Small RNA Research Articles

Characterization of small RNAs in the spleen of MASH in a non-human primate model

Metabolic dysfunction-associated steatotic liver disease (MASLD) and its advanced stage, metabolic dysfunction-associated steatohepatitis (MASH), are increasingly recognized as a global health issue. This study examines the role of small RNAs in the spleen of MASH using a non-human primate model. We performed high-throughput small RNA sequencing on spleen tissues from MASH-primates, revealing significant alterations in the expression of small non-coding RNAs, especially miRNAs. Notably, miR-96, miR-182, miR-183, and miR-122 showed differential expression in MASH spleens. Predictive and validation studies have identified potential target genes, such as PTX3 and NFIX, that were significantly dysregulated in spleens of MASH. These findings characterized small RNAs in spleen of MASH and offer a novel insight for further research for MASH.

The Effect of MiR320a on Lung Cancer.

Lung cancer has a high mortality rate among cancers in both women and men. Currently, lung cáncer diagnosis is made with clinical examination, low-dose CT scan and molecular-based methods and its treatment options include chemotherapy, surgery, radiotherapy or immunotherapy. However, the life expectancy of lung cancer is not very high, and still it is usually diagnosed very lately, which leads to poorer prognosis. MicroRNAs [miRNAs] are small noncoding RNAs that regulate many diverse activities in the cell that can affect tumorigenesis by regulating many cell functions related to cancer, such as cell cycle, metastasis, angiogenesis, me-tabolism, and apoptosis. Also, it can have a potential diagnostic, therapeutic, and prognostic value for lung cancer. MiR320a is a promising microRNA that may help us in the diagnosis, treatment and prognosis of lung cancer, but some aspects of its clinical application are still vague, especially its effect on heavy smokers, delivery mechanism, toxicity and lack of reliable critical value. In this paper, we examined its comprehensive molecular interactions that lead to its tumor suppres-sor effect, and we reviewed its clinical application until now.

Unraveling the Emerging Niche Role of Extracellular Vesicles (EVs) in Traumatic Brain Injury (TBI).

Extracellular vesicles or exosomes, often known as EVs, have acquired significant attention in the investigations of traumatic brain injury (TBI) and have a distinct advantage in actively researching the fundamental mechanisms underlying various clinical symptoms and diagnosing the wide range of traumatic brain injury cases. The mesenchymal stem cells (MSCs) can produce and release exosomes, which offer therapeutic benefits. Exosomes are tiny membranous vesicles produced by various cellular entities originating from endosomes. Several studies have reported that administering MSC-derived exosomes through intravenous infusions improves neurological recovery and promotes neuroplasticity in rats with traumatic brain damage. The therapeutic advantages of exosomes can be attributed to the microRNAs (miRNAs), which are small non-coding regulatory RNAs that significantly impact the regulation of posttranscriptional genes. Exosome-based therapies, which do not involve cells, have lately gained interest as a potential breakthrough in enhancing neuroplasticity and accelerating neurological recovery for various brain injuries and neurodegenerative diseases. This article explores the benefits and drawbacks of exosome treatment for traumatic brain injury while emphasizing the latest advancements in this field with clinical significance.

Prevalence and Subtypes Distribution (ST10, ST14, ST25, ST26) of Blastocystis spp. in Anatolian Water Buffalo (Bubalus bubalis) in Van, Türkiye.

Blastocystis spp. is one of the most common protozoa worldwide, living in the gastrointestinal tract of humans and many other animals. On the basis of the genetic heterogeneity of small subunit ribosomal RNA, at least 28 subtypes (ST1-ST17, ST21 and ST23-ST32) are reported to exist in mammals and birds. This study was carried out to determine the prevalence and subtypes of Blastocystis spp. in Anatolian buffaloes (Bubalus bubalis) in Van province in the Eastern Anatolia Region of Turkey. DNA was extracted using commercial GeneMATRIX Stool DNA Purification Kit and then stored at -20°C until PCR amplification. After PCR amplification of the SSU rRNA gene region positive Blastocystis spp., amplicons from buffalo faeces were sequenced and then deposited in GenBank (OR576949.1, OR576950.1, OR576970.1, OR576971.1, OR577019.1, PP837943.1, PP837940.1, PP837939.1, PP837604.1, PP837937.1, PP837934.1, PP837601.1, PP837936.1 and PP837603.1). PCR analysis of 120 faecal samples showed a total prevalence of 11.67% (14/120). The prevalence was higher in females and young animals (p>0.05). Sequence analysis revealed Blastocystis spp., ST10, ST14, ST25 and ST26 subtypes. To our knowledge, Blastocystis subtypes ST25 and ST26 in buffaloes were reported for the first time in this study. It is thought that more large-scale studies should be carried out to determine the zoonotic subtype potential of this protozoan in the region.

CRH upregulates supervillin through ERK and AKT pathways to promote bladder cancer cell migration.

Corticotropin-releasing hormone (CRH) has been well documented playing a role in the regulation of cellular processes, immune responses, and inflammatory processes that can influence the occurrence and development of tumors. Supervillin (SVIL) is a membrane-associated and actin-binding protein, which is actively involved in the proliferation, spread, and migration of cancer cells. This work investigated CRH's influence on bladder cancer cells'migration and relevant mechanisms. By using human bladder cancer cells T24 and RT4 in wound healing experiments and transwell assay, we found that the migration ability of the T24 cells was significantly increased after CRH treatment. In vivo experiments showed that CRH significantly promoted the metastases of T24 cells in cell line-derived xenograft (CDX) mouse model. Interestingly, downregulation of SVIL by SVIL-specifc small hairpin RNAs significantly reduced the promoting effect of CRH on bladder cancer cell migration. Furthermore, CRH significantly increased SVILmessenger RNA and protein expression in T24 cells, accompanied with AKT andERK phosphorylation in T24 cells. Pretreatment with AKT inhibitor (MK2206) blocked the CRH-induced SVIL expression and ERK phosphorylation. Also, inhibition of ERK signaling pathway by U0126 significantly reduced the CRH-induced SVIL expression and AKT phosphorylation. It suggested that cross-talking between AKT and ERK pathways was involved in the effect of CRH on SVIL. Taken together, we demonstrated that CRH induced migration of bladder cancer cells, in which AKT andERK pathways -SVIL played a key role.

Oral administration of herbal oligonucleotide drug JGL-sRNA-h7 ameliorates hyperglycemia in db/db mice and beagle dogs.

Type 2 diabetes mellitus is a prevalent metabolic disease, posing a considerable threat to public health. Oligonucleotide drugs have proven to be a promising field of therapy for the diseases. In this study, we reported that a herbal small RNA (sRNA), JGL-sRNA-h7 (B34735529, F1439.L002444.A11), could exhibit potent hypoglycemic effects by targeting glucose-6-phosphatase. Oral administration of sphingosine (d18:1)-JGL-sRNA-h7 bencaosomes ameliorated hyperglycemia and diabetic kidney injury better than metformin in db/db mice. Furthermore, glucose tolerance was also improved in sphingosine (d18:1)-JGL-sRNA-h7 bencaosomes-treated beagle dogs. Our study indicates that JGL-sRNA-h7 could be a promising hypoglycemic oligonucleotide drug.

Bioorthogonal Chemistry: Enzyme Immune and Protein Capture for Enhanced LC-MS Bioanalysis.

Immunocapture liquid chromatography-mass spectrometry (IC-LC-MS) bioanalysis has become an indispensable technique across various scientific disciplines, ranging from drug discovery to clinical diagnostics. While traditional immunocapture techniques have proven to be effective, they often encounter limitations in sensitivity, specificity, and compatibility with MS analysis. Chemoenzymatic immunocapture and protein capture (IPC) offers a promising solution, combining the high specificity of antibodies or proteins with the versatility of enzymatic and chemical modifications. This Review explores the foundational principles of chemoenzymatic IPC and examines various modification strategies including bioorthogonal click-chemistry, enzymatic-tagging, and HaloTag/CLIP-tag. Recent advancements in chemoenzymatic IPC techniques have significantly expanded their applicability to a diverse range of biomolecules including small molecules, peptides, RNAs, and proteins. This Review focuses on improvements in analytical performance achieved through these innovative approaches. Moreover, we discuss the broad applications of chemoenzymatic immunocapture in drug discovery, clinical diagnostics, and environmental analysis and explore its potential for future advancements in bioanalysis. We propose a novel solid-phase chemoenzymatic IPC assay (SCEIA) that effectively utilizes bioorthogonal click chemistry and chemoenzymatic approaches for efficient IPC and target analyte release. In summary, chemoenzymatic IPC represents a transformative paradigm shift in IC-LC-MS bioanalysis. By overcoming the limitations of traditional IPC techniques, this approach paves the way for more robust, sensitive, and versatile analytical workflows.

Sex differences in RNA transcripts in dilated cardiomyopathy

Abstract Introduction Dilated cardiomyopathy (DCM) is the most common cardiomyopathy and a major cause of heart failure. Differences in clinical presentation and phenotype exist in men and women but the reason for this is not clear. The analysis of the RNA transcripts (mRNA sequencing) offers an opportunity to provide a link between the genome, the proteome, and the phenotype. The aim of this study was to explore sex differences using mRNA sequencing in patients with DCM. Method Our database, an observational prospective cohort study, includes patients referred for suspected cardiomyopathy. The database includes data on patients’ characteristics, symptoms, diagnostic procedures, treatments, cardiac devices, and outcome. Endomyocardial biopsy from the right ventricle was collected and total RNA, including miRNA and other small RNA, was isolated. RNA sequencing and library preparation was performed. Following quality check, reads were aligned to GRCh38 reference genome by STAR (v2.7.10a). Sex-specific differential expression analysis between individuals diagnosed with DCM (cases) versus non-confirmed cardiomyopathy (controls) was performed using DESeq2 (v.1.38.3) adjusting for age, RNA integrity number and systolic blood pressure. After controlling for multiple testing using the Benjamini-Hochberg method, genes with a corrected P-value < 0.05 were considered as being differentially expressed. Gene-set enrichment analysis on differentially expressed genes was performed via Enrichr tool using Descartes cell types and tissues, KEGG biological pathways, DisGeNET, and Gene Ontology Biological Processes (GOBP). Results Patients´characteristics in women and men with DCM is presented in table 1. There was no difference in outcome in men and women (data not shown). Differential expression analyses with transcriptomic data comparing DCM (n=43) versus controls (n=22) stratified by sex (DCM n= 9, (20.9%) women and controls n=7, (30.4%) women) was performed. There was no overlap between differentially expressed genes between sexes (Figure 1). In men gene set enrichment analyses showed that differentially expressed genes were related to pathways involved in dilated and hypertrophic cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy (KEGG). Interestingly, these analyses revealed an enrichment of genes related to platelet biology, namely precursors (Descartes), activation (GOBP, KEGG) and platelet disorder (DisGeNET). In women, HLA-DQB1 was more expressed in DCM. HLA-DQB1 is associated with celiac disease, narcolepsy, and type 1 diabetes. Consistently, the enrichment analyses showed an enrichment of genes involved in autoimmune diseases (DisGeNET). Conclusion Women and men with DCM exhibit differently activated RNA transcripts although no difference in phenotype was observed. This may indicate that although DCM can be caused by similar factors in women and men the transcriptome is differently activated which warrants further investigation.Table 1.

Long noncoding RNA Sngh20 promotes vascular smooth muscle cell senescence and abdominal aortic aneurysm growth by interacting with dead-box helicase 5

Abstract Background Development of non-surgical treatment of human abdominal aortic aneurysm (AAA) has clinical significance. Long noncoding RNAs (lncRNAs) are emerging as powerful mediators participated in cellular senescence process that a critical pathological alteration prompting AAA development. Purpose To investigate the role and underlying mechanism of lncRNA Small nucleolar RNA host gene-20 (Snhg20) in AAA formation. Methods Experimental AAA mice models were produced by peri-aortic CaPO4 injury in C57bl/6J mice or Subcutaneousangiotensin-II (Ang-II) infusion in Apoe–/– mice and gapmeR was used to knockdown Snhg20 expression. Adeno-associated virus and anti-IL-6 monoclonal antibody was used to knockdown dead-box helicase 5 (DDX5) and neutralize IL-6, respectively.Immunohistochemical and immunofluorescent staining, ELISA and real-time PCR were performed to determine the vascular structure and inflammation, cellular senescence and senescence-associated secretory phenotype (SASP) content in human and mouse AAA lesions. Human aortic SMC cell line was used to investigate the effect of Snhg20 knockdown on senescence and SASP in vitro. LncRNA pulldown and mass spectrometry were used to identify potential targets that interact with Snhg20. p53 DNA binding affinity was examined by EMSA. Results The expression of Snhg20 was downregulated in both human and mice AAA lesion. Snhg20 knockdown promoted SMC senescence and loss, vascular inflammation and AAA growth in both experimental AAA mice models. Mechanistically, Snhg20 interacted with DDX5, an important transcriptional coactivator of p53. The absence of snhg20 increased DDX5 and p53 interaction and thereby promoted p53 DNA binding affinity to transcriptionally initiate p21expression, resulting in increased cellular senescence and senescence-associated secretory phenotype (SASP) secretion, including IL-6. Moreover, DDX5 silencing or anti-IL-6 therapy rescued the SMC senescence and loss, vascular inflammation and AAA growth mediated by Snhg20 knockdown. Furthermore, human AAA lesions showed increased DDX5 co-localization with p53 and abundant senescent vascular SMC. Conclusion These findings identify an important role of Snhg20 in controlling vascular SMC senescence and SPAP expression and suggest that Snhg20 is a potential target for AAA treatment aimed at reducing VSMCs senescence.Schematic summary

SNORD3A: a new possible circulating biomarker of human heart failure

Abstract Background Heart failure (HF) is a complex clinical syndrome and the leading cause of mortality, morbidity and hospitalization in industrialized countries. Human cardiac biopsies are invaluable resources for identifying cardiac signaling pathways, however blood fractions and peripheral blood mononuclear cells (PBMCs) could be used as a source of surrogate biomarkers of signaling pathway activation in human heart failure. Purpose In the present study we aimed to identify novel circulating biomarkers mirroring human myocardial signaling in HF and to study the role played by SNORD3A in cardiomyocyte survival and death. Methods Cardiac left ventricle samples and PBLs from 8 HF patients undergoing heart transplantation and 2 control patients (CTRL) were analyzed by RNA sequencing (RNASeq) to identify transcripts that were regulated in both hearts and PBLs. Five identified transcripts, KCNQOT1, MIAT, SCRN1, MALAT1 and SNORD3A, were then validated by quantitative real-time PCR in PBMCs and in LVs. Next, we analyzed the expression of the Small Nucleolar RNA (snoRNA) SNORD3A in LVs and PBMCs from 8-week-old wild type C57BL/6 mice with pressure overload-induced HF by transverse aortic constriction (TAC). Sham-operated mice (sham) were used as controls. To further investigate the role of SNORD3A in cardiomyocyte function and survival, SNORD3A antisense oligonucleotides (SNOaso) and scramble control sequences (GFPaso) were synthesized and tested in cardiomyoblasts H9C2 cells under normoxic or hypoxic conditions to evaluate SNORD3A transcription levels, cell death and protein synthesis. Results SNORD3A expression was significantly increased in both LVs and PBMCs from HF patients compared to control subjects. Consistent with these results, SNORD3A levels were increased both in PBMCs and LVs from TAC mice compared to sham. In vitro hypoxia significantly increased SNORD3A expression levels in H9C2 cells, compared to normoxia. After SNOaso transfection, SNORD3A transcripts were downregulated, and they were further reduced following 3-hour-hypoxia. Depletion of SNORD3A levels increased cardiomyocyte death and reduced protein synthesis in H9C2 cells. Conclusions Our data suggest that SNORD3A might be involved in the regulation of cardiomyocyte survival in HF and could be useful for diagnostic and prognostic applications in HF.

The Role of Non-Coding RNAs in Mitochondrial Dysfunction of Alzheimer's Disease.

Although brain amyloid-β (Aβ) peptide buildup is the main cause of Alzheimer's disease (AD), mitochondrial abnormalities can also contribute to the illness's development, as either a primary or secondary factor, as programmed cell death and efficient energy generation depend on the proper operation of mitochondria. As a result, non-coding RNAs (ncRNAs) may play a crucial role in ensuring that nuclear genes related to mitochondria and mitochondrial genes function normally. Interestingly, a significant number of recent studies have focused on the impact of ncRNAs on the expression of nucleus and mitochondrial genes. Additionally, researchers have proposed some intriguing therapeutic approaches to treat and reduce the severity of AD by adjusting the levels of these ncRNAs. The goal of this work was to consolidate the existing knowledge in this field of study by systematically investigating ncRNAs, with a particular emphasis on microRNAs (miRNAs), long non-coding RNAs (lncRNAs), circular RNAs (circRNAs), and small nucleolar RNAs (snoRNAs). Therefore, the impact and processes by which ncRNAs govern mitochondrial activity in the onset and progression of AD are thoroughly reviewed in this article. Collectively, the effects of ncRNAs on physiological and molecular mechanisms associated with mitochondrial abnormalities that exacerbate AD are thoroughly reviewed in the current research, while also emphasizing the relationship between disturbed mitophagy in AD and ncRNAs.

First time evaluation of myocardium microRNA profile in Anderson-Fabry disease: implications in the pathological processes

Abstract Background Anderson Fabry disease (AFD) is an X-linked lysosomal disorder, characterized by progressive sphingolipid storage and organ dysfunction. Cardiac involvement is characterized by left ventricular hypertrophy, inflammation and fibrosis and is leading cause of mortality. MicroRNAs (miRNAs) are emerging as promising biomarkers in medicine, as they are dysregulated in many human diseases, offering opportunities to improve our understanding of disorders and discover new therapeutic targets. However, so far, only a few studies have evaluated the role of miRNAs in Fabry disease, and cardiac tissue miRNAs have never been assessed. Purpose To determine the specific tissue miRNA profile analyzing myocardial tissue of AFD patients and to evaluate their relationship with the severity of cardiac involvement. Methods 19 AFD patients (10 females [53%]; median age 53 years [IQR 43-63]) undergoing right ventricular endomyocardial biopsy (n=15) or surgical septal myectomy (n=4), standard cardiac magnetic resonance (1.5T, cines for maximum wall thickness (MWT) and indexed LV mass (LVMi) calculation) and high-sensitivity Troponin I (TnI) dosage were included and compared to 7 endomyocardial biopsies of controls. Myocardial samples were fixed in formalin and embedded in paraffin. RNA was extracted from 3-5 slides of tissue and used to generate small RNA libraries (Qiagen) for Next Generation Sequencing analysis on Illumina sequencer. Raw data were normalized and analyzed using DEseq2 pipeline. Correlations were performed using Pearson r; a p < 0.05 was considered statistically significant. Results In AFD group median MWT was 13 mm [IQR 8-17], LVMi was 72 g/m2 [IQR 46-97]. TnI was increased in 9 patients (47%) and NT-proBNP in 8 (42%). 6 patients were on specific AFD treatment. We identified 9 miRNAs differentially expressed in AFD patients compared to controls; miRPath analysis revealed that these miRNAs are associated to pathways involved in AFD pathogenesis (autophagy and mTOR signalling, HIF-1, apoptosis, TGF-beta signalling and inflammation) (figure 1). Moreover, we found 10 miRNAs that were differentially expressed in maximal wall thickness (<10 mm, 10-15 mm, >15 mm) groups (figure 2), in particular 3 miRNAs that progressively increased at the increasing of thickness. Among these miRNAs, miR-21-5p showed the strongest correlation with myocardial hypertrophy (r=0.869, p value<0.001 for MWT; r=0.905, p<0.001 for LVMi) and with cardiac damage (r=0.831, p<0.001 for TnI). Additionally, miR-21-5p had a modest correlation with age (r=0.518, p=0.05) and did not differ between patients on specific AFD treatment and patients not treated (p=0.660). Conclusions This study for the first time evaluated the myocardial miRNA profile in AFD patients and identified miR-21-5p as a cardiac biomarker correlating with clinical heart involvement, both in terms of left ventricular hypertrophy (MWT, LVMi) and myocardium damage (troponin).Figure 1Figure 2

MiRNA Chaining for Efficient Stable Overexpression to Improve Protein Quantity and Quality in CHO Cells.

MicroRNAs (miRNAs), small noncoding RNAs with a length of about 22 nucleotides, harbor the potential to be powerful tools for the genetic engineering of production cell lines like Chinese hamster ovary (CHO) cells. Their ability to regulate multiple targets at once and their potential to fine-tune effect strengths contrast withclassical engineering approaches. However, most studies of miRNAs rely on transiently flooding the cells with miRNA mimics. Since this approach is not suitable for long-term cultivation in a bioprocess, stable overexpression of miRNAs becomes more and more important for the biotech industry. Here, the user might be confronted with insufficient overexpression of the miRNA of interest. In this chapter, we present a method for the generation of stable CHO cell lines expressing a miRNA from a plasmid-based system containing multiple copies of the miRNA, allowing tuning of overexpression and regulation.

Small Nucleolar RNAs in Head and Neck Squamous Cell Carcinomas.

Small nucleolar RNAs (snoRNAs), a distinct class of noncoding RNAs, encompass highly diverse structures and have a range of 60 to 300 nucleotides in length. About 90% of human snoRNAs are intronic and embedded within introns of their host gene transcripts. Most snoRNAs enriched in specific tissue correlate in abundance with their parental host genes. Advancements in high-throughput sequencing have facilitated the discovery of dysregulated snoRNA expression in numerous human malignancies including head and neck squamous cell carcinoma (HNSCC). Hundreds of differentially expressed snoRNAs have been identified in HNSCC tissues. Among 1,524 snoRNA genes in a 567 HNSCC cohort, 113 snoRNAs were found to be survival related. As for snoRNA's roles in HNSCC, based on the available evidence, dysregulated snoRNAs are closely associated with the carcinogenesis and development of HNSCC. Upregulated snoRNAs have been shown to augment the expression of other oncogenes or activate the Wnt/β-catenin signaling pathway, thereby promoting tumor cell viability, glycolysis, migration, and the epithelial-mesenchymal transition while inhibiting apoptosis in vitro. In vivo animal studies have further elucidated the functional roles of snoRNAs. Knockdown of host genes of these snoRNAs suppressed the Wnt/β-catenin signaling pathway and restrained tumor proliferation and aggressiveness in mice. The putative mechanisms underlying these observations are associated with the biological functions of snoRNAs, primarily involving microRNA-like functions through the generation of microRNA-like fragments and regulation of alternative splicing to yield diverse transcripts. While most of the snoRNAs are upregulated in HNSCC, 4 downregulated snoRNAs have been identified and annotated. SNORA36B (implicated in the regulation of DNA templates) and U3 (chr17, influencing cell proliferation) may serve as protective factors associated with prolonged overall survival. This review describes the viable structures of snoRNAs, endeavors to refine snoRNA sequencing technology, and summarizes snoRNAs' expression profile as well as their role in HNSCC progression for potential diagnostic and therapeutic strategies for HNSCC management.

GTSF1 is required for transposon silencing in the unicellular eukaryote Paramecium tetraurelia.

The PIWI-interacting RNA (piRNA) pathway is crucial for transposon repression and the maintenance of genomic integrity. Gametocyte-specific factor 1 (GTSF1), a PIWI-associated protein indispensable for transposon repression, has been recently shown to potentiate the catalytic activity of PIWI in many metazoans. Whether the requirement of GTSF1 extends to PIWI proteins beyond metazoans is unknown. In this study, we identified a homolog of GTSF1 in the unicellular eukaryote Paramecium tetraurelia (PtGtsf1) and found that its role as a PIWI-cofactor is conserved. PtGtsf1 interacts with PIWI (Ptiwi09) and Polycomb Repressive Complex 2 and is essential for PIWI-dependent DNA elimination of transposons during sexual development. PtGtsf1 is crucial for the degradation of PIWI-bound small RNAs that recognize the organism's own genomic sequences. Without PtGtsf1, self-matching small RNAs are not degraded and results in an accumulation of H3K9me3 and H3K27me3, which may disturb transposon recognition. Our results demonstrate that the PIWI-GTSF1 interaction also exists in unicellular eukaryotes with a role in transposon silencing.

LoDEI: a robust and sensitive tool to detect transcriptome-wide differential A-to-I editing in RNA-seq data

RNA editing is a highly conserved process. Adenosine deaminase acting on RNA (ADAR) mediated deamination of adenosine (A-to-I editing) is associated with human disease and immune checkpoint control. Functional implications of A-to-I editing are currently of broad interest to academic and industrial research as underscored by the fast-growing number of clinical studies applying base editors as therapeutic tools. Analyzing the dynamics of A-to-I editing, in a biological or therapeutic context, requires the sensitive detection of differential A-to-I editing, a currently unmet need. We introduce the local differential editing index (LoDEI) to detect differential A-to-I editing in RNA-seq datasets using a sliding-window approach coupled with an empirical q value calculation that detects more A-to-I editing sites at the same false-discovery rate compared to existing methods. LoDEI is validated on known and novel datasets revealing that the oncogene MYCN increases and that a specific small non-coding RNA reduces A-to-I editing.

Gene co-expression analysis reveals conserved and distinct gene networks between resistant and susceptible Lens ervoides challenged by hemibiotrophic and necrotrophic pathogens

As field crops are likely to be challenged by multiple pathogens during their development, the investigation of broad-spectrum resistance in the host is of great interest for crop genetic enhancement. In this study, we attempted to address this question by adopting a weighed gene co-expression approach to study the temporal transcriptome dynamics of resistant and susceptible recombinant inbred lines (RILs) derived from an intraspecific Len ervoides cross during the infection process with either the necrotrophic pathogens Ascochyta lentis or Stemphylium botryosum, or the hemibiotrophic pathogen Colletotrichum lentis. By comparing networks of resistant and susceptible RILs, seven network module pairs were found to possess high correlation coefficients (R > 0.70) and large number of overlapping genes (n > 100). The conserved co-regulation of genes in these network module pairs were involved in plant cell wall synthesis, cell division, cytoskeleton organization, and protein ubiquitin related processes and appeared to be common disease responses against these pathogens. On the other hand, we also identified eight modules with low correlation between resistance and susceptibility networks. Among those, a stronger gene co-expression in R-genes and small RNA processes in the resistant hosts may be enhancing L. ervoides resistance against A. lentis, C. lentis, and S. botryosum, whereas the higher level of synergistic regulation in the synthesis of arginine and glutamine and phospholipid and glycerophospholipids in the susceptible hosts may contribute to increased susceptibility in L. ervoides.

Assessment of heat tolerance and identification of miRNAs during high-temperature response in grapevine

With global warming, heat stress has been recognized as a significant factor limiting grapevine development and fruit quality. MicroRNAs (miRNAs) are a class of small non-coding RNAs known to play crucial regulatory roles in stress resistance. Hence, there is an immediate requirement to cultivate and identify grapevine varieties that are resistant to heat and explore miRNA-mediated heat stress defense mechanisms. In this study, we assessed the thermal resistance of 38 grape germplasm resources and identified a series of miRNAs involved in heat stress resistance. The CK (25°C) and HS (45°C) groups of “Shenyue” cuttings of grapes were used as experimental materials for next-generation sequencing and construct libraries of small RNAs. A total of 177 known and 20 novel miRNAs were detected in the libraries. Differential expression analysis identified 65 differentially expressed miRNAs (DEMs) using the DE-Seq procedure. Furthermore, RT-qPCR validation confirmed complementary expression profiles of eight DEMs and their target genes between the HS and CK groups. Heterologous transformation further identified the function of Vvi-miR3633a downregulated under heat stress in Arabidopsis. In the heterologous expression lines, the survival rate was reduced by high temperature treatment indicating the ability of Vvi-miR3633a to regulate heat resistance. Assessing the heat resistance of grape species and the expression patterns of miRNA in response to high temperatures may reveal the molecular processes of heat resistance regulation mediated by miRNA in grapes under heat stress.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

TRNA and tsRNA: From Heterogeneity to Multifaceted Regulators.

As the most ancient RNA, transfer RNAs (tRNAs) play a more complex role than their constitutive function as amino acid transporters in the protein synthesis process. The transcription and maturation of tRNA in cells are subject to stringent regulation, resulting in the formation of tissue- and cell-specific tRNA pools with variations in tRNA overall abundance, composition, modification, and charging levels. The heterogeneity of tRNA pools contributes to facilitating the formation of histocyte-specific protein expression patterns and is involved in diverse biological processes. Moreover, tRNAs can be recognized by various RNase under physiological and pathological conditions to generate tRNA-derived small RNAs (tsRNAs) and serve as small regulatory RNAs in various biological processes. Here, we summarize these recent insights into the heterogeneity of tRNA and highlight the advances in the regulation of tRNA function and tsRNA biogenesis by tRNA modifications. We synthesize diverse mechanisms of tRNA and tsRNA in embryonic development, cell fate determination, and epigenetic inheritance regulation. We also discuss the potential clinical applications based on the new knowledge of tRNA and tsRNA as diagnostic and prognostic biomarkers and new therapeutic strategies for multiple diseases.