Slit Length Research Articles

Single Nucleotides Moving through Nanoslits Composed of Self-Assembled Monolayers via Equilibrium and Nonequilibrium Molecular Dynamics.

Nonequilibrium molecular dynamics (MD) simulations were used to study the effect of three chemical surface groups on the separation of DNA mononucleotide velocity (or time-of-flight) distributions as they pass through nanoslits. We used nanoslits functionalize with self-assembled monolayers (SAMs) since they have relatively smooth surfaces. The SAM molecules were terminated with either a methyl, methylformyl, or phenoxy group, and the nucleotides were driven electrophoretically with an electric field intensity of 0.1 V/nm in slits about 3 nm wide. Although these large driving forces are physically difficult to achieve experimentally, the simulations are still of great value as they provide molecular level insight into nucleotide translocation events and allow comparison of different surfaces. Nucleotides adsorbed and desorbed from the slit surface multiple times during the simulations. The required slit length for 99% accuracy in identifying the deoxynucleotide monophosphates (dNMPs), based on the separation of the distributions of time of flight, was used to compare the surfaces with shorter lengths indicating more efficient separation. The lengths were 6.5 μm for phenoxy-terminated SAMs, 270 μm for methylformyl-terminated SAMs, and 2400 μm for methyl-terminated SAMs. Our study showed that a slit with a section with methyl termination and the second section with methylformyl termination lead to a required length of 120 μm, which was significantly lower than for only a methylformyl- or methyl-terminated surface.

ADVANCED METHOD OF ANTENNA CALCULATION FOR RADIO MONITORING SYSTEMS OF ON-BOARD RADIO SOURCES

Analysis of the experience of modern armed struggle shows that timely detection of signals onboard radio sources by radio monitoring systems is an important task. One way to ensure its solution is the use of compact broadband antennas in the centimeter range. Therefore the development and improvement of methods for calculating broadband compact antennas in the centimeter wave range is an important and relevant scientific and practical task. An improved method for calculating a traveling wave antenna based on irregular symmetrical slit lines located arranged on a multilayer dielectric substrate (Vivaldi antennas) is proposed, by taking into account the thickness of the dielectric substrate, the relative effective dielectric constant of the substrate layers and two-way power supply to improve the directional properties of the antenna and its coordination in a given frequency band. In particular, the formulas of the phase multiplier of the system (for two radiating elements) and the resulting pattern of the antenna take into account the two-way power supply and the thickness and relative dielectric constant of the substrate. These advanced formulas for calculating and selecting these options antennas, lengths; maximum and minimum slot width; the coefficient of opening the gap; the width of the strip of symmetrical microstrip power line at the connection of the coaxial power line; the width of the strip at the intersection with the slit line; the width of the symmetrical slit line at the base of the opening; the length of a quarter-wave transformer based on a symmetrical microstrip line; the length of the symmetric microstrip power line; slit length; resonator diameter; the radius of the cover of the structural capacitor. The practical significance of the results obtained lies in the possibility of an approximate calculation of compact broadband antennas in the centimeter wavelength range. The results make it possible to model and manufacture these antennas for radio monitoring systems for onboard radio sources.

Central Slice Theorem-based Relationship between 1D-NPS Obtained by the Slit Method and 2D-NPS for CT Images

The method using a numerical slit (slit method) is used commonly to obtain the one-dimensional (1D) noise power spectrum (NPS) in computed tomography. However, the relationship between the 1D-NPS obtained by the slit method and the original two-dimensional (2D) NPS derived by the 2D Fourier transformation has not been elucidated clearly. The purpose of this study was to clarify their relationship based on the well-known central slice theorem (projection slice theorem) and validate it using computer simulation analysis. With the application of the central slice theorem, we described that the 1D-NPS obtained by the slit method was equal to the central slice (profile) in the 2D-NPS when we set the slit length to the maximum (i.e. the matrix size of the noise image). To verify this, we generated computer-simulated noise images with the known 2D-NPS (true 2D-NPS). From those images, we obtained the 1D-NPS that was obtained by the slit method and compared it with the central slice in the true 2D-NPS. When we set the slit length to the maximum, the 1D-NPS obtained by the slit method showed good agreement with the central slice in the true 2D-NPS. We clarified the relationship between the 1D-NPS obtained by the slit method and the 2D-NPS using a theoretical approach and the computer simulation. We had to maximize the slit length to achieve the accurate measurement of the 1D-NPS using the slit method.

Central Slit Tearing Behaviour of Thermoplastic Polyurethane-Coated High-Strength Fabrics

This research study reports the central slit tearing behaviour of three different varieties of industrial-grade high-strength fabrics, namely (a) Kevlar, (b) Nylon 6, 6, and (c) Polyester, all of these with a special thermoplastic polyurethane (TPU) coating. Tear resistance was evaluated and the tear behaviour was analyzed based on the critical load required for tear initiation and the energy required for tear propagation, by changing slit length and slit orientation. The study revealed that the coated Kevlar fabric has the highest specific tear energy among all the fabric materials, but the Polyester fabric displayed highest tear load and tear energy. This research work also showed that there are three major factors that determine the tear performance of envelope material, namely the yarn tenacity, yarn count, and yarn weaving density/yarn spacing, so the index based on the three factors was proposed for explaining the tearing behaviour. The materials for coating were selected for assessing the performance for inflatable application, so the degree of anisotropy was calculated for the tearing parameters; load, energy, and specific energy for all the coated fabrics. The breaking strengths of three varieties of basic and coated fabrics were evaluated for assessment of the influence of TPU coating.

First report of cyst nematode (Heterodera elachista) on Zea mays in Gansu Province, China.

The cyst nematodes are important plant-parasitic nematodes and make detrimental economic impacts worldwide. Heterodera elachista attacks rice in Japan (Ohshima 1974), Iran (Tanha et al. 2004) and China (Ding et al. 2012) and also attacks corn in Italy (De Luca et al. 2013) and northeast China (Xiao et al. 2019). Considering this nematode can infect these two most important crops with high reproduction rates, special attention should be paid to avoid its spread to new areas by soil, water, and agricultural practices. A survey for cyst nematodes was performed in fields of corn seed for propagation in September 2018 in Zhangye City, Gansu Province, which is the biggest corn seed production base in China. One hundred seventy four samples were collected by the zig-zag method in about 25 ha corn fields. Each soil sample containing approximately 1 kg soil in total was from the mixture of 20 cores (20 cm in depth and 0.2 cm in diameter). Cysts were detected in 6 out of 174 samples using the sieving-decanting method (Byrd et al. 1983). The six samples from ~ 1.2 ha corn fields in which plants displayed symptoms of dwarf, yellow leaves and earlier wilting had an average of 14 ± 2.8 cysts per 100 g soil. The cysts (n = 30) were dark brown, spherical to lemon shape, protruding, tapered vulva with ambifenestrae separated by a vulva slit, obvious and medium-sized underbridge, few dark-brown vesicles and clear swollen protrusion around underbridge and cyst cuticle with a zigzag pattern. Morphological measurements of the cysts included body length (excluding neck) (range =359.4 to 498.6 μm, mean = 429.5 ± SD 39.3 μm), vulva slit length (34.3 to 42.8, 37.9 ± 2.5), fenestral length (31.2 to 43.8, 38.0 ± 4.4) and width (26.1 to 31.4, 29.3 ± 1.6), underbridge length (74.7 to 82.9, 78.3 ± 2.8). J2 (n = 20) had the following measurements: body length (386.6 to 454.9, 425.3 ± 21.8), stylet length (17.1 to 22.2, 19.2 ± 1.6), stylet knob width (3.4 to 4.3, 3.9 ± 0.3), tail length (50.5 to 60.5, 55.5 ± 3.3) and hyaline tail length (25.0 to 34.6, 29.1 ± 3.1). The morphological characteristics are consistent with the Italian population of H. elachista through the comparison of the measurements. DNA was extracted from a single cyst randomly chosen (n = 5) using the protocol described by Subbotin et al. (2001). The ITS-rDNA and D2/D3 fragments of the 28S rRNA were respectively amplified with universal primers pairs TW81 and AB28 (Subbotin et al. 2001) and D2A and D3B (Castillo et al. 2003), and sequenced (Tsingke Biological Technology, Beijing, China). The consensus ITS sequence (GenBank Accession No. MN699476, 1037 bp) had 98.37 to 99.60% similarity with the H. elachista from corn in Italy (KC618469) and in China (MH712504), and from rice in China (HM560778) and in Iran (AF498391). The D2/D3 sequence (GenBank Accession No. MN699477, 746 bp) exhibited 99.60 to 99.73% similarity with that of H. elachista from rice in China (JN202922, HM560842), and from corn in Italy (KC618462). This nematode population was identified as H. elachista according to the morphological and molecular features. Twenty-day-old corn seedling (cv. Tiannuo) was inoculated with 3000 J2 and eggs in a pot filled with sterile soil. Eight plants were inoculated and two uninoculated plants were used as controls. J2 were found in the stained roots at 10 d after inoculation and J4 were detected at 30 d. These inoculated plants exhibited yellowing and dwarfing similar to the symptoms observed initially in the field, and the control grew normally. After 60 d, the average of 28 cysts were detected from each inoculated plant. This is the first report of H. elachista in Gansu Province, northwest China.

First record of Heterodera elachista infecting rice in Henan Province of central China.

From June 2018 to November 2019, a survey for cyst-forming nematodes was conducted in rice fields in Henan Province of central China. Cysts were recovered from two rice fields (N32° 14' 048″8 and E115° 4' 008″) at Huangchuan County, leading to more intensive sampling. A further 25 soil samples were then collected with a valve bag from each of these two locations. Cysts and second-stage juveniles (J2) were recovered from roots and soil following Cobb's gravity sieving method. Live cysts were detected in all soil samples with a mean of 6.7±1.5 cysts per 100 ml of soil. Morphologically, the cysts were spherical to lemon-shaped, light to dark brown in color with subcrystalline layer. The vulval cone was well developed, cone terminus with a few large, peripheral, dark brown bullae lacking finger-like projections, and the ambifenestrae were almost rounded with two semifenestrae; width and length of the semifenestrae were similar. The vulval bridge was narrow, with a medium sized underbridge. Cyst measurements (n = 8) determined a mean body length of 431.1 ± 47.23 (351.0 - 516.0) µm, body width 304.3 ± 47.40 (240.0 - 381.0) µm; body length to width ratio 1.42 ± 0.10 (1.2 to 1.6); fenestrae length 39.4 ± 7.06 (26.0 - 47.0) µm; fenestrae width 36.5 ± 5.96 (25.0 - 43.0) µm; vulva slit length 37.1 ± 3.62 (30.0 - 42.0) µm; and the mean underbridge length 75.0 ± 3.39 (70.0 - 81.0) µm. Morphometric J2 measurements (n = 10) included a body length of 432.3 ± 53.26 (379.0 - 512.0) µm; stylet length 20.8 ± 1.87 (18.0 - 24) µm with rounded knobs; tail length 63.1 ± 7.92 (52.0 - 75.0) µm with a hyaline terminal tail length of 35.8 ± 6.14 (28.0 - 45.0) µm. The key morphometrics of this isolate were intermediate to those of the Japanese isolates (Nobbs et al. 1992.) and Chinese isolates (Ding et al. 2012), and other morphological character values were within the range of those reported for Heterodera elachista (Nobbs et al. 1992; Tanha Maafi et al. 2003). Amplification of DNA from single cysts (n = 7) was conducted using the protocol described by Ding et al. (2012). rDNA - ITS sequences were amplified with the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR product was purified and sequenced. The ITS sequences were submitted to GenBank under accession numbers MT579616. Comparisons showed a sequence identity of more than 99.9% for H. elachista sequence MN720080 from Korea and 99.5% for H. elachista sequences JN864884 and JN202916 from China. Species identification was also confirmed using sequence characterized amplified region (SCAR) methods with H. elachista-specific primers He-F/He-R (Qi, 2012). An expected PCR fragment of approximately 434 bp was obtained, which was consistent with those previously reported for H. elachista. Pathogenicity was confirmed by infection and reproduction on rice (Oryza sativa cv. 'Nipponbare'). Seeds were sown into three tubes containing 150 ml of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 185 eggs/cyst) and cultivated in an artificial climate box at 25/30°C, under a 12-h dark/12-h light cycle. Three other tubes without cysts were set as control. Two weeks after sowing, stunting and reduction of leaf length were observed and third- and fourth-stage juveniles were observed in roots stained with acid fuchsin. On average, 142 cysts per 150 ml soil were recovered at 5 weeks after sowing. The newly formed cysts corresponded morphologically and molecularly to the cysts from the original soil samples. The globally recognized and economically important rice-damaging cyst nematodes include H. oryzae, H. oryzicola, H. elachista, H. sacchari and H. graminophila (Zhuo et al. 2014). Ohshima (1974) first reported H. elachista, which was originally recorded as H. oryzae in Japan by Luc and Brizuela (1961). H. elachista was then detected from a rice field at Mazandaran Province in Iran (Tanha Maafi et al., 2003), and in upland rice fields in Hunan (Ding et al., 2012) and Guangxi, China (Zhuo et al. 2014). To the best of our knowledge, this is the first report of H. elachista as a pathogen on rice in Henan Province, in central China. According to our field observations, H. elachista was much more serious in direct-seeded rice field than in the transplanted rice fields. H. elachista was also reported attacking corn (Xiao et al., 2019). Henan is the most important corn-producing province in China, thus H. elachista is a potential threat to corn production in Henan. Our findings will be very beneficial for H. elachista management and further research on direct-seeded rice and corn in Henan Province, central China.

First report of Meloidogyne graminicola on rice in Anhui province, China.

Meloidogyne graminicola, a devastating plant pathogen of rice (Oryza sativa), is considered to a severe constraint to productivity in rice-growing areas (Zhan et al., 2018). In April 2020, irrigated paddy rice field in Qianshan City, Anhui Province, China, showed symptoms with stunting, thinning, chlorosis, and typical hook-shaped root tips. Females and egg masses of Meloidogyne sp. were found inside the cortex of the root galls, males were found in soil and roots. The morphological characteristics of females, males and second-stage juveniles (J2) were identified as described previously (Tian et al., 2017; Wang et al., 2017). The perineal pattern of the females (n=12) was dorsoventrally oval with low and round dorsal arches, with lateral fields obscure or absent. Most of the striae were smooth, and occasionally broken by short and irregular striae. Morphological measurements (mean±sd, range) of female nematodes (n=20) were body length (543.0±66.0 µm, 448.0-629.0 µm), stylet (11.6±1.9 µm, 7.9-14.2 µm), dorsal pharyngeal gland orifice to stylet base (DGO) (4.0±0.4 µm, 3.4-4.7 µm), vulval slit length (24.1±4.9 µm, 14.8-32.8 µm), vulval slit to anus distance (16.1±3.0 µm, 8.4-20.2 µm). The male nematodes were cylindroid, vermiform, and rounded tail, with the measurements (n=20) body length (1673.0±125 µm, 1346.0-1822.0 µm), stylet (15.5±0.8 µm, 14.0-17.1 µm), DGO (3.7±0.5 µm, 2.9-5.5 µm), and spicule (30.7±2.5 µm, 23.4-34.6 µm). The J2 were vermiform with a gradually tapering hyalines, its measurements (n=20) were body length (452.0±33.0 µm, 391.0-511.0 µm), stylet (13.4±0.8 µm, 12.0-15.2 µm), DGO (3.6±0.6 µm, 2.5-4.7 µm), tail length (72.1±5.2 µm, 59.8-84.8 µm) and hyaline tail terminus (21.7±2.5 µm, 18.0-29.7 µm). DNA extracted from individual females (n=10) were used for molecular identification. The D2/D3 region of 28S RNA was amplified with D2A (5'-ACA AGT ACC GTG AGG GAA AGT TG-3') and D3B (5'-TCG GAA GGA ACC AGC TAC TA-3') (De Ley et al. 1999). The ITS region was amplified with AB28 (5'-ATA TGC TTA AGT TCA GCG GGT-3') and TW81 (5'-GTT TCC GTA GGT GAA CCT GC-3') (Curran et al. 1994). The fragments of D2/D3 region (GenBank accession No. MT576694) and ITS region (GenBank accession No. MT573412) were 766 bp and 579 bp respectively, they all exhibited 99%-100% similarity with those of M. graminicola isolates available in the GenBank. Therefore, both morphological and molecular characterization confirmed the status of this nematode as Meloidogyne graminicola. In green house test, twenty 2-week-old rice seedlings (cv. Longliangyou) were individually maintained in pots with sterilized sand and soil (3:1) and inoculated with 300 J2, other ten non-inoculated rice seedlings as negative control. Rice seedlings were grown in green house at 28℃/25℃ with a 16 h/8 h light/dark photoperiod. After 30 days, all inoculated rice seedling showed symptoms with stunting, chlorosis, and typical hook-shaped root tips, which were similar with that in fields. The nematode reproduction index (final population density/initial population density) were 7.86-10.32. No symptoms were observed on non-inoculated rice seedlings. These results confirmed the pathogenicity of M. graminicola on rice. To our knowledge, this is the first report of M. graminicola in Anhui Province, China. References Curran, J., et al. 1994. Mycol. Res. 98:547. https://doi.org/10.1016/S0953-7562(09)80478-4. De Ley, P., et al. 1999. Nematology. 1:591. https://doi.org/10.1163/156854199508559. Tian, Z., et al. 2017. Plant Disease. http://dx.doi.org/10.1094/PDIS-06-17-0832-PDN. Wang, G., et al. 2017. Plant Disease. http://dx.doi.org/10.1094/PDIS-12-16-1805-PDN. Zhan, L., et al. 2018. BMC Plant Biol. 18:50. https://doi.org/10.1186/s12870-018-1266-9.

First Report of Meloidogyne enterolobii on Industrial Hemp (Cannabis sativa) in China.

Industrial hemp (Cannabis sativa L.) is an important annual herbaceous plant that has great economic value. In March 2020, many small to large galls were observed on the roots of industrial hemp plants growing in a field in Tianya District, Sanya City, Hainan Province, China. The diseased plants did not show obvious aboveground symptoms. Females were obtained by dissecting the galls under a stereomicroscope. Second-stage juveniles (J2s) were collected for 24-48 h from egg masses hatching at 25°C. The morphological characteristics of females and J2s were observed and measured with a Nikon E200 microscope at 100× and 400× magnification. The perineal patterns of females were oval, with coarse and smooth striae, moderately high to high dorsal arches, and lacking distinct lateral lines. Measurements of females (n = 20) included vulval slit length = 26.4 ± 2.7 (23.6 to 31.2) µm, vulval slit to anus distance = 22.1 ± 2.4 (18.9 to 24.7) µm. The J2s had long and narrow tails with bluntly rounded tail tips and distinct hyaline tail termini. Measurements of J2s (n = 20) were body length = 432.4 ± 23.1 (386.8 to 465.3) µm, body width = 16.2 ± 1.8 (14.2 to 18.9) µm, stylet = 12.8 ± 0.5 (11.6 to 13.7) µm, dorsal esophageal gland orifice to stylet base = 3.6 ± 0.4 (3.1 to 4.8) µm, tail = 52.9 ± 3.8 (46.3 to 61.4) µm, hyaline tail length = 15.7 ± 2.6 (12.5 to 19.2) µm. These morphological characteristics were consistent with the original description of M. enterolobii (Yang and Eisenback 1983). Molecular biology analyses were also conducted to confirm species identification. Genomic DNA was extracted from a single J2 (Song et al. 2017). The ITS rRNA gene and D2-D3 region of the 28S rRNA gene were amplified using the primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The ITS rRNA gene sequence (765 bp, GenBank accession No. MT654126) was 100% identical to M. enterolobii sequences previously obtained from Fujian, China (MT406251) and Vietnam (MG773551), and the D2/D3 region sequence of 28S rRNA gene (759 bp, MT654127) revealed 99% identity with M. enterolobii sequences from Fujian (MT193450) and Taiwan (KP411230), China, and South Carolina, USA (MH800969). In addition, species identification was further confirmed using the M. enterolobii-specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) and MK7-F/MK7-R (GATCAGAGGCGGGCGCATTGCGA/CGAACTCGCTCGAACTCGAC), respectively (Long et al. 2006; Tigano et al. 2010). The PCR products had the expected fragment lengths of 236 bp and 520 bp, which were consistent with those previously reported for M. enterolobii (Long et al. 2006; Tigano et al. 2010). The pathogenicity test of this nematode was performed in a greenhouse at 25°C. Ten industrial hemp seedlings (cv. Longma No. 5 ) maintained in 12-cm diameter and 12-cm high pots containing autoclaved soil, were inoculated with 800 freshly hatched J2s of the original population of M. enterolobii per plant, and 8 non-inoculated seedlings were used as controls. At 60 d after inoculation, all inoculated plants exhibited gall symptoms on the roots similar to those in the field, and the nematode reproduction factor (final population density/initial population density) was 18.2. No symptoms were observed on control plants. These results confirmed the pathogenicity of M. enterolobii on industrial hemp. To our knowledge, this is the first report of industrial hemp as a new host of M. enterolobii in China. As M. enterolobii has a broad host range, a strong pathogenicity, and a high reproduction rate, it could become a major threat to industrial hemp production. Further monitoring and research on effective control strategies are needed.

A novel detonation arrester containing a large disk with long triangular slits: Design and numerical simulation

AbstractAiming at the problem that common flame arresters can only extinguish deflagration flame, but cannot effectively extinguish detonation flame in large pipelines, this paper proposes a novel structure of detonation arrester based on heat transfer theory to improve the detonation flame extinguishing efficiency. The flame arresting element is composed of a large disk with long triangular slits and is used as the quenching part of detonation arrester in a monolithic structure. Compared with common flame arrester consists of several small fires retarding elements, the proposed monolithic structure is safer due to its integrity. In addition, this paper explores the relationship between flame extinguishing ability, detonation pressure, and temperature change. This investigation determined that the diameter of the quenching part and the parameters(length and height) of the long triangular slits were the key factors affecting the quenching characteristics, and as the diameter and porosity increase, the detonation pressure at the front of the flame arrester will decrease. Finally, the rationality and applicability of the structure are verified by simulation experiments. These preliminary conclusions are helpful to reveal the nature of the proposed structure and solve the technical problem of preventing detonation flame propagation of coal mine gas in large pipelines.

Determination of Yield Surfaces in Accordance With ISO 16842 Using an Optimized Cruciform Test Specimen

Background: For the standard ISO 16842 cruciform test specimen, stresses obtained from the gauge area are far below the ultimate tensile strength due to high stress concentrations at the slit ends which lead to premature failure. Objective: To introduce a new cruciform specimen design which has been optimized with respect to the determination of yield surfaces. Methods: The proposed design differs from the ISO standard by an additional thinning of the gauge area and wider slits in the arms to avoid stress singularities. Compared to other cruciform test piece designs found in the literature, the stress distribution is still homogeneous and there is no need to reduce the size of the gauge area, thanks to the specimen’s well-balanced proportions. Results: Biaxial tensile tests have been conducted with aluminium 5754 alloy samples of different thicknesses. For the standard cruciform test piece, the maximum strain achieved at the gauge area is only 25% of the fracture strain. The optimized cruciform test piece can attain about 66% of the fracture strain before breaking. Conclusions: The optimized specimen design enables the measurement of yield surfaces at higher stress levels. In case of other materials such as elastomers, the slit length has be to adjusted accordingly.

First Report of Heterodera zeae on Maize (Zea mays) in Henan Province, China

First Report of <i>Heterodera zeae</i> on Maize (<i>Zea mays</i>) in Henan Province, China

Investigation on influence of time on tear behaviour of airship envelope

An experimental investigation on tearing behaviour of a coated fabric used in aerostat/airship has been undertaken. The tear tests have been conducted on bi-axial set up and pressurised cylinder. Tear propagation was studied by inducing dynamic tear on a bi-axially stressed coated fabric through a falling dagger. The influence of traverse rates, 1–500 mm/min, on tear strength under uniaxial loading was also studied. Thiele’s empirical equation has been found to fit the data of bi-axial tests and cylinder tests. The instantaneous tear on a bi-axially stressed fabric when left under constant stress for some duration lead to failure of fabric at even 15% lesser than critical tear slit length in about 15 min. The tear strength of the coated fabric was found to be less at 1 mm/min traverse rate while remaining nearly constant for higher rates of traverse. The critical tear length not only depends upon inherent tear strength of material, diameter and pressure of envelope but also on the time for which the tear remains under creep.

Design of a compact hyperspectral imaging spectrometer with a freeform surface based on anastigmatism.

Hyperspectral imaging spectrometers with a wide field of view (FoV) have significant application values. However, enhancing the FoV will increase the volume of the imaging spectrometer and reduce the imaging quality, so a wide-FoV spectrometer system is difficult to design. Based on the theory of off-axis astigmatism, we present a method that includes a "prism box," "partial anastigmatism," and a partial differential equation to solve the parameters of a freeform surface. In this method, a compact wide-FoV imaging spectrometer with a freeform surface is designed. The spectrometer is an Offner structure with two curved prisms as the dispersion elements. The primary mirror and tertiary mirror of the Offner spectrometer are an aspheric surface and a freeform surface, respectively, to correct the off-axis aberration of a wide FoV. The ratio of the slit length to the total length of the spectrometer is close to 0.4. In comparison to conventional spectrometers of the same specifications, the total length of the spectrometer is reduced by 40% and the volume by 70%. The compact imaging spectrometer has potential application in the field of space remote sensing. In addition, the design method of the spectrometer provides a reference for the design of other optical systems with freeform surfaces.

An Internal Coupled-Feed UHF RFID Tag Antenna with CP and Metal-Mountable Advantage

An internal coupled-feed microstrip RFID tag antenna for UHF band is presented in this article. To achieve a compact size, the orthogonal cross-slot is etched on the radiation patch, reducing antenna size and providing feeding space for L-shaped feedline. In order to meet the metal-mountable advantage and the low-profile size requirement, the ends of L-shaped feedline are connected with ground through metal-via. By optimizing the size of L-shaped feedline, the expected input impedance of the proposed tag antenna can be obtained easily. Moreover, the target band of circular polarization (CP) can be covered by optimizing the length of slits, which is embedded in the four corners of the radiation patch. The measured 3-dB Power Reflection Coefficient (PRC) bandwidth of the proposed tag antenna is 98 MHz (from 840 to 938 MHz), and its 3-dB axial-ratio (AR) bandwidth is 7 MHz (from 920 to 927 MHz). Further test results demonstrate that the tag antenna can provide better gain and reading range when mounted on a metal plate.

Application of back-propagation neural networks to defect characterization using eddy current testing

Eddy current testing is widely used for the automatic detection of defects in conductive materials. However, this method is strongly affected by probe scanning conditions and requires signal analysis to be carried out by experienced inspectors. In this study, back-propagation neural networks were used to predict the depth and length of unknown slits by analyzing eddy current signals in the presence of noise caused by probe lift-off and tilting. The constructed neural networks were shown to predict the depth and length of defects with relative errors of 4.6% and 6.2%, respectively.

Heat transfer enhancement of wavy fin-and-tube heat exchangers via innovative compound designs

The present study examines some novel improvements in association with the airside performance of wavy fin-and-tube heat exchangers. Effects of waffle height, adding slits on wavy fins and vortex generators on the thermal resistance of wavy fin-and-tube heat exchangers are investigated. Increasing waffle height, imposing slits on the wavy fin, or adding vortex generators can provide 6–10% reduction in thermal resistance subject to constraints of the same pumping power. Yet, the compound design including all these three features together is even more powerful to achieve a 16% reduction of thermal resistance. Increasing waffle height will decrease thermal resistance, but the accompanied pressure drop is even higher. Hence, it is highly recommended that the waffle height should be less than the fin pitch or at a corrugation angle being less than 15°. Punching slits on the top of wavy fin surface can result in 6–7% decrease in thermal resistance. Effect of increasing the width of slits on heat transfer characteristics is negligible. Conversely, increasing the length of slits is much more effective. It can be seen from the results that slits with a length of 12 mm and a width of 1 mm yield 8–10% reduction in thermal resistance.

SDSS-IV MaNGA: Bar pattern speed estimates with the Tremaine-Weinberg method and their error sources

Abstract Estimating the bar pattern speed (Ωbar) is one of the main challenges faced in understanding the role of stellar bars in galaxy dynamical evolution. This work aims to characterise different uncertainty sources affecting the Tremaine Weinberg (TW)-method to study the correlation between bar and galaxies physical parameters. We use a sample of 15 MaNGA SDSS-IV galaxies and 3 CALIFA galaxies from Aguerri et al. (2015). We studied the errors related with (i) galaxy centre determination, (ii) disc position angle (PA) emphasising the difficulties triggered by outer non-axisymmetric structures besides the bar, (iii) the slits length and (iv) the spatial resolution. In average, the PA uncertainties range $\sim 15 \%$, the slit length $\sim 9 \%$ and the centring error $\sim 5 \%$. Reducing the spatial resolution increases the sensitivity to the PA error. Through Monte Carlo simulations, we estimate the probability distribution of the $\mathcal {R}$ bar speed parameter. The present sample is composed of 7 slow, 4 fast and 7 ultrafast bars, with no trend with morphological types. Although uncertainties and low sample numbers may mask potential correlations between physical properties, we present a discussion of them: We observe an anti-correlation of Ωbar with the bar length and the stellar mass, suggesting that massive galaxies tend to host longer and slower bars. We also observe a correlation of the molecular gas fraction with $\mathcal {R}$, and a weak anti-correlation with Ωbar, suggesting that bars rotate slower in gaseous discs. Confirmation of such trends awaits future studies.

Numerical investigation supersonic jet near field with a longitudinal slit cutout on the expiration channel

The effects of a slit cutout length on the parameters of a supersonic flow are studied. The flow in the nozzle with a Mach number M = 2 was simulated numerically. The jet from the nozzle passed through the 30 cm long tube and then exhausted into quiescent air. Two symmetrical longitudinal slits were cut at the end of the tube. Three cases with 3, 6, and 9 cm cutouts were considered. The slit width was fixed at 1 cm for all cases. The study showed that an increase in the cutouts length leads to a slight increase in the mixing zone width at the jet boundary. However, the mixing intensity gradient was decreased. This flow case is somewhat similar to the chevrons used in some practical applications. So the cutouts can be used to reduce the intensity of the acoustic noise in the far field.

The Nuclear Source of the Galactic Wind in NGC 253

Abstract We present Brγ emission line kinematics of the nuclear region of NGC 253, recently known to host a strong galactic wind that limits the global star formation of the galaxy. We obtained high-resolution long-slit spectroscopic data with PHOENIX at Gemini South, positioning the slit on the nucleus infrared core (IRC), close to the nuclear disk major axis. The spatial resolution was 0.″35 (∼6 pc) and the slit length was 14″ (∼240 pc). The spectral resolution was ∼74,000, unprecedentedly high for galactic nuclei observations at ∼2.1 μm. The line profiles appear highly complex, with blue asymmetry up to 3.″5 away of the IRC, and red asymmetries further away to northeast. Several Gaussian components are necessary to fit the profile, nevertheless a narrow and a wide one predominate. The IRC presents kinematic widths above 700 km s−1 (FWZI), and broad component FWHM ∼ 400 km s−1, the highest detected in a nearby galaxy. At the IRC, the blueshifted broad component displays a 90 km s−1 bump in radial velocity distribution, a feature we previously detected in molecular gas kinematics. The narrow component velocity dispersion (∼32 km s−1) is within the expected for normal galaxies and luminous infrared galaxies (LIRGs). Intermediate components (FWHM ∼ 150 km s−1, redshifted to the northeast, blueshifted to the southwest) appear at some positions, as well as weaker blue (−215 km s−1) and red line wings (+300 km s−1). The IRC depicts a large broad-versus-narrow line flux ratio (F(B)/F(N) ∼ 1.35), and the broad component seems only comparable with those observed at very high star-forming rate galaxies. The results indicate that the IRC would be the main source of the galactic winds originated in the central region of NGC 253.

Optimization of single-photon emission computed tomography system for fast verification of spent fuel assembly: a Monte Carlo study

The International Atomic Energy Agency (IAEA) assessed that single-photon emission computed tomography (SPECT) technique is one of the most attractive technique for safeguards of a spent fuel because of its intuitive evaluation capability by using a tomographic image. Even though there are over a hundred kinds of the verification technique, the IAEA suggested the need for “more sensitive and less intrusive alternatives to existing nondestructive assay instruments” for partial-defect detection. The aim of this study is to optimize a SPECT system using Monte Carlo method for faster verification of spent fuel assembly than the conventional system. An optimization study of detector geometry was performed using GATE simulation program. The detector head consists of one-dimensional (1D) multi-slit tungsten collimator, Bismuth Germanate (BGO) scintillator, and silicon photomultiplier (SiPM) arrays. The collimator slit width and length, and scintillator length were optimally determined by evaluating the quality of 1D projection image for Cs-137 line source. The type of photoelectric sensor was determined by assessing the light transfer efficiency of the scintillator using DETECT2000 program. For the performance evaluation of the optimized detector, a tomographic image of twelve fuel sources in the assembly was compared with that acquired using the conventional detector developed by IAEA . The optimized scintillator length, collimator slit width, length, and septal thickness were 4 cm, 0.2 cm, 5 cm, and 0.2 cm, respectively. The light transfer efficiency in the scintillator to the 3×70 mm3 and 3×3 mm2 sensors were 23.4± 0.6% and 5.3± 0.3%, respectively. In the results of the image quality assessment, the optimized detector head shows about 1.5 times improved sensitivity, while the image quality is slightly poorer than the conventional one due to the bigger slit width. Nevertheless, by considering a deep-learning-based image-reconstruction-algorithm, we chose the bigger slit width because higher image intensity gives an advantage in discrimination between the fuel sources and the background noise. We expect that the combination of the detector head with higher sensitivity and the deep-learning-based image-reconstruction-algorithm will contribute to the faster verification of spent fuel assemblies compared to the conventional system.