Small Molecule Natural Products Research Articles

Antifungal isopimaradiene diterpenoids from Sagittaria latifoli

Antifungal screening of our small-molecule natural product libraries showed that a column fraction derived from the organic extract of Sagittaria latifolia (Alismataceae) was active against the clinically important opportunistic pathogen Cryptococcus neoformans. Subsequent bioassay- and LC-MS-guided fractionation of this plant extract resulted in the identification of two new isopimaradiene type of diterpenoid glycosides 1 and 2 that exhibited IC50s of 4.1 and 15.4µg/mL, respectively, against C. neoformans. The structures of compounds 1 and 2 were determined by chemical methods and spectroscopic analysis. It was noted that hydrolysis of the glycosides under drastic conditions afforded an artifact aglycone (4) due to the migration of the double bond between C-7 and C-8 in the genuine aglycone 3.

Synthesis of most polyene natural product motifs using just 12 building blocks and one coupling reaction.

The inherent modularity of polypeptides, oligonucleotides, and oligosaccharides has been harnessed to achieve generalized building block-based synthesis platforms. Importantly, like these other targets, most small molecule natural products are biosynthesized via iterative coupling of bifunctional building blocks. This suggests that many small molecules also possess inherent modularity commensurate with systematic building block-based construction. Supporting this hypothesis, here we report that the polyene motifs found in >75% of all known polyene natural products can be synthesized using just 12 building blocks and one coupling reaction. Using the same general retrosynthetic algorithm and reaction conditions, this platform enabled the synthesis of a wide range of polyene frameworks covering all of this natural product chemical space, and first total syntheses of the polyene natural products asnipyrone B, physarigin A, and neurosporaxanthin β-D-glucopyranoside. Collectively, these results suggest the potential for a more generalized approach for making small molecules in the laboratory.

Sensitizing the Therapeutic Efficacy of Taxol with Shikonin in Human Breast Cancer Cells

Shikonin, a small-molecule natural product which inhibits the activity of pyruvate kinase M2 (PKM2), has been studied as an anti-cancer drug candidate in human cancer models. Here, our results demonstrate that shikonin is able to sensitize human breast cancer cells to chemotherapy by paclitaxel (taxol). Human breast adenocarcinoma MBA-MD-231 cells, which have higher levels of PKM2 expression and activity compared with MCF-7 cells, were selected to study further. The concentrations of shikonin and taxol were first selected at which they did not significantly induce cytotoxicity when treated alone, whereas the combination induced apoptosis. Surprisingly, PKM2 activity was decreased by shikonin, but not by the combination treatment. To identify the potential targets of this combination, human phospho-kinase antibody array analysis was performed and results indicated that the combination treatment inhibited the activation of ERK, Akt, and p70S6 kinases, which are known to contribute to breast cancer progression. Finally, how the combination affects breast cancer cell growth in vivo was tested using a xenograft tumor model. The results indicated that shikonin plus taxol prolonged animal survival and reduced tumor size than the vehicle treatment group. In summary, our results suggest that shikonin has a potential as an adjuvant for breast cancer therapy.

Identification of novel kinase inhibitors by targeting a kinase‐related apoptotic protein–protein interaction network in HeLa cells

Protein kinases orchestrate activation of signalling cascades in response to extra- and intracellular stimuli for regulation of cell proliferation. They are directly involved in a variety of diseases, particularly cancers. Systems biology approaches have become increasingly important in understanding regulatory frameworks in cancer, and thus may facilitate future anti-cancer discoveries. Moreover, it has been suggested and confirmed that high-throughput virtual screening provides a novel, effective way to reveal small molecule protein kinase inhibitors. Accordingly, we aimed to identify kinase targets and novel kinase inhibitors. A series of bioinformatics methods, such as network construction, molecular docking and microarray analyses were performed. In this study, we computationally constructed the appropriate global human protein-protein interaction network with data from online databases, and then modified it into a kinase-related apoptotic protein-protein interaction network. Subsequently, we identified several kinases as potential drug targets according to their differential expression observed by microarray analyses. Then, we predicted relevant microRNAs, which could target the above-mentioned kinases. Ultimately, we virtually screened a number of small molecule natural products from Traditional Chinese Medicine (TCM)@Taiwan database and identified a number of compounds that are able to target polo-like kinase 1, cyclin-dependent kinase 1 and cyclin-dependent kinase 2 in HeLa cervical carcinoma cells. Taken together, all these findings might hopefully facilitate discovery of new kinase inhibitors that could be promising candidates for anti-cancer drug development.

UPLC-MS-ELSD-PDA as a powerful dereplication tool to facilitate compound identification from small-molecule natural product libraries.

The generation of natural product libraries containing column fractions, each with only a few small molecules, using a high-throughput, automated fractionation system, has made it possible to implement an improved dereplication strategy for selection and prioritization of leads in a natural product discovery program. Analysis of databased UPLC-MS-ELSD-PDA information of three leads from a biological screen employing the ependymoma cell line EphB2-EPD generated details on the possible structures of active compounds present. The procedure allows the rapid identification of known compounds and guides the isolation of unknown compounds of interest. Three previously known flavanone-type compounds, homoeriodictyol (1), hesperetin (2), and sterubin (3), were identified in a selected fraction derived from the leaves of Eriodictyon angustifolium. The lignan compound deoxypodophyllotoxin (8) was confirmed to be an active constituent in two lead fractions derived from the bark and leaves of Thuja occidentalis. In addition, two new but inactive labdane-type diterpenoids with an uncommon triol side chain were also identified as coexisting with deoxypodophyllotoxin in a lead fraction from the bark of T. occidentalis. Both diterpenoids were isolated in acetylated form, and their structures were determined as 14S,15-diacetoxy-13R-hydroxylabd-8(17)-en-19-oic acid (9) and 14R,15-diacetoxy-13S-hydroxylabd-8(17)-en-19-oic acid (10), respectively, by spectroscopic data interpretation and X-ray crystallography. This work demonstrates that a UPLC-MS-ELSD-PDA database produced during fractionation may be used as a powerful dereplication tool to facilitate compound identification from chromatographically tractable small-molecule natural product libraries.

Chemical proteomic strategies for the discovery and development of anticancer drugs

Cancer is one of the leading causes of death globally. Drug discovery and development against cancer is thus among the most pursuing goals nowadays. Although the majority of anticancer drugs targeted on proteins, the identification and validation of drug targets and their regulated pathways remain a bottleneck in the drug R&D processes. Fortunately, chemical proteomic strategies based on the perfect combination of various targeted affinity chromatography and high-throughput MS analysis have emerged as a powerful tool for the large-scale identification of proteome-wide drug-protein interactions, and demonstrated great promise in elucidating complex underlying mechanisms of drug action against cancers. In this context, an updated overview of the chemical proteomic strategies, such as activity-based protein profiling (ABPP), compound-centric chemical proteomics (CCCP), and other targeted affinity chromatographic approaches for modern anticancer drug discovery and development will be provided. Some most recent successful applications in this area will be highlighted. Future perspectives on this subject will also be discussed with a particular emphasis on small molecule natural products and their derivatives.

Euodenine A: A Small-Molecule Agonist of Human TLR4

A small-molecule natural product, euodenine A (1), was identified as an agonist of the human TLR4 receptor. Euodenine A was isolated from the leaves of Euodia asteridula (Rutaceae) found in Papua New Guinea and has an unusual U-shaped structure. It was synthesized along with a series of analogues that exhibit potent and selective agonism of the TLR4 receptor. SAR development around the cyclobutane ring resulted in a 10-fold increase in potency. The natural product demonstrated an extracellular site of action, which requires the extracellular domain of TLR4 to stimulate a NF-κB reporter response. 1 is a human-selective agonist that is CD14-independent, and it requires both TLR4 and MD-2 for full efficacy. Testing for immunomodulation in PBMC cells shows the induction of the cytokines IL-8, IL-10, TNF-α, and IL-12p40 as well as suppression of IL-5 from activated PBMCs, indicating that compounds like 1 could modulate the Th2 immune response without causing lung damage.

Abstract 3429: Coordination of cell cycle repression and reduced cytoskeletal tension by the small molecule natural product, Schweinfurthin A.

Abstract Malignant Peripheral Nerve Sheath Tumors (MPNST) are a frequent cause of morbidity and mortality in Neurofibromatosis type 1 patients, and arise in part from loss of the tumor suppressor function of the NF1 gene product, neurofibromin. We have previously shown that MPNST tumor cell lines, as well as astrocytoma cell lines, derived from both patients and a Nf1-/+;Trp53-/+ (NPcis) mouse model are differentially sensitive to the natural product, Schweinfurthin A (SA). In addition to its anti-proliferative effects, SA caused dramatic reorganization of the actin cytoskeleton. When the NF1 Ras-regulatory domain was re-expressed in an Nf1-/- astrocytoma cell line derived from the NPcis model, these cells became resistant to the effects of SA. This led us to hypothesize that SA mediates its effects on the actin cytoskeleton and proliferation by phenocopying neurofibromin in its regulation of Rho and mitogenic signaling pathways. Our objective is to understand if and how this is the case. To further that end, the goal of this study was to begin to probe the coordination of proliferation and cytoskeletal tension, as has been previously reported in other studies. We cultured individual SA- and DMSO-treated MPNST cells derived from the NPcis model onto pre-defined micropatterns of fibronectin. By constraining cell shape, quantitative structural properties of cells were revealed that were otherwise masked when cells were grown on standard coverslips. We observed dose-dependent increases in the concave curvature of cell edge segments not attached to the underlying fibronectin. Such curvature is known to represent decreased cell tension exerted by the actin cytoskeleton. Across the same SA doses, we measured a decrease in cyclin D1 and cyclin D3 total protein levels and a decrease in retinoblastoma protein phosphorylation, which was consistent with flow cytometry data showing a G1 blockade. Thus, we conclude that proliferation and cytoskeletal tension are coordinated in cells sensitive to the candidate drug, SA. Funded by NCI Contract No. HHSN261200800001E. Citation Format: Thomas Turbyville, Alla Brafman, De Chen, Kathryn Romanchuck, John Beutler, Karlyne Reilly, Stephen Lockett. Coordination of cell cycle repression and reduced cytoskeletal tension by the small molecule natural product, Schweinfurthin A. [abstract]. In: Proceedings of the 104th Annual Meeting of the American Association for Cancer Research; 2013 Apr 6-10; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2013;73(8 Suppl):Abstract nr 3429. doi:10.1158/1538-7445.AM2013-3429

Identification of dual Acetyl-CoA carboxylases 1 and 2 inhibitors by pharmacophore based virtual screening and molecular docking approach

Acetyl-CoA carboxylase (ACC) is a crucial metabolic enzyme that plays a vital role in obesity-induced type 2 diabetes and fatty acid metabolism. To identify dual inhibitors of Acetyl-CoA carboxylase1 and Acetyl-CoA carboxylase2, a pharmacophore modelling approach has been employed. The best HypoGen pharmacophore model for ACC2 inhibitors (Hypo1_ACC2) consists of one hydrogen bond acceptor, one hydrophobic aliphatic and one hydrophobic aromatic feature, whereas the best pharmacophore (Hypo1_ACC1) for ACC1 consists of one additional hydrogen-bond donor (HBD) features. The best pharmacophore hypotheses were validated by various methods such as test set, decoy set and Cat-Scramble methodology. The validated pharmacophore models were used to screen several small-molecule databases, including Specs, NCI, ChemDiv and Natural product databases to identify the potential dual ACC inhibitors. The virtual hits were then subjected to several filters such as estimated [Formula: see text] value, quantitative estimation of drug-likeness and molecular docking analysis. Finally, three novel compounds with diverse scaffolds were selected as potential starting points for the design of novel dual ACC inhibitors.

A massively spectacular view of the chemical lives of microbes.

Knowledge that microbes lead fascinating chemical lives is as old as microbiology itself. Observations in the late 19th century by Burdon-Sanderson (1) that were elaborated on by Pasteur and Joubert (2) gave rise to the idea that compounds secreted by some microbes could have remarkable effects on the lives of others. The accretion of such knowledge continued steadily through the early years of the 20th century until the quantum leap emanating from Fleming’s seminal discovery of penicillin (3). Chain and Florey’s subsequent development of penicillin as a therapeutic agent ushered in not only the golden era of antibiotics but an entire pharmaceutical industry based largely on small-molecule natural products. Since those days, the chemical lives of microbes have been studied largely through labor-intensive and time-consuming approaches that addressed one molecule at a time. Although this time-honored approach has yielded much new knowledge, the rate of discovery slowed down dramatically in recent decades. Perhaps all there was to discover about small-molecule natural products had been discovered. The advent of genomics put a halt to that idea; genomes revealed a great potential diversity of secreted microbial products waiting to be found (4). However, progress in realizing that potential has been slow (5). In PNAS, Watrous et al. offer a brand new way of viewing secreted microbial products that holds great promise in providing the next quantum leap in understanding the fascinating world of microbial chemical ecology (6).

Abstract 5292: Identification of antiangiogenic small molecule natural products targeting anthrax toxin receptor 2

Abstract Bacillus anthracis protective antigen (PA), the B-subunit of the binary anthrax toxin, binds to the cellular receptors capillary morphogenesis gene protein 2 (CMG2) and tumor endothelial marker 8 (TEM8) with high affinity. Both CMG2 and TEM8 are expressed on endothelial cells during angiogenesis. We have shown that wild-type PA inhibits both VEGF-induced and bFGF-induced angiogenesis at moderate but statistically significant levels. Structure-activity studies identified a PA mutant that exhibited markedly enhanced inhibition of angiogenesis and also inhibited tumor growth in vivo. This mutant, PASSSR, is unable to undergo normal cellular processing and thus, remains bound to the surface receptor. Further mutation of PASSSR so that it does not bind to these cell surface receptors abolished its ability to inhibit angiogenesis. We conclude that high affinity anthrax receptor ligands, such as PA and PASSSR, are angiogenesis inhibitors, and that anthrax toxin receptors are useful targets for anti-angiogenic therapy. The long-term goal of our research is to determine the extent to which antrax toxin receptor directed therapeutics can control tumor growth and metastasis. Here we show that in addition to inhibition of subcutaneous lung tumors, PASSSR can inhibit the growth of orthotopically implanted breast cancer cells and extend survival in this mouse model. We also sought to identify small molecule natural products that can inhibit the interaction with the anthrax toxin receptor CMG2 and to determine their antiangiogenic and antitumor capacity in vivo. This work was based on the hypothesis that small molecule natural products can inhibit CMG2-ECM interactions required for breast cancer angiogenesis. This work leverages the wide variety of chemical entities generated by endophytic fungi, and the ability of other fungal compounds such as fumagillin to provide interesting insights into angiogenesis inhibitors. Following a high-throughput screen of >10,000 natural product extracts, we identified 48 extracts with significant inhibitory activity, of which ∼0.5% exhibited measurable activity. Of these, 9 exhibited 1:1 binding to CMG2 with IC50 <100 ug/ml total solids. Purification and chemical and in vitro characterization resulting in the identification of six compounds with anti-CMG2 and endothelial cell inhibitory, one of which exhibits antiangiogenic activity. Thus, we have identified several small molecule natural product inhibitors of CMG2 and demonstrated that CMG2 inhibitors can inhibit angiogenesis and breast cancer growth. While none of these molecules is currently suitable as a lead for the development of a breast cancer therapeutic, we believe that these studies confirm that the approach that we have taken is suitable for the development of such a therapeutic and propose to dramatically expand the number of molecules screened for such activity. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 5292. doi:1538-7445.AM2012-5292

ChemInform Abstract: Terpene Biosynthesis: Modularity Rules

AbstractReview: about 100 refs.

Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1–P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities. The melting experiments demonstrate that P1–P4 can significantly enhance the stability of the G-quadruplex with the ordering of P1≈P4>P3>P2. Further insight into the binding mode of small molecules with the G-quadruplex by Autodock3 analysis reveals that P1–P3 prefer the end-stacking mode with the G-quadruplex through π–π interaction and P4 prefers to insert into the groove outside the G-tetrads. Thus, our research finds that four ligands (P1–P4) from small natural molecules have high affinity to, and can significantly enhance the stability of the G-quadruplex in the promoter region of the c-kit oncogene.

Amphotericin primarily kills yeast by simply binding ergosterol

Amphotericin B (AmB) is a prototypical small molecule natural product that can form ion channels in living eukaryotic cells and has remained refractory to microbial resistance despite extensive clinical utilization in the treatment of life-threatening fungal infections for more than half a century. It is now widely accepted that AmB kills yeast primarily via channel-mediated membrane permeabilization. Enabled by the iterative cross-coupling-based synthesis of a functional group deficient derivative of this natural product, we have discovered that channel formation is not required for potent fungicidal activity. Alternatively, AmB primarily kills yeast by simply binding ergosterol, a lipid that is vital for many aspects of yeast cell physiology. Membrane permeabilization via channel formation represents a second complementary mechanism that further increases drug potency and the rate of yeast killing. Collectively, these findings (i) reveal that the binding of a physiologically important microbial lipid is a powerful and clinically validated antimicrobial strategy that may be inherently refractory to resistance, (ii) illuminate a more straightforward path to an improved therapeutic index for this clinically vital but also highly toxic antifungal agent, and (iii) suggest that the capacity for AmB to form protein-like ion channels might be separable from its cytocidal effects.

Aminoacyl tRNA synthetases as targets for antibiotic development

Aminoacyl tRNA synthetases represent drug targets against which numerous small molecule natural products are available for further development into useful antibiotics. An understanding of the chemical properties, characterization of mode of action, and the elucidation of biosynthetic mechanisms for these molecules is necessary for the design of derivatives with enhanced pharmacological properties. Despite the ubiquity of small molecule natural products that inhibit tRNA synthetases, only a very small number of these compounds have been approved for clinical use. Here, we focus our discussion on tRNA synthetase inhibitor molecules of three different chemical classes, namely those derived from polyketide precursors, those that occur as phosphoramidate conjugates, and promising synthetic molecules with a mode of action that is distinct from molecules of the first two classes. Also discussed are the factors that undermine the broad-based use of some of these molecules as effective antibiotics in humans and strategies that may aid in directing the development of derivatives with improved pharmacological properties.

Selective recognition of G-quadruplex in the vascular endothelial growth factor gene with small-molecule natural products by electrospray ionization (ESI) mass spectrometry and circular dichroism (CD) spectrometry

In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to investigate selective recognition of G-quadruplex in the vascular endothelial growth factor (VEGF) gene with 12 small-molecule natural products. We found that kaempferol, a natural flavonol, shows the highest binding affinity among the 12 natural molecules. The results from ESI-MS and CD spectra indicated that kaempferol could enhance the thermal stability of the VEGF–G-quadruplex and showed selective recognition for the G-quadruplex in a solution consisting of the G-quadruplex and the corresponding duplex DNA.

Formation and recognition of G-quadruplex relevant for pilin antigenic variation in Neisseria gonorrhoeae

In this research, NMR, ESI-MS, and circular dichroism (CD) spectroscopies were used to investigate the formation and recognition of G-quadruplex by a G-rich sequence that has been demonstrated to be relevant for pilin variation in Neisseria gonorrhoeae . The NMR spectra provided strong evidence that the G-quadruplex structure was formed from this G-rich sequence, and this result was confirmed by CD spectroscopy. In addition, two small-molecule natural products (jatrorrhizine hydrochloride (J) and dehydrocorydaline (D)) were found to bind to this G-quadruplex over the corresponding duplex DNA with high selectivity by ESI-MS.

Terpene Biosynthesis: Modularity Rules

Terpenes are the largest class of small-molecule natural products on earth, and the most abundant by mass. Here, we summarize recent developments in elucidating the structure and function of the proteins involved in their biosynthesis. There are six main building blocks or modules (α, β, γ, δ, ε, and ζ) that make up the structures of these enzymes: the αα and αδ head-to-tail trans-prenyl transferases that produce trans-isoprenoid diphosphates from C(5) precursors; the ε head-to-head prenyl transferases that convert these diphosphates into the tri- and tetraterpene precursors of sterols, hopanoids, and carotenoids; the βγ di- and triterpene synthases; the ζ head-to-tail cis-prenyl transferases that produce the cis-isoprenoid diphosphates involved in bacterial cell wall biosynthesis; and finally the α, αβ, and αβγ terpene synthases that produce plant terpenes, with many of these modular enzymes having originated from ancestral α and β domain proteins. We also review progress in determining the structure and function of the two 4Fe-4S reductases involved in formation of the C(5) diphosphates in many bacteria, where again, highly modular structures are found.

Monoclonal Antibodies against Small Molecule Natural Products and Their Applications, Eastern Blotting and Knockout Extract

To determine the hapten number in hapten-carrier protein conjugate matrix-assisted laser desorption/ionization (MALDI) tof mass spectrometry was applied. Highly specific anti-ginsenoside Rb1 and Rg1 monoclonal antibodies (MAbs) were prepared. Ginsenosides were developed on thin layer chromatography (TLC) plates which were covered by a polyvinylidene difluoride (PVDF) membrane resulting in blotting. The membrane was treated with NaIO4 solution to release the aldehyde group on the sugar moiety of the ginsenosides. By treatment of the membrane with a protein solution the ginsenoside-protein conjugation as a Schiff-base occurred, which can function to fix it to the PVDF membrane. A part of the ginsenoside aglycone was reacted with anti-ginsenoside Rb1 MAb, secondary MAb conjugated with enzyme and finally a substrate was added, resulting in a specific and highly sensitive staining that we named Eastern blotting. Furthermore, it makes one-step isolation of ginsenoside Rb1 possible using an immuno-affinity column conjugated with anti-ginsenoside Rb1 MAb. Furthermore, immunoaffinity concentration was carried out allowing high sensitivity analysis of lower concentrations of ginsenoside Rb1 so that several unknown bands could be structurally determined.

Hippocampal and cortical neuronal growth mediated by the small molecule natural product clovanemagnolol

The use of small molecule surrogates of growth factors that directly or indirectly promote growth represents an attractive approach to regenerative medicine. With synthetic access to clovanemagnolol, a small molecule initially isolated from the bark of the Bigleaf Magnolia tree, we have examined the small molecule's ability to promote growth of embryonic hippocampal and cortical neurons in serum-free medium. Comparisons with magnolol, a known promoter of growth, reveals that clovanmagnolol is a potent neurotrophic agent, promoting neuronal growth at concentrations of 10 nM. In addition, both clovanemagnolol and magnolol promote growth through a biphasic dose response.