Solid-phase Synthesis Of Oligodeoxyribonucleotides Research Articles

Further Optimization of Detritylation in Solid-Phase Oligodeoxyribonucleotide Synthesis

Various conditions for optimum detritylation (i.e., the removal of 5′-O-trityl protecting groups) during solid-phase synthesis of oligodeoxyribonucleotides were investigated. Di- and tri-chloroacetic acids of variable concentrations were used to study the removal of the 4,4′-dimethoxytrityl (DMTr) group. It was found that the DMTr group could be completely removed under much milder acidic conditions than what are currently used for automated solid-phase synthesis. The 2,7-dimethylpixyl (DMPx) is proposed as an alternative and more readily removable group for the protection of the 5′-OH functions both in solid- and solution-phase synthesis. The improved detritylation conditions are expected to minimize the waste and offer a protocol for incorporation of acid sensitive building-blocks in oligonucleotides.

ChemInform Abstract: Repair and Replication of Oxidized DNA Bases Using Modified Oligodeoxyribonucleotides

ChemInform is a weekly Abstracting Service, delivering concise information at a glance that was extracted from about 100 leading journals. To access a ChemInform Abstract of an article which was published elsewhere, please select a “Full Text” option. The original article is trackable via the “References” option.

Solid-Phase Synthesis of Oligodeoxyribonucleotides without Base Protection Utilizing O-Selective Reaction of Oxazaphospholidine Derivatives

A study on the development of a novel method to synthesize oligodeoxyribonucleotides without base protection is described. We found that nucleoside 3′-O-oxazaphospholidine derivatives exclusively react with the hydroxy group of nucleosides in the presence of unprotected nucleobase amino groups. Since the O-chemoselectivity of the oxazaphospholidine derivatives is likely due to their ring structure, which allows the regeneration of the oxazaphospholidine derivatives from the corresponding base phosphitylation adducts via an intramolecular recyclization, the method is expected to be compatible with any kinds of acidic activators.

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

Solid-phase synthesis of deoxyribonucleotides having a cap structure analog.

In this study, the solid-phase synthesis of oligodeoxyribonucleotides having a guanosine pyrophosphate cap structure (Gpp-) was achieved by using a new guanosine monophosphate unit having the DMTr group capable of estimation of coupling efficiency of the pyrophosphate bond formation. Since 7-methylguanosine base was unstable under basic conditions, Gpp-capped DNA oligomers were synthesized by using a new linker having a silanediyl bond, which allowed to release the DNA chain from the solid support by treatment with fluoride anion under neutral conditions.

A New Approach for the Efficient Synthesis of Oligodeoxyribonucleotides Containing the Mutagenic DNA Modification 7,8-Dihydro-8-oxo-2′-deoxyguanosine at Predefined Positions

Abstract A combination of H-phoshonate and phosphoramidite chemistry has been applied for the automated solid-phase synthesis of oligodeoxyribonucleotides containing 7, 8-dihydro-8-oxo-2′-deoxyguanosine (8-oxodG) residues at predefined positions. The unmodified part of the oligomers has been synthesized by using protected standard phosphoramidites, for the incorporation of 8-oxodG the synthon 2-N-acetyl-5′-0-(4,4′-dimethoxytrityl)-7,8-dihydro-2′-deoxyguanosin-8-one-3′-H-phosphonate, prepared in a five step synthesis via 8-bromo-2′-deoxyguanosine, has been used. This approach combines the advantages of both DNA synthesis strategies in that a high yield of full length oligomers is obtained and unreacted, protected 8-oxodG monomers can be recycled, respectively.

A solid-phase synthesis of oligodeoxyribonucleotides and their analogues using deoxyribonucleoside phosphorobisdiethylamidite intermediates

A solid-phase synthesis of oligodeoxyribonucleotides and their analogues using deoxyribonucleoside phosphorobisdiethylamidite intermediates

Solid Phase Synthesis of Oligodeoxyribonucleotides Utilizing the Phenylthio Group as a Phosphate Protecting Group

Abstract Oligodeoxyribonucleotide synthesis utilizing the phenylthio group as a phosphate protecting group was applied to the solid phase method. The base residues of deoxyguanosine and deoxyadenosine were protected with bis(isobutyryloxy)ethylene (Bibe) and phthaloyl groups to avoid the base modification and depurination, respectively. A key synthetic intermediate of N2-isobutyryl-N1,N2-bis(isobutyryloxy)ethylenedeoxyguanosine was prepared in high yield by four-step reaction from deoxyguanosine and used for preparation of the building blocks of deoxyguanosine required for the polymer support synthesis. Two kinds of polymer supports, i.e., 1% cross-linked polystyrene and controlled pore glass were chosen. The latter was employed for the synthesis of dodecadeoxyribonucleotides by using an automated DNA synthesizer.

Synthesis of Oligodeoxyribonucleotides Involving a Rapid Procedure for Removal of Base-Protecting Groups by Use of the 4,4′,4″-Tris(benzoyloxy)trityl (TBTr) Group

Abstract Fully protected building units for oligodeoxyribonucleotide synthesis in the phosphoramidite approach were prepared in high yields by the 5′-dimethoxytritylation of N-[4,4′,4″-tris(benzoyloxy)trityl]deoxyribonucleosides followed by the 3′-phosphitylation with methoxymorpholinochlorophosphine. The solid phase synthesis of oligodeoxyribonucleotides on a controlled pore glass gel using the amidite units was examined. The efficiency of condensation was discussed in detail. The 4,4′,4″-tris(benzoyloxy)trityl (TBTr) group was removed rapidly from a protected tetramer synthesized on the controlled pore glass gel to give dGpCpApT.

Solid-phase synthesis of oligodeoxyribonucleotides using the bis(trimethylsilyl) peroxide oxidation of phosphites

The trimethylsilyl triflate-catalyzed bis(trimethylsilyl) peroxide oxidation of phosphites has been successfully applied to the solid-phase synthesis of d (AAGATC).

A new linkage for solid phase synthesis of oligodeoxyribonucleotides.

An aryl diisocyanate has been used to attach an appropriately protected 2'-deoxyribonucleoside bearing a free 3'-hydroxyl group, to a long chain alkylamine controlled pore glass support via a urethane moiety, in a simple two step procedure. This obviates the need for the preparation and short column chromatographic purification of the 2'-deoxyribonucleoside-3'-O-succinates required for preparation of the widely used succinyl linked supports. The greater stability of the urethane bond compared to an ester bond led to substantially higher yields of oligodeoxyribonucleotides prepared by the solid phase phosphotriester method. More than twenty oligodeoxyribonucleotides have already been synthesized on the glass support bearing the new linkage.

Festphasensynthese von Oligodesoxyribonucleotiden an Polystyren‐Teflon‐Trägern nach der Diestermethode

Phosphodiester Solid Phase Synthesis of Oligodeoxyribonucleotides on Polystyrene‐Teflon‐SupportsPhosphodiester solid phase method on two different polystyrene‐teflon‐supports has been applied for for the rapid synthesis of the hexanucleotides d(TCTAGA), d(TGTCAA), d(TTGACA) and the octanucleotides d(CATTATAC) and d(GTATAATG)Als Abkürzungen für die Nucleinsäurebausteine und deren Schutzgruppen wurden die von der IUPAC‐IUB Commission on Biochemical Nomenclature (CBN) empfohlenen Regeln verwendet, vgl. Hoppe‐Seyler's Z. Physiol. Chem. 351, 1055 (1970); außerdem wurden abgekürzt:DEAE = O‐(Diethylamino)ethyl, HPLC = Hochdruckchromatographie, O.D.E. = optische Dichteeinheit [17], TEAB = Triethylammoniumbicarbonat, TFA = Trifluoressigsäure, Tris = α,α,α‐Tris‐(hydroxymethyl)‐methyl‐amin , respectively. In the case of hexanucleotides a polymeric support with 90 mg polystyrene/g support has been used. The octanucleotides were prepared using a 180 mg polystyrene/g support. The yields of all oligonucleotides were 42–51%/condensation step.

Continuous-flow Phosphotriester Method for Solid-phase Synthesis of Oligodeoxyribonucleotides

Continuous-flow Phosphotriester Method for Solid-phase Synthesis of Oligodeoxyribonucleotides

Rapid synthesis of oligodeoxyribonucleotides. VII. Solid phase synthesis of oligodeoxyribonucleotides by a continuous flow phosphotriester method on a kieselguhr-polyamide support.

A new kieselguhr-polydimethylacrylamide support has been used in a continuous flow, column system for solid phase synthesis of oligodeoxyribonucleotides by a phosphotriester procedure. Using only protected mononucleotides a 14-mer, 20-mer and 27-mer were assembled in high repetitive yield using a simple manually operated, bench top apparatus.

Rapid synthesis of oligodeoxyribonucleotides IV. Improved solid phase synthesis of oligodeoxy-ribonucleotides through phosphotriester intermediates

A phosphotriester solid phase method on a polyamide support has been used to prepare oligodeoxyribonucleotides up to 12 units long. Compared to solid phase phosphodiester synthesis the new methodology is quicker, more flexible and gives 10-60-fold better overall yields.