Protein Source Research Articles

Producing food from CO2 using microorganisms: Lots to do, little to lose!

BackgroundFor the first time, the recently held United Nations Climate Change Conference (COP 28) involved a summit leaders’ declaration to include global food production in their action plan to fight climate change. Reducing meat consumption is the primary way to take this fight seriously, nevertheless the global supply of people with high-quality protein is one of the central challenges of the coming decades. Producing microbial protein from CO2 (aka single cell protein, SCP) offers the unique opportunity to recycle both, CO2 from the atmosphere and food side streams, into consumer-oriented foods - an innovative path to a zero-carbon footprint diet. Scope and approachThe importance of utilizing CO2 as a substrate for microbial food production is underscored by comparative environmental footprint studies of various protein sources. This commentary systematically discusses the opportunities and technical challenges in realizing this vision. Key findings and conclusionsThe herein proposed acetate-based CO2-to-food framework carries the potential to decrease the environmental footprint of food production by several orders of magnitude in terms of greenhouse gas emission, water, and land usage. While all relevant process steps are already advanced to a high technological readiness level, the key engineering challenges encompass their consolidation to a circular process, scale-up and product formulation.

Effect of Extraction Processes on the Physicochemical and Functional Properties of Protein-Rich Extracts from the Red Seaweed Pyropia Seriata (Nori)

This study examined the physicochemical and techno-functional properties of protein extracts from the red seaweed (Pyropia seriata). The extraction processes involved variations of some of the following steps: alkaline treatment, milling, freeze drying, neutralisation, heating, and concentration. The extracts had total amino acid contents ranging between 40–55% of the powders with essential amino acids comprising 25–30% of the powders. The extracts were particularly abundant in aspartic acid and limited in the essential sulphur amino acids. The molecular weight (MW) distribution of the proteins within the extracts ranged from <10 to 50 kDa. All the extracts were soluble, with a solubility of 65–100% depending on the final pH of the solution. The extracts had significant foaming-producing and emulsifying potential. The foaming stability ranged between 75–91% for solutions between pH 7 to 11 and less than 75% for solutions with pH of 5 or 3. Alkaline treatment significantly improved foaming capacity (120-160%). A similar effect was also observed for emulsifying activity (0.29–0.51) and emulsifying stability (15–40%). Milling enhanced the emulsifying potential and decreased the mg of amino acids per g powder. Neutralisation with hydrochloric acid instead of citric acid and subsequent heating and concentration showed minimal effect on the properties of the extracts and decreased the mg amino acids per g powder. This research highlights the potential of Pyropia seriata as a source of soluble alternative protein for food applications.

Preparation of salt-free Pleurotus eryngii protein with enhanced colloidal stability and emulsifying properties by ceramic membrane filtration

Fungi proteins represent a potential alternative to animal proteins, which are regarded as a prospective source of edible proteins due to more sustainable and efficient cultivation of fungi. Nevertheless, the extraction of fungi proteins typically involves alkali extraction combined with acid precipitation (AEAP), yielding considerable amounts of salt that causes aggregation and inferior functional properties of proteins. In this study, we put forward a novel extraction method by direct filtration of Na+ and OH− from the alkaline extraction solutions using ceramic membranes. This method enabled the continuous, efficient and cost-effective production of Pleurotus eryngii protein (PEP). The PEP prepared by this technology featured a uniform distribution of nanoparticles (∼129.5 nm) with higher water dispersity, colloidal stability and surface active properties as compared to that prepared by the AEAP method. Moreover, the microstructures of PEP can be tailored with various nanoparticle sizes and size distribution profiles, allowing for the adjustment of long-term stabilities and surface activities. Our study renovated the production technology of fungi proteins to enhance their functionalities as well as the application prospects in the future food industry.

Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.

Multi-Modal Analysis of human Hepatic Stellate Cells identifies novel therapeutic targets for Metabolic Dysfunction-Associated Steatotic Liver Disease

Background and aimsMetabolic dysfunction-associated steatotic liver disease (MASLD) ranges from Metabolic dysfunction-associated steatotic liver (MASL) to Metabolic dysfunction-associated steatohepatitis (MASH) with fibrosis. Activation of Hepatic Stellate Cells (HSCs) into fibrogenic myofibroblasts plays a critical role in the pathogenesis of MASH liver fibrosis. We compared transcriptome and chromatin accessibility of human HSCs from NORMAL, MASL, and MASH livers at single cell resolution. We aimed to identify genes that are upregulated in activated HSCs and to determine which of these genes are key in the pathogenesis of MASH fibrosis. Methods18 human livers were profiled using single-nucleus (sn)RNA-seq and snATAC-seq. High priority targets were identified, then tested in 2D human HSC cultures, 3D human liver spheroids, and HSC-specific gene knockout mice. ResultsMASH-enriched activated (A) HSC subclusters are the major source of extracellular matrix proteins. We identified a set of concurrently upregulated and more accessible core genes (GAS7, SPON1, SERPINE1, LTBP2, KLF9, EFEMP1) that drive activation of (A) HSC subclusters. Expression of these genes was regulated via crosstalk between lineage-specific (JUNB/AP1), cluster-specific (RUNX1/2) and signal-specific (FOXA1/2) transcription factors. The pathological relevance of the selected targets, such as SERPINE1 (PAI-1), was demonstrated using dsiRNA-based HSC-specific gene knockdown or pharmacological inhibition of PAI-1 in 3D human MASH liver spheroids, and HSC-specific Serpine1 knockout mice. ConclusionThis study identified novel gene targets and regulatory mechanisms underlying activation of MASH fibrogenic HSCs and demonstrated that genetic or pharmacological inhibition of select genes suppressed liver fibrosis. Impact and implicationsHere we present snRNA-seq and snATAC-seq analysis of human HSCs from NORMAL, MASL, and MASH livers. We identified additional subclusters that were not detected by previous studies and characterized the mechanism by which HSCs activate in the MASH livers, including the transcriptional machinery that activates HSCs into myofibroblasts. For the first time, we described the pathogenic role of activated HSC-derived PAI-1 (a product of SERPINE1 gene) in the development of MASH liver fibrosis. Targeting of RUNX1/2-SERPINE1 axis may provide a novel strategy for treatment of liver fibrosis in patients.

Reviving the entomophagy tradition among the younger generation: An application of the theory of planned behavior

Edible insects are sustainable sources of animal protein. Although insects are novel foods in Western societies, the Asia-Pacific region preserves traditional entomophagy cultures. In parts of the Asia-Pacific region, the amount consumed gradually declined with each passing generation. Reviving the entomophagy tradition among the younger generation is crucial for the future market for edible insects. This study examined young consumers’ perceptions of edible insects and the psychological determinants of their consumption. This study was conducted in Japan, which is a typical example of generational differences in insect consumption due to traditional eating habits. We adopted the theory of planned behavior (TPB) to identify psychological determinants of entomophagy and conducted two online surveys among 391 and 342 young Japanese consumers, respectively. We extended the original TPB by adopting a treatment–control design in which respondents in the treatment group received information on product availability. The results revealed that edible insects remained a novel food among respondents. The TPB revealed that subjective normsand perceived behavioral control (PBC) were determinants of consumption intention, whereas intention and PBC were determinants of behavior. Information on product availability had a significant positive impact on intention; however, it had little impact on behavior. Furthermore, we found that food safety control was the most valued product attribute and hedonistic attributes were prioritized over functionalist attributes. Based on these findings, this study proposes possible promotional strategies that provide valuable insights for marketers and policymakers in Japan and other countries to revive the entomophagy tradition among younger generations.

A Brief Meta-analysis and Health Risk Assessment of Lead and Cadmium in Meat, Liver, and Kidney of Livestock in Iran

Background: Red meat from livestock is an excellent source of high-quality protein, vitamins, and minerals Objective: This meta-analysis aimed to investigate the levels of two of the most toxic heavy metals; lead (Pb) and cadmium (Cd) in meat and edible offal (liver and kidney) of livestock (sheep, buffalo, and cow) in Iran with assessing their health risk of developing cancer. Methods: A systematic search was conducted covering ISI Web of Science, PubMed, and Google Scholar. Finally, data from 4 articles including 624 samples were analysed. Results: Pooled results show that the mean concentrations of Pb and Cd were 0.18 mg/kg and 0.13 mg/kg respectively which were both higher than their eligible maximum limits by FAO/WHO. The Estimated Daily Intake (EDI) of Pb and Cd in meat, liver, and kidney for adults and children was lower than the Total Daily Intake (TDI) limits. The consumers' non-carcinogenic risk (THQ) for meat consumption was generally safe in terms of Cd and Pb in all cities except for Pb in Hamadan which was greater than one (unsafe) for both adults and children. Carcinogenic Risk (CR) for meat consumption was generally safe or within the acceptable range in terms of Cd and Pb in all cities except for Pb in Hamadan which had a Pb-CR greater than safe/permissible level for children. Conclusion: It can be concluded that the dangerous levels of CR and THQ of meat in terms of Pb in Hamadan warrant concern and further study.

Pecan (Carya illinoinensis (Wangenh.) K. Koch) nuts as an emerging source of protein: extraction, physicochemical and functional properties.

The increasing demand for sustainable alternatives to traditional protein sources, driven by population growth, underscores the importance of protein in a healthy diet. Pecan (Carya illinoinensis (Wangenh.) K. Koch) nuts are currently underutilized as plant-based proteins but hold great potential in the food industry. However, there is insufficient information available on pecan protein, particularly its protein fractions. This study aimed to explore the physicochemical and functional properties of protein isolate and the main protein fraction glutelin extracted from pecan nuts. The results revealed that glutelin (820.67 ± 69.42 g kg-1) had a higher crude protein content compared to the protein isolate (618.43 ± 27.35 g kg-1), while both proteins exhibited amino acid profiles sufficient for adult requirements. The isoelectric points of protein isolate and glutelin were determined to be pH 4.0 and pH 5.0, respectively. The denaturation temperature of the protein isolate (90.23 °C) was higher than that of glutelin (87.43 °C), indicating a more organized and stable conformation. This is further supported by the fact that the protein isolate had a more stable main secondary structure than glutelin. Both proteins demonstrated improved solubility, emulsifying, and foaming properties at pH levels deviating from their isoelectric points in U-shaped curves. Compared to the protein isolate, glutelin displayed superior water and oil absorption capacity along with enhanced gelling ability. The protein isolate and glutelin from pecan nuts exhibited improved stability and competitive functional properties, respectively. The appropriate utilization of these two proteins will support their potential as natural ingredients in various food systems. © 2024 Society of Chemical Industry.

The effects of casein glycomacropeptide on general health status in children with PKU: A randomized crossover trial

In PKU, it is suggested that casein glycomacropeptide based protein substitute (GMP) may have physiological advantage when satiety, oxidative stress, renal function and inflammation are considered. Its prebiotic properties may also help gastrointestinal (GI) tolerance.In children with PKU, a randomized/crossover trial comparing phenylalanine-free amino acids (AA) vs GMP as the single source of protein substitute for 12-weeks in each arm was conducted. There was a 4-week wash out period with AA in-between. At baseline and end of each intervention, blood and fecal samples were taken to monitor gut health, oxidative stress, renal function, inflammatory markers and plasma amino acids. Satiety and Pediatric Quality of Life (PedsQL) GI symptoms questionnaires were completed. Usual weekly blood spots for phenylalanine and tyrosine were done.Twelve patients (8 males; aged 4-9y) with PKU participated. GMP improved the following GI symptoms: stomach pain (p = 0.003), heartburn and reflux (p = 0.041) and wind/ bloating (p = 0.018). With GMP, there was also a trend for less constipation (p = 0.068), discomfort with eating (p = 0.065) and nausea and vomiting (p = 0.087). There was no changes on stool gut health markers (IgA, short chain fatty acids and fecal calprotectin). There were no statistically significant differences for renal, oxidative stress, inflammatory and gut health markers or measures of satiety except for adiponectin (p = 0.028) and total antioxidant capacity (p = 0.049), although the latter was possibly without clinical significance. Mean dried blood spot Phe was 114 μmol/L higher with GMP vs AA (p < 0.001). There was no difference in tyrosine levels. In conclusion, GI symptoms significantly improved with GMP versus AA. The phenylalanine content of GMP may present challenges when it is used as the only protein substitute in children with classical PKU with low Phe tolerance.

Exploring the biodiversity of plant proteins for sustainable foods: Composition and emulsifying properties of the proteins recovered by aqueous extraction from camelina (Camelina sativa L.) seeds

The food transition towards an increased consumption of plant proteins aimed at limiting environmental impacts requires a diversification of plant protein sources. In this study, we explored the potentialities of the sustainable oilseed crop camelina to provide dietary proteins and to prepare oil-in-water emulsions. An innovative green refinery process, including the removal by ultrasound of the mucilage attached at the surface of the seeds and extraction by grinding in water at pH 8, was used to recover aqueous extracts containing camelina seed proteins. These proteins, mainly composed of the 11S globulin cruciferins and the 2S albumin napins, contained the nine essential amino acids of nutritional interest. Camelina seed proteins exhibited low solubility in the range of pH H 5.5-2, attributed to the cruciferins. Oil-in-water emulsions stabilized by camelina seed proteins revealed the preferential adsorption of napin at the oil/water interface and exhibited physical instability below pH 7. Homogenization of the whole aqueous extracts containing oil bodies (OBs) induced the adsorption of cruciferins and napins together with oleosins at the surface of homogenized OBs, and their sedimentation below pH 6.5. Camelina seed proteins adsorbed at the oil/water interface governed the surface properties of the oil droplets and homogenized OBs and the physical stability of the emulsions as a function of pH. This work brings new insights into the potentialities of camelina seed proteins recovered by aqueous extraction that may serve as natural plant-based functional ingredients in the food industry and that will contribute to the development of innovative and sustainable plant-based food emulsions.

Untargeted metabolomics and PacBio analysis on bioactive components and microbial community in co-fermentation of black soldier fly larva

Fermentation can enhance nutritional value and safety of insect protein, this study utilized probiotic Bacillus subtilis (B. subtilis) and complex enzyme containing chitinase and protease to ferment the paste of Black Soldier Fly larva (BSFL), decomposing anti-nutritional factor chitin and protein in paste while inhibiting the proliferation of harmful microorganisms. The result indicated a 40 % degradation of chitin after fermentation, accompanied by an increase in the variety and quantity of amino acids and peptides, functional substances such as raffinose and cucurbitacin significantly increased, while the levels of antibiotics such as erythromycin and ofloxacin had decreased; after fermentation, there is a significant difference in the microbial distribution between bacteria, co-fermentation and CK, the indigenous microbiota of BSF and pathogenic bacteria such as Klebsiella pneumoniae and Clostridiaceae bacteria were significantly inhibited, anaerobic bacteria, including Anaerosalibacter, Caldicoprobacter and Tissierella, exhibit a marked increase; significant changes are detected in the carbon sources, amino acids, and key enzymes related to other metabolic pathways of B. subtilis during the fermentation process. Overall, we have developed a method for fermenting BSFL paste, aiming at enhance its probiotic properties, nutritional value, and safety. This study provided groundwork for utilizing fermented insects as a novel protein source for food and fodder.

Enhancing the nutritional value of black soldier fly larvae through the nutrient amino acid transporter suppression in the excretion system

Abstract Larvae of the black soldier fly (Hermetia illucens, BSFL) are rich in valuable nutrients and offer a promising alternative protein source for animal feeds. Nonetheless, there is a pressing need to improve both the productivity and quality of BSFL to ensure the viability of BSFL products and facilitating the industrial production. To fulfil the needs of different animals, it is necessary to adjust the profile of essential amino acids (EAAs) in BSFL. Insects excrete surplus nutrients to maintain homeostasis; AAs are excreted by nutrient AA transporters (NATs) in the Malpighian tubules. We aimed to modify the composition of essential AAs by silencing the NAT in Malpighian tubules of BSFL (HiNATt). Silencing HiNATt resulted in a 77.3% increase in the total AA content while 56.2% decrease in body weight. Notably, the contents of some valuable essential AAs were strongly increased (histidine, 256.8%; valine, 198.1% in total compared to the intact larva). These results suggest that inhibiting the HiNATt function could modify the amount of accumulated EAAs. This finding opens a new avenue for producing BSFL with increased nutritional value as an alternative protein source.

Structuring chicken breast analogs via high moisture extrusion of dairy-plant proteins blends

Chicken analogs were structured using binary blends of soy protein isolate (SPI) and wheat gluten (WG) or whey protein concentrate (WPC), as well as trinary blends of SPI-WG-WPC via high moisture extrusion. Chicken analogs with anisotropic structures were achieved (anisotropic index >1). Although adding WPC increased hardness, by varying the ratio of SPI to WG in the trinary blends, comparable texture profile properties as cooked chicken breast were achieved. The drivers of the fiber structure formation were non-covalent protein-protein interactions like hydrogen bonds and hydrophobic interactions, and to a lesser extent, inter-protein disulfide bonds formation. β-sheets were the dominant secondary structure, and adding WPC increased the proportion of α-helix while adding WG increased the proportion of β-turns in the meat analog (MA). This study offered strategies on structuring extruded chicken analogs with WPC, a high-quality protein source, and provided insights into mechanisms underlying the formation of fiber structures.

Metagenomic Insights into Enhancing Protein Content and Digestibility in Jack Bean (Canavalia ensiformis) Tempeh: Unraveling Microbial Dynamics During Fermentation

Jack beans (Canavalia ensiformis) are a locally abundant Indonesian bean variety boasting a significant protein content that remains underutilized. The production of tempeh from Jack beans presents a promising avenue for tapping into this valuable vegetable protein source. The tempeh-making process involves several key stages, including soaking the ingredients, inoculating with a mold starter, and fermenting the mixture. Throughout each stage, protein content preservation and effective utilization are paramount. This study uses high-throughput sequencing technologies to characterize protein hydrolysis in Jack beans during fermentation. The research aims to investigate how microorganisms participating in the fermentation of Jack bean tempeh influence protein content and protein digestibility. The findings reveal that prolonging the fermentation time of Jack beans, utilizing a 1.5% tempeh mold starter, and fermenting for 36 hours resulted in a notable increase in protein content by 66.63% and enhanced protein digestibility in vitro by 48.82%. This improvement may be attributed to the predominant activities of Bacillus and Rhizopus during the fermentation process by the metagenomics approach.

In vitro ruminant fermentation, degradation, and methane production of four agro-industrial protein-rich co-products, compared with soyabean meal

Soyabean is considered an unsustainable protein source for livestock feeds because of the large quantity of input and energy required to cultivate and process it. Other protein-based agro-industrial co-products that are less input-intensive, can mitigate methane (CH4) production and may therefore be more sustainable options instead soyabean. The objective of this study was to compare the effect of replacing the same amount of protein (40g/kg DM crude protein) as soyabean meal (SBM) with low-carbon local agro-industrial co-products, (brewers’ spent grains, BSG; dried wheat distillers’ grains, WDG; dried corn distillers’ grains, CDG and corn steep liquor CSL), on in vitro rumen degradation, fermentation and gas and methane production. The study used a 72-hour in vitro gas production method with a basal substrate of dried, ground grass silage and wheat. Gas volumes were measured at eleven different specific intervals, and CH4 concentrations were analysed via gas chromatography. After 72hours, in vitro DM degradability (IVDMD) and volatile fatty acid (VFA) concentrations were assessed. Gas and CH4 production curve profiles were fitted to models to determine asymptote production, the extent of degradation in rumen proper (RoP), and the fractional degradation rate (μ) (h-1) in the halfway 50% of the asymptote production. The IVDMD and estimated RoP at 0.04h and 0.025h were lower (P<0.05) for BSG compared to the other treatments, by 4.9 – 6.6%; 5.8 - 9.9%; 5.2 - 9.0%. Gas and CH4 yield (mL/g substrate and mL/g substrate degraded), and pH (SB = 6.77, BSG = 6.80, WDG = 6.74, CDG = 6.84, and CSL = 6.73; P>0.05), were not significantly affected by treatment. Butyrate and valerate were lower (P<0.05) for BSG compared to CSL, and caproate was lower (P<0.001) for BSG compared to the other treatments and in CSL compared to SBM. The results regarding degradability and VFAs concentrations of this study demonstrated that dried wheat distillers’ grains, dried corn distillers’ grains, and corn steep liquor have the potential to replace soyabean meal as protein sources for ruminants, but further reduction of CH4 emissions as a result of such practice may not be expected. Although slightly less degradable, based on their nutrient composition and the fact they did not affect rumen fermentation characteristics, brewers' spent grains can still play a complementary role in ruminant diets, especially in regions where they are locally readily available.

A comprehensive review on composition to application of pea protein and its components

Pea protein, a valuable plant-based protein source, is notable for its nutritional value, essential amino acids, and low allergenicity, making it widely applicable in food, medicine, and materials. It consists mainly of globulin and albumin, which influence its functional properties and applications. However, there is a lack of comprehensive reviews on its extraction methods, functional properties, modification techniques, and applications in food. This paper aims to fill these gaps by detailing pea protein composition, extraction methods, functional properties, and modification impacts while summarizing its food applications and proposing future research directions. The goal is to enhance pea protein's functionality and expand its applications through optimized extraction and advanced technology. By improving extraction techniques and adapting pea protein for better functionality, we aim to develop high-quality market applications, ensuring the growth and sustainability of the pea protein industry globally. This approach promises a flourishing future for pea protein, meeting global competition demands and driving industry advancement.

Development of protein hydrolysate as a cost-effective and robust biodispersant: Investigating its performance in dispersing of carbon black pigment in water-based paints

Carbon black pigments hold significant importance as the primary representatives of black pigments in the industry today. The dispersibility of carbon black pigment (CB) in water is limited by the nonpolar and weakly hydrophilic characteristics of the pigment's surface. Therefore, there is a critical need to devise an economical and eco-friendly approach for creating a well-dispersed and stable suspension of carbon black in an aqueous medium. The primary focus of this study was to investigate the dispersion capabilities of protein hydrolysate (HP) derived from sheep wool on CB particles in a water-based pigment concentrate. The hydrolysis degree of protein source was determined by high-performance liquid chromatography and gel permeation chromatography. The dispersion performance was investigated by zeta potential, transmission electron microscopy, Fourier transform infrared spectroscopy, grindometer, spectrophotometer-colorimeter, viscometer, and cryptometer measurements. The HP solution containing amino acids, peptides, and polypeptides with low molecular weight can cover the surface of the CB particles, creating enough electrical repulsion and steric resistance. As a result, this phenomenon can inhibit the collision and interaction among the pigment particles caused by Brownian motion, making it less prone to aggregation. The protein hydrolysate demonstrated a higher capability in producing the stable CB dispersions compared to a commercial reference dispersant, highlighting the effectiveness of amino acids, peptides, and polypeptides as powerful CB dispersing agents.

Effect of Using Germinated and Fermented Lupin and Oats as a Dietary Protein Source on Laying Hen Performance and Egg Quality

Soybean meal is the dominant protein source for poultry nutrition. However, soybean is not widely grown in Europe, necessitating importation from other countries. To reduce dependency on imported soybean meal, an alternative feed material is needed. Fermentation and/or germination of grains are known to increase the value of the protein content of a diet. This study aimed to determine if they could substitute partly soybean meal in a diet. Germinated or fermented or germinated and fermented grains of lupin and oats were used in laying hen’s diet (a mix of 6.50% lupin and 3.50% oat grains). Oats were dehulled or not dehulled. The hens’ weight loss and the downgraded eggs rate were the lowest when using fermented grains. All trial diets reduced the egg cholesterol content. Dehulling had only a slight effect on performance. Diets containing germinated grains led to a decrease in laying performance and an increase in body weight loss. Diets containing fermented grains gave the best results in terms of quantity of amino acids, hen weight maintenance, laying performance, and egg quality. In conclusion, fermented lupin and oats can be used in laying hen diets to partly substitute sources of protein such as soya, but germinated grains cannot.

Mimicking Mechanics: A Comparison of Meat and Meat Analogs

The texture of meat is one of the most important features to mimic when developing meat analogs. Both protein source and processing method impact the texture of the final product. We can distinguish three types of mechanical tests to quantify the textural differences between meat and meat analogs: puncture type, rheological torsion tests, and classical mechanical tests of tension, compression, and bending. Here, we compile the shear force and stiffness values of whole and comminuted meats and meat analogs from the two most popular tests for meat, the Warner–Bratzler shear test and the double-compression texture profile analysis. Our results suggest that, with the right fine-tuning, today’s meat analogs are well capable of mimicking the mechanics of real meat. While Warner–Bratzler shear tests and texture profile analysis provide valuable information about the tenderness and sensory perception of meat, both tests suffer from a lack of standardization, which limits cross-study comparisons. Here, we provide guidelines to standardize meat testing and report meat stiffness as the single most informative mechanical parameter. Collecting big standardized data and sharing them with the community at large could empower researchers to harness the power of generative artificial intelligence to inform the systematic development of meat analogs with desired mechanical properties and functions, taste, and sensory perception.

CRISPR/Cas9‐Mediated Genome Editing for Trait Improvement and Stress Tolerance in Leguminosae (Legume Family)

ABSTRACTLegumes represent a significant source of protein, roughage, minerals and carbohydrates in global diets. They are cultivated primarily for human consumption, forage and as a green manure. However, the growth and productivity of legumes are often hindered by a range of biological and environmental factors. The most prevalent diseases afflicting legumes include downy mildew, fusarium root rot, southern blight and common leaf spot. Additionally, environmental stresses such as salinity and drought represents significant challenges. Over time, the development of cultivars with enhanced tolerance has emerged as a sustainable approach to combat the impact of these stresses. Although environmentally friendly, traditional breeding methods entail lengthy screening and cross‐breeding protocols, which constrain their efficacy in addressing climate challenges and ensuring global food security. Furthermore, these approaches rely on the natural availability of genetic variation, which may not always be exist for specific traits, particularly in the context of rapidly changing environmental conditions. Additionally, the traditional breeding method is not sufficiently precise, which can result in the unintended introduction of undesirable traits. Furthermore, the genetic intricacy of legumes presents an additional challenge making it difficult to isolate and enhance desired traits. These constrain impede the capacity to expeditiously develop cultivars that can withstand emerging stresses, such as climate change. Genome editing has emerged as a powerful tool to overcome the limitations of traditional breeding methods. By enabling precise and targeted genetic manipulation, genome editing can enhance desired traits or introduce new ones, thereby facilitating the development of climate‐resilient agronomic varieties. In particular, clustered regularly interspaced short palindromic repeat/CRISPR associated protein (CRISPR/Cas9)‐mediated editing has demonstrated considerable potential in enhancing legume adaptability to diverse stress conditions and increasing crop yield. This study highlights the advancements in genome editing, with a specific focus on CRISPR/Cas9 technology, as a means to improve legume crops' resilience and productivity in response to environmental pressures.