariable logistic regression and meta-analysis were conducted to assess associations. Data on 13,623 individuals aged ≥65 years were analyzed. The prevalence of suicidal ideation ranged from 0.5% in China to 6.0% in India, while the range of the prevalence of MCI was 9.7% (Ghana) to 26.4% (China). After adjustment for potential confounders, MCI was significantly associated with 1.66 (95%CI=1.12-2.46) times higher odds for suicidal ideation. MCI was significantly associated with higher odds for suicidal ideation among older adults in LMICs. Future longitudinal studies from LMICs are necessary to assess whether MCI is a risk factor for suicidal ideation.

Developing Teachers through School-Based Leadership: A Case Study of One Rural Primary School in South Africa

Contemporary thinking in scholarship observes that the framework of rural school teaching and leadership calls for customized attention owing to the contextual challenges that rural schools are faced with. This paper aims to examine the use of school-based leadership to develop primary school teachers, in a selected rural context. Supported by the interpretive qualitative paradigm, data was generated through a focus group interview with seven teachers and an individual face-to-face interview with the school principal from one selected rural primary school. Data were analyzed through thematic analysis. The findings revealed that although the school principal used open and effective leadership strategies to develop teachers to improve teaching and learning conditions, teachers still needed structured professional development programmes to enhance their teaching and improve learner outcomes. In light of the findings, this paper recommends a combination of leadership strategies from the school principal that will enhance teaching and learning while providing structured professional development. The paper advocates for the dual use of school-based leadership by the school principal to improve teaching and learning and teacher professional development.

The Career Orientation Impact in the Livelihood of Rural High School Learners: A Case of Selected High Schools Waterberg District, South Africa

This study analyses how career orientations can help rural high school learners to become more self-directed and flexible in developing their careers in today's dynamic world of work. Career counsellors are needed in schools to guide the way learners subjectively make sense of their self-perceived talents and abilities. The study used a qualitative approach to obtain information about how career orientation can change the lives of rural high school learners. The purposive sampling technique was used to choose rich information from rural high school learners and teachers, councillors, and the surrounding employers/educational institutions in Waterberg District. Data analysis was done through inductive thematic data analysis where themes and categories emanated. The outcome of the study considered the fundamental aspects to develop career paths, career orientation programs, changing the mind set and the impact of career orientation in rural high schools. The product of the study will be shared with all four schools, nearby employers, and the Department of Education, Waterberg District in Limpopo province. The outcomes of the study might help in dealing with persistent educational obstacles like broader educational equity and public funding for developmental career orientation programs that face many youth and adults in rural communities. It is recommended that policy developers establish career orientation models that would benefit the livelihood of rural high schools.

Thinking about drugs histories and private purposes in South Africa

Thinking about drugs histories and private purposes in South Africa

ICT and Agricultural Development in South Africa: An Auto-Regressive Distributed Lag Approach

The use of Information Communication Technology (ICT) forms a significant component of the Fourth Industrial Revolution (4IR). This study examined the impact of ICT on agricultural development in South Africa utilizing time series data from 1995 to 2022. Agricultural development was measured through agricultural output and agriculture total factor productivity as dependent variables. Traditional factors of production (land, labor, and capital) together with ICT variables (mobile cellphone subscriptions, Internet usage, and fixed telephone subscriptions) were used. Additional variables such as inflation, human development, access to energy and climate change were used. Data analysis was performed using the ARDL approach. The findings revealed that mobile phone subscriptions and Internet usage positively affect agricultural output and ATFP in the short and long run despite having a negative effect through the second lag in the short run. Fixed telephone subscriptions negatively affect ATFP in the long run while affecting output negatively in the short run through the first lag. Land, human development index, access to energy, and capital generally exhibited an increasing effect on both agricultural output and ATFP both in the short and long run through the various models estimated. Climate change and inflation were generally found to affect both agricultural output and ATFP negatively in the short and long run. The study concluded that ICT plays a significant role in promoting agricultural output and total factor productivity growth. Recommendations included that the South African government should promote the digitalization of the agriculture sector through the provision of ICT infrastructure that can be utilized by both smallholder farmers and large-scale agricultural producers.

Notes from the editor

You are reading the third issue of IJELS in 2024, volume 12. Our articles in the current issue cover five areas of literacy, including, linguistic literacy, music and art literacy, digital literacy, social science literacy, and thinking and literacy. Our authors in this issue come from China, Indonesia, Malaysia, Nigeria, Oman, Singapore, South Africa, Thailand, Turkey, and the United Kingdom.

Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.

Potential Health Risks of Indoor Particulate Matter Heavy Metals in Resource-Constrained Settings of South Africa

Evidence suggests that pollutants like particulate matter and heavy metals significantly impact health. This study investigated the determinants and sources of indoor PM2.5 heavy metals and assessed the health risk to children in Durban. Thirty households of mothers participating in the mother and child in the environment (MACE) birth cohort study were assessed for PM2.5 heavy metals. Multivariate linear regression was used to identify the determinants of PM2.5 heavy metals, while Pearson correlation and principal component analysis identified their sources. The health risk for children was assessed using measured metal concentrations. Proximity to industry, wall type, house age, and presence of windows increased some PM2.5 heavy metals, while cross ventilation reduced indoor PM2.5 As and Cu levels. Pearson correlation and principal component analysis indicated household, traffic, industrial, and natural sources as potential contributors. The health index was greater than 1, and cancer risk values for PM2.5 As and Pb exceeded acceptable levels. The findings highlight the toxicity of indoor air due to heavy metals and the potential for adverse health outcomes in children. To protect vulnerable groups, it is essential to prevent exposure to high-risk metals.

Investigating Methods and Approaches in Teaching Reading Skills in Sepedi Home Language to Foundation Phase Learners: Primary School in the Capricorn South District

Research shows that South African learners cannot read competently compared to those from other countries. This study investigates the different methods and approaches used in the teaching of reading skills in Sepedi Home Language in Foundation Phase learners with special focus on a primary school in Limpopo Province of South Africa. The research study sought to understand how teachers apply the different methods and approaches in teaching reading in the Foundation Phase so that learners are able to acquire the skills taught. A qualitative research method was used for data collection, in particular interviews and lesson observation. Purposive sampling was used to select the participants in the study, which were the teachers and learners. Thematic analysis was used to analyse all the datasets gathered in this study. Key findings include the following: Learners have varied reading opportunities at school; they have a fairly adequate reading opportunity at home; they were generally dissatisfied with the overall reading time allowed at school; Foundation Phase teachers have a fair understanding of what teaching reading skills entail; current methods used for teaching reading are inadequate; difficulties of teaching reading to non-Sepedi speaking learners; Departmental Heads provide useful support to teachers; and that there is a need to improve the reading skills of Foundation Phase learners. The study recommends that the Departmental officials should schedule regular workshops and do class visits in Foundation Phase for monitoring and supporting teachers in order for them to improve their teaching of reading; teachers need to make sure that they prioritise reading by engaging learners to participate in various activities that involve reading, and that learners should have access to the reading books that they use at school even at home, so that they could practise reading.