Sterile Soil Research Articles

Soil legacies in maize-edible legume intercropping alter maize growth and reduce Spodoptera frugiperda larval feeding

Plant-soil feedback can influence aboveground interactions between plants and herbivores by affecting plant chemistry. Such interactions can be utilized in pest management. However, cropping systems such as maize-legume intercropping (MLI) can influence these interactions which is not well understood. In this study, we explored effects of MLI systems on soil physico-chemical properties, maize growth, larval feeding and development of fall armyworm (Spodoptera frugiperda). We used sterile soil and soil conditioned by different MLI and maize-monoculture cropping systems to explore these interactions. Soil samples that included soil conditioned by different MLI and maize-monoculture cropping systems were collected from smallholder farmer fields in eastern Kenya, where different MLI and maize-monoculture cropping systems were being practiced. These soil samples were compared with sterile soils for physico-chemical properties using black oxidation and Walkley methods. Three-weeks-old maize plants grown in the different soil treatments in the greenhouse were used for larval feeding and development assays. Neonate S. frugiperda larvae were allowed to feed on maize leaf discs for 24 hours and another set of plants were inoculated with the neonates for 15 days and the larval survival and development monitored. Soil obtained from different maize-edible legume intercropping systems had a higher pH, electrical conductivity, nitrogen, organic carbon, potassium, phosphorus, calcium, magnesium, exchangeable acidity, copper, clay and silt compared to maize-monoculture and sterile soil. Maize plants grown in MLI soil had better growth parameters compared to those in maize-monoculture and sterile soils. A high correlation was found between pH and plant biomass, while no significant correlation with other physico-chemical properties was noted. There were significant differences in larval feeding by S. frugiperda neonates when exposed to constitutive and induced maize leaf discs with more leaf tissue fed on maize grown in maize-monoculture and sterile soil. When allowed to feed for 15 days, S. frugiperda larval weight and length were significantly lower on maize plants grown in soils conditioned by MLI than those grown in soil conditioned by maize-monoculture and sterile soils. Findings from this study show how conditioning soil by MLI systems improve soil health, maize growth and reduces S. spodoptera larval feeding and development.

Study and evaluation of the effects of vegetation cover destruction on soil degradation in Middle Guinea through the application of remote sensing and and geotechnics

Soil degradation in Middle Guinea is increasing over the years. While it's good to have precautions to deal with it, it's even more important to go back to the source of the scourge in order to lessen its effects over time, or even eradicate it. At the center of the factors that are often mentioned is the destruction of the vegetation cover, and the aim of this study is to clear it (in all its forms: trees, grass, savannah, etc.) by following its variation in time [1982 and 2021] and in space. The present study was conducted by combining the remote sensing and GIS results, developed with data from geotechnical survey data and laboratory tests. On the Mali Labé Linsan axis, between [1982 and 1992], 63 % of the territory explored was occupied by fresh vegetation cover, compared to 13 % of dry vegetation, as well as 12 % of sterile soil and 12 % of sand mineral soil. For the periods [1992–2002] and [2002–2012], these same parameters increased to: 67 %; 11 %; 11 % and 11 %. The period [2012–2021] was marked by changes of 73 %; 10 %; 9 % and 9 %, respectively. The bearing capacity of soils varies from one point to another. In all six boreholes presented, their maximum values are greater than or equal to 400 Kpa (≥400 Kpa). The minimum values calculated for 2.1 ≤ B(m)≤7.3 fluctuate between 291 Kpa and 806 Kpa. The investigations carried out on this subject show that the overall movement of the positive variation of the vegetation cover in time (63 % < 67 % < 73 %) and very contrasted in space, would not be responsible for the degradations (which are local and mainly caused by erosion: wind and water). In addition, they open up to a (geoscientific and geotechnical) approach of a deep analysis, the purpose of which suggests the adoption of slab/concrete/grating foundations (depth of anchorage specific to each soil analyzed).

Obtainment and Inoculation of Acinetobacter pittii Strain JJ-2, and Combined Action with Plants for Formaldehyde and CO2 Removal: A Research Study.

A formaldehyde-degrading bacterium JJ-2 was isolated from the rhizosphere of Chlorophytum and identified as Acinetobacter pittii by colony morphology and 16S rDNA sequence analysis. Further studies showed that under optimal conditions, JJ-2 could maintain activity for six cycles at an initial formaldehyde concentration of 450mgL-1. At the same time, the complete degradation time was shortened from 12 to 6h. When the JJ-2 strain was inoculated into sterile soil, the surface spray method had the best effect, and the removal efficiency of 5ppm formaldehyde increased by 22.63%. In an actual potted plants system colonized with strain JJ-2, the first and second fumigations (without re-inoculation) increased removal by 1.36 times and 0.92 times during the day and 1.27 times and 2.07 times at night. In addition, in the second fumigation, the plant-bacteria combined system was 693.63ppm and the plant system was 715.34ppm, effectively reducing the CO2 concentration. This study provides an economical, ecological, and efficient approach to improve the combined system of plants and bacteria to remove gaseous formaldehyde from indoor air, with a positive impact on carbon neutrality.

The application of the entomopathogenic fungus Akanthomyces muscarius modified GFP to study endophytization

Entomopathogenic fungi (EPF) of the genus Akanthomyces (formerly Lecanicillium) are one of the most common and important fungal entomopathogens, infecting sucking insects of the order Hemiptera mainly. The fungi can also parasitize on phytopathogenic fungi (rust, powdery mildew). The entomopathogens from these genera reported as endophytes in various plants under natural conditions [1–2], contributing to an increase in plant immunity to pathogens, as well as a decrease in plant colonization by pests. Endophytic colonization of plants by the fungus Akanthomyces lecanii can suppress the growth of the peach aphid [3]. Akanthomyces muscarius strains caused the death of moth when feeding on cabbage colonized by the fungus [4]. Endophytic properties were assessed using the A. muscarius (= Lecanicillium muscarium) strain Vl 72-GFP fluorescently labeled with GFP [5]. The transformation was done by electroporation of germinated conidia of the high-virulent “wild” strain Vl 72 by the pBARGPE1 vector harboring an eGFP gene, showed an expression of fluorescent protein without affecting fungal growth and virulence. The influence of the fungus on the growth rates of beans was revealed when leaves, sterile soil and seeds were treated with a suspension of conidia of 108 spores/ml. On the 7th day, stimulation of the growth of the stems and roots of the beans was observed when the seeds were soaked in a spore suspension of the fungus. When spraying the leaves, only the stem’s elongation was observed. The studied strain colonizes beans irregularly. When treating the seeds, the fungus was isolated in greater quantities from the roots (26%), when spraying the leaves — from the stem (36%), when watering the soil — also from the stem (43%). Infection of A. muscarius plants by spilling the soil was most effective. No effect of endophytization was found on the number of aphids after 14 days of aphid plant colonization. As a result of the introduction of the spores of Vl 72-GFP strain by shedding the soil under flower crops (lantana, gerbera, acanthus) in the greenhouse of Saint Petersburg Botanical Garden, this strain was isolated from the leaves of the Acanthus mollis L. after one month, which confirms the ability of this species to endophytic colonization of plants in greenhouse conditions. Analysis of hyphae Vl 72-GFP in the plant performed on an AxioImager M1 fluorescent microscope demonstrated the same level of fluorescence as in A. muscarius hyphae growing on the media.

Microbial consortia as an option for biocontrol of Stromatinia cepivora

Stromatinia cepivora, the causal agent of white rot, is responsible for 60–80% of economic losses in onion and garlic crops. This work aimed to select biological control agents (BCAs) to control white rot. Ten microorganisms were tested for hyperparasitic activity on S. cepivora sclerotia in garlic (Allium sativum). Bioassays consisted of pots filled with sterile soil and 50 sclerotia in a plastic tulle bag. Four microorganisms were selected to compare their capability for degrade sclerotia on garlic. Our results showed that increasing degradation happened when Th034, Th035, Th003, and Bs006 were added to the pots containing garlic. Subsequently, three application techniques (seeds, seedlings at transplant, and seeds and transplant) were evaluated. Seven BCAs applied singly and in mixtures were evaluated in semi-field experiments for their ability to reduce white rot symptoms in onion plants in soil inoculated with 300 sclerotia per kilogram. The results indicated that efficacy was dependent on microrganism, mixture, and technique of application. The synergy factor showed that only two treatments have synergistic effects. In both cases, the mixture consisted of a strain of Bacillus and two species of Trichoderma (T. koningiopsis, T. atroviride) applied twice. In most cases, antagonistic interactions among BCAs were observed.

Enhanced bioremediation of pesticides contaminated soil using organic (compost) and inorganic (NPK) fertilizers

This research examined the bioremediation of pesticides (Carbofuran and Paraquat) contaminated farmyard soil using compost and Nitrogen, Phosphorus, and Potassium (NPK) fertilizer. Microcosms representing each treatment were set-up in triplicates. Biostimulation was done using two concentrations (0.5 % and 1.0 % w/w) of NPK fertilizer and compost, following pesticides application at recommended rates [Carbofuran (1 g/kg) and Paraquat (5 ml/kg)] and four times the recommended rates. Two control soils were set-up; Abiotic control (sterile farmyard soil + pesticide) and Control (farmyard soil without treatment). Monitoring of the dynamics in microbial community abundance, and pesticide residues during the biostimulation period was done weekly for 28 days, using standard enumeration method, and High Performance Liquid Chromatography (HPLC), respectively. At the end of the monitoring period, considerable reduction in pesticide residues across the treatment set-ups was recorded. In Carbofuran-treated soils, there were no complete, but considerable losses in residual pesticide, however, in most of the Paraquat-treated soils, there were complete losses within 21 days. Lower pesticide residues were recorded in set-ups amended with compost than NPK, across both Carbofuran and Paraquat-treated soils. After pesticides application, decreases in microbial counts were recorded at Day 7 across all the treatments, followed by increases from Day 14–21, then decreases at Day 28. Microbial counts were lower in Carbofuran than in Paraquat-treated soils irrespective of nutrient (compost and NPK) amendments. Bacterial and fungal counts were in the magnitude of 106 and 105 CFU/g soil, respectively. Also, increased counts were recorded for Actinomycetes, Nitrifiers, Phosphate solubilizers across all treatments, and were in magnitude of 103–104 CFU/g soil. Soil microorganisms could breakdown and eliminate large concentrations of Carbofuran and Paraquat in compost-amended soils than in NPK-amended soils. This study suggests that bioremediation of pesticides contaminated soils can be achieved and enhanced by stimulating the indigenous microbial community with requisite nutrients (compost).

Energizing Sustainable Agriculture: Advances in Greenhouse Heating through Microwave-Based Technologies

For the agricultural sector to develop sustainably in the future, progress toward more environmentally friendly technologies and methods is crucial. It is necessary to increase output while reducing the demand for energy, agrochemicals, and water resources. Although greenhouses can be utilized successfully for this purpose, significant technical advancements are required, especially when it comes to heating, to lower the use of fossil fuels and boost energy efficiency. Microwaves can warm plants without heating the entire greenhouse volume, which takes a significant amount of energy to compensate for heat loss in the outdoor environment. In this paper, through a thorough examination of the state of the art, a general overview of novel greenhouse heating systems based on radiation is reported. First, the strengths and weaknesses of microwave heating are discussed, and finally, the use of microwaves for soil sterilization is examined. All outcomes suggest these irradiation-based technologies can contribute significantly to energetically sustainable agriculture; moreover, they can be used to increase plant comfort.

First Report of the guava root-knot nematode (Meloidogyne enterolobii) on Selenicereus costaricensis in Guangxi, China.

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 μm, stylet lengths = 15.1 ± 0.9 μm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 μm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 μm, stylet lengths = 14.7 ± 0.5 μm, DGO = 3.5 ± 0.4 μm, tail lengths averaged = 43.6 ± 9.7 μm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.

Bacterial Density in Soil Samples Collected from Hospital Wastes Dumping Site at Chukwuemeka Odumegwu Ojukwu Medical Centre, Uli, Anambra State, Nigeria.

The soil quality is characterized by adequate nutrients as a result of abundant nutrients cycling bacteria. Most soil in Nigeria has been subjected to different kinds of pollutants resulting from anthropogenic activities which have become a major threatening factor to the quality of soil. This study was carried out to evaluate bacterial density in soil samples collected from hospital wastes dumping site at Chukwuemeka Odumegwu Ojukwu Medical Centre, Uli, Anambra State. A total of 30 composite soil samples were aseptically collected from the site using a sterile soil auger. The samples were analyzed for total heterotrophic bacterial count (THBC) and phosphate solubilizing bacterial count (PSBC) using standard plate technique. The predominant bacterial isolates that aided nutrients cycling were appropriately characterized, and their densities in both impacted and non-impacted soil samples were enumerated. Also, the bacterial isolates were characterized based on morphology, microscopy, and biochemical characteristics. There was an increase in the THBC and PSBC in the impacted soil, and Gram negative rods such as Pseudomonas, Klebsiella, and Micrococcus species (Gram positive) were the bacterial isolates. The study has revealed that wastes generated from hospital enhances microbial proliferation in the soil, which invariably increases soil fertility. Keywords: Bacterial Density, Soil Samples, Hospital Wastes and Dumping Site

Bacterial Diversity and Occurrences in Cassava Effluent-Contaminated Soil Collected From Ozubulu, Anambra State, Nigeria

Environmental degradation due to indiscriminate disposal of refuse has a tremendous effect on microbial activities in the soil. Most soil in Nigeria has been subjected to different kinds of pollutants resulting from anthropogenic activities which have become a major threatening factor to the quality of soil. This study was undertaken to evaluate bacterial diversity and occurrences in cassava effluent contaminated soil from Ozubulu, Anambra State. A total of 30 composite soil samples were aseptically collected from cassava effluent disposal site using a sterile soil auger. The predominant bacterial isolates that aided nutrients cycling were appropriately characterized, and their diversities in both impacted and non-impacted soil samples were enumerated. Furthermore, the bacterial isolates were characterized based on morphology, microscopy, and biochemical characteristics. There was a significant reduction in the occurrences of the bacterial isolates in the impacted soil, and Gram negative rods such as Pseudomonas, Klebsiella and Micrococcus (Gram positive) species were the bacterial isolates. The study has revealed that cassava effluent affects microbial distribution in the soil. Keywords: Bacterial, Diversity, Occurrences, Cassava, Effluent-Contaminated and Soil

Micropropagation of Lepidium ostleri (Brassicaceae), a native endemic plant species

Lepidium ostleri S.L. Welsh & Goodrich (Ostler’s peppergrass) is an endemic plant species restricted to Ordovician limestone outcrops associated with the San Francisco Mountain Range in western Utah. Due to restricted population distribution and proximity to modern mining operations, L. ostleri is a species of conservation interest. This study focused on the development of a micropropagation protocol for propagating mature plants using plant tissue culture methods. Indirect shoot organogenesis was obtained from L. ostleri explants on Murashige and Skoog (MS) medium augmented with various concentrations of BAP (6-Benzylaminopurine), kinetin (N6-furfuryladenine), and IAA (indole-3-acetic acid). Plantlets supporting shoots grown in vitro were pulse treated with differing strengths of indole-3-butyric acid (IBA) and transferred to sterile soil. Following root induction, plantlets were acclimated to ambient conditions. The successful development of a micropropagation protocol supports management activities for L. ostleri and also contributes to in vitro propagation knowledge at the species, genus, and family levels.

The role of the soil microbiome in the colonisation of glacier forefields by Antarctic pearlwort (Colobanthus quitensis) under current and future climate change scenarios

Glacier retreat in cold regions exposes new terrain for plant colonization. However, the roles of soil microbiomes in plant establishment and performance on newly-exposed forefields have rarely been assessed. Here, we compared the survival of Antarctic pearlwort (Colobanthus quitensis) individuals grown for three years in sterilised and unsterilised soils at sites initially at 30 m, 100 m and 300 m from three retreating Maritime Antarctic glaciers. We also installed open top chambers (OTCs), which increased air temperatures by ∼1.8 °C and reduced soil water potential by ≤ 4 kPa, on one forefield to test the effects of warming on C. quitensis survival and the soil microbiome. The main driver of plant performance was distance from glacier fronts, with a 32 kPa reduction in soil water potential apparently explaining reduced plant survival at 300m compared with 30 m from glaciers. Soil sterilisation had few effects on plant survival at 30 m and 100 m, but reduced survival at 300 m, which was attributable to reductions in beneficial plant-microbial interactions. Effects of OTCs on plant survival were amplified with distance from glacier and sterilisation, with plants not surviving in chambered and sterilised soil at 300 m after three years. Soil bacterial functionality altered from a phototrophic community at 30 m to a more specialized chemoheterotrophic community at 100–300 m. Fungal ortholog groups showed transfer RNA and ribosome biogenesis to be enriched in soil at 30 m, with spliceosomes and messenger RNA synthesis being more frequent at 300 m. We propose that soil microbiomes improve the environmental tolerance of C. quitensis through enhanced physiological performance, which in turn improves survival and facilitates the species’ colonization of newly-exposed glacier forefield soils. These plant-microbe interactions are likely to become increasingly important as the climate of Maritime Antarctica changes over future decades.

Deciphering survival strategies: Oxidative stress and microbial interplay in Eisenia fetida under tetracycline contamination

Soil contamination resulting from residual antibiotics presents a pressing need to understand the survival mechanisms of soil organisms in polluted environments. This study focused on Eisenia fetida, and tetracycline stress experiments were conducted in a controlled environment using sterile artificial soil. The stress concentration ranged from 0 to 600 mg/kg, and stress cycles lasted either 10 or 30 days. The objective of this study was to assess the effects of oxidative stress and the changes in microbial communities both within and outside the earthworms. A comprehensive mathematical model was developed to elucidate the responses of organisms following exposure to stress utilizing factor analysis, grey relational analysis, and hierarchical entropy weight analysis. Under tetracycline stress, the initial stage (1–3 days) exhibited a coordinated regulation of oxidative stress and microbial communities in the soil with the assistance of CAT and GPX enzymes. The subsequent stage (4–5 days) further emphasized the influence of soil microbial communities. A notable “feedback regulation” of soil microbial communities on oxidative stress was observed during the third stage (6–8 days). Earthworms maintained a metabolic balance in the fourth stage (9–10 days). In the long term, the stress-induced a self-detoxification mechanism within soil microbial communities, which collaborated with GPX to respond to oxidative stress.

First Report of Root Rot on Paris polyphylla var. yunnanensis caused by Fusarium solani in Yunnan, China.

Paris polyphylla var. yunnanensis is a perennial herb with diverse chemical components having wide-ranging pharmacological effects. The demand for P. polyphylla var. yunnanensis as a raw material increases greatly and currently exceeds 1,000 tons per year (Zhou et al. 2021). In September 2021, root rot was observed on P. polyphylla var. yunnanensis in Mangshi, Yunnan province, China. Average disease incidences in the fields reached 15%, with diseased plants exhibiting yellowing and wilting leaves, as well as browning and rotting roots. Cross sections (5 × 5 mm2) cut from the margin of symptomatic and asymptomatic root tissues were surface-sterilized for 30 s with 75% ethanol, followed by 180 s with 1% sodium hypochlorite. After rinsing thrice with sterile distilled water, the fragments were transferred to potato dextrose agar (PDA) plates and incubated at 28°C in the dark. Ten isolates were obtained, and single spore isolation was performed. These isolates showed similar morphological characters, with colonies ranging in color from white to pale cream and sparse mycelia. Conidia were produced on the top or side of phialides. Microconidia were oval or reniform, 0- or 1-septate, with a diameter of 5.1-10.7 µm × 1.6-3.9 µm (average 7.6 μm × 2.8 µm) (n=30). The macroconidia were straight to slightly curved or sickle-shaped, 3- to 5-septate, with a diameter of 15.1-27.9 μm × 2.8-4.0 μm (average 21.0 μm × 3.6 μm). Chlamydospores were smooth, nearly round, and 3.3-6.6 (average 4.9) μm in diameter. Genomic DNA were extracted from mycelia of the two isolates. The nuclear ribosomal internal transcribed spacer (ITS), translation elongation factor 1 alpha (EF1α), and the second largest subunit of nuclear DNA-directed RNA polymerase II (RPB2) were amplified with the primer pairs of ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Carbone and Kohn 1999), and fRPB2-5F/fRPB2-7cR (Liu et al. 1999), respectively. These two isolates exhibited the same nucleotide sequences (ITS, OP646781; EF1α, OP661172; RPB2, OP661173), with BLASTn analyses showing 100%, 99.66%, and 99.65% identity, respectively, with Fusarium solani (syn. Neocosmospora solani) (Crespo et al. 2019) strain NRRL 43474 (ITS, EF453097; EF1α, EF452945; RPB2, EF469984). A phylogenetic tree was constructed using MEGAX based on the nucleotide sequences of ITS, EF1α, and RPB2, using the maximum likelihood method. The isolate was classified into the F. solani clade. According to the morphology and sequence analyses, the isolate was identified as F. solani (Chehri et al. 2015), and named PpFs1. To test the pathogenicity of the isolate PpFs1, the roots of four years old P. polyphylla var. yunnanensis plants were dipped in 107 spore/mL suspension filtered from potato dextrose broth (PDB) for 30 min, while control roots were dipped in sterile water. After inoculation, all plants were transplanted in pots filled with sterile soil and kept at 25°C with a 12/12-h light/darkness photoperiod. Six plants were used for each treatment, and repeated thrice. Two months after inoculation, the infected plants showed wilted leaves and rotted roots, while controls remained asymptomatic. PpFs1, identified by morphology and ITS, was re-isolated from infected plants, and was found to comply with Koch's postulates. To the best of our knowledge, F. oxysporum and F. concentricum causes Paris polyphylla var. Chinensis stem rot in China. But this is the first report of root rot on P. polyphylla var. yunnanensis being caused by F. solani in Yunnan, China.

Plant diversity and soil legacy independently affect the plant metabolome and induced responses following herbivory.

Plant and soil biodiversity can have significant effects on herbivore resistance mediated by plant metabolites. Here, we disentangled the independent effects of plant diversity and soil legacy on constitutive and herbivore-induced plant metabolomes of three plant species in two complementary microcosm experiments. First, we grew plants in sterile soil with three different plant diversity levels. Second, single plant species were grown on soil with different plant diversity-induced soil legacies. We infested a subset of all plants with Spodoptera exigua larvae, a generalist leaf-chewing herbivore, and assessed foliar and root metabolomes. Neither plant diversity nor soil legacy had significant effects on overall foliar, root, or herbivore-induced metabolome composition. Herbivore-induced metabolomes, however, differed from those of control plants. We detected 139 significantly regulated metabolites by comparing plants grown in monocultures with conspecifics growing in plant or soil legacy mixtures. Moreover, plant-plant and plant-soil interactions regulated 141 metabolites in herbivore-induced plants. Taken together, plant diversity and soil legacy independently alter the concentration and induction of plant metabolites, thus affecting the plant's defensive capability. This is a first step toward disentangling plant and soil biodiversity effects on herbivore resistance, thereby improving our understanding of the mechanisms that govern ecosystem functioning.

Sterile soil mitigates the intergenerational loss of gut microbial diversity and anxiety-like behavior induced by antibiotics in mice

The decline in gut microbial diversity in modern humans is closely associated with the rising prevalence of various diseases. It is imperative to investigate the underlying causes of gut microbial loss and restoring methods. Although the impact of non-perinatal antibiotic use on gut microbiota has been recognized, its intergenerational effects remain unexplored. Our previous research has highlighted soil in the farm environment as a key factor for gut microbiome health by restoring gut microbial diversity and balance. In this study, we investigated the intergenerational consequences of antibiotic exposure and the therapeutic potential of sterile soil. We treated C57BL/6 mice with vancomycin and streptomycin for 2 weeks continuously, followed by a 4–8 week withdrawal period before breeding. The process was repeated across 3 generations. Half of the mice in each generation received an oral sterile soil intervention. We assessed gut microbial diversity, anxiety behavior, microglial reactivity, and gut barrier integrity across generations. Antibiotic exposure led to a decrease in gut microbial diversity over generations, along with aggravated anxiety behavior, microgliosis, and altered intestinal tight junction protein expression. Oral sterile soil intervention restored gut microbial diversity in adult mice across generations, concomitantly rescuing abnormalities in behavior, microgliosis, and intestinal barrier integrity. In conclusion, this study simulated an important process of the progressive loss of gut microbiota diversity in modern humans and demonstrated the potential of sterile soil to reverse this process. This study provides a theoretical and experimental basis for research and interventions targeting multiple modern chronic diseases related to intestinal microorganisms.

Environmental fate and metabolic transformation of two non-ionic pesticides in soil: Effect of biochar, moisture, and soil sterilization

Soil moisture, organic matter, and soil microbes are the key considering factors that control the persistence, degradation, and transformation of applied pesticides under varied soil conditions. In this study, underlying influence of these factors was assessed through the fates and metabolic transformation of two non-ionic pesticides (e.g., Phorate and Terbufos) in soils. Concisely, two distinct experiments including a customized batch equilibrium (sorption study), and a lab incubation trial (degradation study) were performed, following the OECD guidelines. As per study findings, biochar (BC) amendment was found to be the most influential factors during sorption study, particularly, 1% BC amendment contributed to achieve the best results. In addition, the non-linearity of sorption isotherm (1/n < 1.0) was revealed through Freundlich isotherm, indicating the strong adsorption of studied pesticides onto the soils. On the other hand, during degradation study, soil moisture initiates the enhanced degradation of parent pesticides and subsequent metabolism. In the presence of 40% water holding capacity (WHC), 1% BC amendment enhances the metabolic transformation, while H2O2 treatment could hinder the process. Additionally, the half-life degradation (t1/2) of phorate and terbufos was controlled by biochar amendment, moisture, and soil sterilization, respectively. Finally, BC can accelerate the metabolic transformation, whereas, phorate underwent a metabolic change into sulfoxide and sulfone while terbufos turned into solely sulfoxide. This pioneering study gathered crucial data for understanding the persistence and metabolic transition of non-ionic pesticides in soils and their patterns of degradation.

In-vivo Screening of Cherry Tomato [Solanum lycopersicum L. var. cerasiforme (Dunnal) A. Gray] Genotypes and Hybrids against Fusarium Wilt in Arunachal Pradesh, India

Cherry tomato [Solanum lycopersicum L. var. cerasiforme (Dunnal) A. Gray] is becoming popular among various tribes of Arunachal Pradesh due to its unique taste, flavor and appearance. Owing high rainfall and high humidity, successful cultivation of cherry tomato is becoming restricted in this state due to various biotic factors like infection of wilt complexes as well as pests like root-knot nematodes. The aim of the present investigation was to evaluate eighteen cherry tomato genotypes (nine) and hybrids (nine) against Fungal wilt caused by Fusarium oxysporum f. sp. lycopersici resistance in the Pasighat condition of Arunachal Pradesh, India. For screening purpose, artificial pathogen inoculation method was applied through pin-prick method in the 35 days old cherry tomato seedlings that were grown in pot culture containing sterile soil and data for the pathogen infection was recorded by following Completely Randomized Design (CRD) in 60 days and 120 days after pathogen inoculation. Among 18 genotypes and hybrids, G4xG6 (DI:0.00%, PDI:0.00%), G9 (DI:0.00%, PDI:0.00%) and G5 (DI:0.00%, PDI:0.00%) showed highest resistance towards Fusarium wilt, while genotype G3 (DI:65.56%, PDI:63.60%) exhibited susceptible system. The disease incidence was ranged from 0.00%-65.56%. The use of resistant genotypes and hybrids to manage the population of fungus is a very cost effective method and can be exploited commercially in breeding programmes and for vegetable grafting.

First Report of Root Rot Caused by Ilyonectria robusta in the Medicinal Herb Aconitum carmichaelii in China.

Aconitum carmichaelii Debeaux is used as a traditional Chinese medicine with antiarrhythmic, antiinflammatory and other pharmacological functions. It is widely cultivated in China. According to our survey, about 60% of A. carmichaelii in Qingchuan, Sichuan, suffered from root rot, reducing yields by 30% in the past five years. Symptomatic plants exhibited stunted growth, dark brown roots, reduced root biomass, and fewer root hairs. The disease caused root rot and plant death in 50% of the infected plants. In October 2019, ten symptomatic 6-month-old plants were collected from fields in Qingchuan. Diseased pieces of the roots were surface sterilized with sodium hypochlorite solution (2%), rinsed three times in sterile water, plated on potato dextrose agar (PDA), and incubated at 25°C in the dark. Six single-spore isolates of a Cylindrocarpon-like anamorp were obtained. The colonies on PDA were 35 to 37 mm diam after seven days with regular margins. The plates were covered with felty aerial mycelium, white to buff, and the reverse side chestnut near center with a ochre to yellowish leading edge. On spezieller nährstoffarmer agar (SNA), macroconidia were 1 to 3 septate, straight or slightly curved, cylindrical, with rounded ends, and varied in size: 1-septate 15.1 to 33.5 × 3.7 to 7.3 μm (n=250), 2-septate 16.5 to 48.5 × 3.7 to 7.6 μm (n=85), and 3-septate 22.0 to 50.6 × 4.9 to 7.4 μm (n=115). Microconidia were ellipsoid to ovoid, and 0 to 1 septate; aseptate spores were 4.5 to 16.8 × 1.6 to 4.9 μm (n=200), and 1-septate spores were 7.4 to 20.0 × 2.4 to 5.1 μm (n=200). The chlamydospores were brown, thick-walled, globose to subglobose, 7.9 to 15.9 μm (n=50). The morphology of these isolates was consistent with the previous description of Ilyonectria robusta (Cabral et al. 2012). Isolate QW1901 was characterized by sequencing the ITS, TUB, H3, and tef1α loci using previously reported primer pairs: ITS1/ITS4 (White et al. 1990), T1/Bt-2b (O'Donnell and Cigelnik 1997), CYLH3F/CYLH3R (Crous et al. 2004), and EF1/EF2 (O'Donnell et al. 1998). A Blastn search of the sequences of ITS, TUB, H3, and tef1α showed that QW1901 shared 99.26, 97.89, 97.79, and 99.17 % identities, respectively, with the ex-type strain of I. robusta (CBS308.35). The ITS, TUB, H3, and tef1α sequences were deposited in GenBank under accession nos. MW534715, and MW880180 to MW880182, respectively. A phylogenetic tree was constructed from a neighbor-joining analysis on the alignment of the combined ITS, TUB, H3, and tef1α sequence. QW1901 was clustered with the ex-type strain of I. robusta. To confirm the pathogenicity of I. robusta, bare roots of healthy 6-month-old A. carmichaelii were inoculated with mycelial plugs of 7-day-old QW1901 colonies selected randomly (Lu et al. 2015). Five needle-wound lateral roots and five intact roots were inoculated as replicates with pathogen-free agar plugs as a control. Then, all plants were grown in sterile soil in a growth chamber at 20±1°C and watered regularly. Pathogenicity assays were repeated twice. After 20 days of cultivation, infected plants exhibited symptoms similar to those observed in the field. All control plants remained asymptomatic. Sequencing confirmed the re-isolation of I. robusta from the inoculated plants, satisfying Koch's hypothesis. Ilyonectria robusta has been reported to cause root rot of plants such as Codonopsis tangshen and Panax ginseng ( Lu et al. 2015; Zheng et al. 2021), and has also been reported to be isolated from Aconitum kongboense in China (Wang et al. 2015). However, this is the first report of the pathogen causing root rot of A. carmichaelii. Management measures, such as growing disease-free seedlings in sterile soil, should be used to minimize the risk of this pathogen.

The effects of atoxigenic A. flavus co-applied with T. asperellum on the population dynamics of toxigenic A. flavus in the soil

Aspergillus flavus is an important aflatoxigenic fungal specie infecting crops from production to storage. Contamination of foods and their products by these mycotoxins has become a problem worldwide; in Tanzania, related deaths were reported in 2017. This study focused on assessing the effectiveness of atoxigenic Aspergillus flavus, Trichoderma asperellum and a co-inoculated atoxigenic A.flavus and T.asperellum on the population dynamic of toxigenic A.flavus in the soil. A pot experiment was set in the screen house where a known concentration of fungal inoculum was added to the sterile soil. Aspergillus spp. were isolated from soil samples by dilution plate techniques on Modified Dichloran Rose Bengal (MDRB) agar and sub-cultured on potato dextrose agar (PDA). Identification was made using morphological and microscopic characteristics of culture in PDA media. Total colony forming units (CFU g-1 of soil) and incidence percent were derived from colony count data recorded. R-statistical software version 4.0.4 was used to analyse the collected data. There was a significant difference between treatments on reducing the population (CFU/g) of toxigenic A.flavus in soil (p&lt; 2.2×10-16). Co-inoculated T.asperellum and atoxigenic A.flavus significantly reduced the population (CFU g-1 of soil) of toxigenic A.flavus to 1.4×105 CFU g-1 of soil as compared to control treatment 4.5×105 CFU g-1 of soil. There was a strong positive correlation (p&lt;0.001) between the incidence percent and population of toxigenic A.flavus in the soil under different biocontrol treatments. Co-inoculated T. asperellum and atoxigenic A. flavus had the lowest incidence of 36.3% to other treatments. The findings of this study demonstrate that co-inoculated atoxigenic A.flavus and T.asperellum was effective biocontrol treatment for reducing the population of Aspergillus flavus in the soil ecosystem.