Lesional Skin Biopsies Research Articles

A Tale of a Patient with Two Autoimmune Disorders

Purpose: Wegener's granulomatosis (WG) is a rare clinical disorder affecting individuals with an underlying genetic susceptibility. The incidence of concurrent WG and Crohn's Disease (CD) is unknown. The diagnosis of both autoimmune disorders is challenging and requires a high level of suspicion. We describe a patient with a known history of CD presenting with persistent fevers, bloody diarrhea, and diffuse arthralgias despite treatment for a CD flare. The patient was ultimately diagnosed with WG based on positive serine protease 3 antibody (PR3). Case: A 36-year-old Pacific Islander male with a known history of diffuse CD presented with bloody diarrhea, skin blisters, fevers, and diffuse arthralgias. The patient was admitted to the medical service for treatment for a CD flare with IV steroids, mesalamine, and antibiotics. Comprehensive infectious disease evaluation was negative for bacterial, fungal and viral infections. Subsequently, the patient was transferred to the MICU for hypotension, persistent fevers up to 104.7, and tachycardia (HR=140's). An echo showed RV enlargement consistent with pulmonary hypertension. A CT scan of the abdomen and pelvis showed bilateral pulmonary nodules consistent with granulomatous disease and hypodensities in the splenic parenchyma concerning for splenic infarcts. Sarcoidosis was excluded by negative serum ACE; in addition, patient age and gender did not support this diagnosis. Colonoscopy with TI intubation showed erythema and friability from sigmoid to cecum consistent with CD. Biopsies showed active colitis and negative for AFB and CMV. Skin lesion biopsies were negative for infectious markers and positive for neutrophilic infiltrates. Significant lab findings included a marked PR3 positivity at 171 (cutoff for normal 19), highly specific for WG. The patient was started on treatment for WG including high-dose IV solumedrol and rituximab infusion with significant clinical improvement within 24 hours. He was ultimately discharged on prednisone taper and scheduled rituximab infusions. At his two-week follow-up clinic visit, the patient was doing well with complete resolution of his arthralgias, no further fevers and formed, non-bloody stools. We speculate that his CD flare may have been triggered by the onset of WG. Focused treatment for his WG also resulted in improvement in his CD flare. CD and WG are both autoimmune disorders with genetic susceptibilities that may overlap and may be triggered by infectious and environmental factors. The underlying mechanisms of WG and CD remain elusive. Future studies may help identify genes that overlap in both WG and CD but also provide ability to distinguish between these two autoimmune disorders.

Cutaneous melanoma arising from a cesarean delivery skin scar

A 41-year-old pregnant African-American woman noticed rapid growth of her cesarean delivery skin scar beginning at 14-week gestation. Skin biopsy, which was performed at 31 weeks, revealed poorly differentiated cutaneous melanoma. At 34 weeks, she underwent repeat cesarean delivery with tumor excision, pelvic lymphadenectomy and abdominal wall reconstruction. Locally advanced disease and anatomical limitations prevented attainment of negative surgical margins. Despite adjuvant chemotherapy and radiation, she died 1 year after diagnosis. Deferring biopsy of a suspicious skin lesion during pregnancy may have delayed the diagnosis of melanoma in this case and possibly affected the long-term outcome.

Paraneoplastic disseminated lentigines heralding aggressive Langerhans cell sarcoma

Dear Editor, A 21-year-old man presented with a rapidly growing (9 cm), non-tender right flank mass with superficial excoriation and inflammation (Fig. 1a). The lesion was accompanied by rapid onset of disseminated brown papules, involving the torso, back, and limbs (Fig. 1b). Facial and axillary skins were spared, and there was no particular direction of spread. The skin patches did not coalesce or show pruritus or inflammation. There was also weight loss of 15 lb in 3 months. A positron emission tomogram scan (PET) showed FDG uptake in the right waist (SUV 5.8) and right groin (SUV 2.1) (Fig. 1c). Wide margin resection of the mass and lymph node excision was performed with clear margins. Histology of both specimens showed sheets and loose clusters of pleomorphic malignant cells infiltrating the dermis and subcutis with frequent mitosis (Fig. 1d). In view of the anaplastic morphology and unusual presentation, extensive immunophenotyping was performed. The cells were positive for CD1a, S100, and Langerin stains. They were negative for melanocytic markers (HMB45, melan-A, MITF) EMA, cytokeratin (CK, Cam 5.2, 34betaE12), actin, desmin, CD31, CD34, c-kit, B and T markers (CD20, CD79a, CD3), CD68, CD30, CD56, CD21, MPO, and ALK1. Electron microscopy for Birbeck granules was not performed. The picture was compatible with Langerhans cell sarcoma (LCS). A separate skin biopsy of a pigmented lesion on the torso showed elongated rete ridges with increased basal melanin pigmentation within keratinocytes and the tips, with no increased Langerhans cells and no evidence of malignancy or dysplasia. The lesion was compatible with common lentigo. The patient was treated with consolidation radiotherapy to the primary sites, but there was no regression of the skin lentiges. Fig. 1 a Clinical photo showing the flank mass with impending ulceration. b Widespread lentiginous lesion all over the trunk heralding the rapid growth of the malignant lesion. c PET with maximum intensity projection showing two sites of active lesions in the ... In the World Health Organization classification, LCS is the malignant end of the spectrum of benign Langerhans cell histiocytosis (LCH) [1]. The typical LCH cell is replaced by pleomorphic tumor cells in the LCS, only identifiable by phenotype or ultrastructure. Initial unifocal subcutaneous involvement is not unusual. However progressive disease, especially with multifocal dissemination, is highly fatal, despite multi-agent chemotherapy. It remains to be seen whether systemic progression may occur in our patient. Our patient demonstrated two hitherto unreported phenomena, namely paraneoplastic manifestation of LCS and acquired rampant disseminated lentigines as a new paraneoplastic dermatosis. The clinical history and histological findings do not suggest an underlying disseminated cutaneous LCH. Common paraneoplastic dermatoses (e.g., acanthocis nigricans) are well characterized and are putatively caused by neoplastic humoral secretions. Acquired melanocytic nevi are mostly related to solar exposure and are therefore localized. Recently, some cases of acral lentigines are debated to be paraneoplastic [2]. Disseminated lentigines are usually only found in familial lentiginosis syndromes (e.g., LEOPARD syndrome, Peutz–Jeghers, Carney complex, PTEN hamartoma syndrome). The neoplastic associations of these syndromes come from their primary systemic gene mutations [3]. The rapidly acquired disseminated growth of lentigines in our case is highly unusual and is somewhat induced by the abnormal aggressive transformation of the LCS cells. Skin pigmentation is usually under exquisite humoral control [4], and cutaneous Langerhans cells interact closely with melanocytes and keratinocytes [5]. It is impossible, however, to retrospectively work out the exact mechanism how the localized growth induced a systemic pigment response, since interval archival specimens are unavailable and the list of possible mediators are extensive. In any case, extirpation of the primary lesion appeared to halt further skin lesions.

Alitretinoin abrogates innate inflammation in palmoplantar pustular psoriasis

Palmoplantar pustular psoriasis is often recalcitrant to therapy. Here we evaluated the therapeutic effect of alitretinoin in patients with recalcitrant palmoplantar pustular psoriasis and investigated subsequent immunopathological alterations. Seven patients with palmoplantar pustular psoriasis were treated with oral alitretinoin 30 mg once daily for 12 weeks. Efficacy was assessed by palmoplantar pustular psoriasis area and severity index (PPPASI), visual analogue scales (VAS) on intensity of pain and pruritus and an overall patient assessment. Immunohistochemical staining for neutrophil elastase, CD3, CD4, CD8, CD1a CD11c, CD303,CD68, CD69, CD208 and HLA-DR was on lesional skin biopsies obtained before and after 12 weeks of treatment. PPPASI and VAS for pruritus and pain decreased significantly after 12 weeks of treatment with alitretinoin. The overall patient assessment ranged from 60% to 90% clinical improvement. In correlation with clinical improvement a significant reduction, particularly of neutrophils, macrophages and dendritic cells, was also observed in the skin sections. Alitretinoin was well tolerated except for headache during the first month of treatment in two patients. Limitations of the study are a missing control group and the concomitant usage of topical therapy. Our findings suggest that alitretinoin may represent a new and promising therapy for recalcitrant palmo-plantar psoriasis and warrants further controlled studies to confirm efficacy and safety of alitretinoin in this disease.

Aberrant epigenetic modifications in peripheral blood mononuclear cells from patients with pemphigus vulgaris

Pemphigus vulgaris (PV) is an autoimmune blistering disorder with a complex aetiology involving genetic and environmental factors, most of which remain unknown. It has become increasingly evident that aberrant epigenetic modifications are associated with the occurrence and development of autoimmune skin disorders. However, it is not known whether epigenetic modifications play a role in the development of PV. To analyse DNA methylation and histone modification patterns in peripheral blood mononuclear cells (PBMCs) of patients with PV. PBMC samples were isolated from 24 patients with PV and 20 healthy controls. Skin lesion biopsies and control skin specimens were obtained from 25 patients with PV and 15 healthy controls. Global DNA methylcytosine levels, as well as histone acetylation and methylation levels, were measured by enzyme-linked immunosorbent assay. mRNA expression levels were determined using real-time reverse transcription-polymerase chain reaction. Genomic DNA methylation in PBMCs of patients with PV was increased relative to controls. DNMT1 expression levels were significantly higher in PV PBMCs than in controls. MBD3 expression was repressed in PV PBMCs compared with healthy controls. Global histone H3/H4 acetylation and H3K4/H3K27 methylation levels were significantly decreased in patient PBMCs compared with healthy controls. These changes were accompanied by increased HDAC1, HDAC2 and SUV39H2 and decreased SUV39H1 and EZH2 in PV PBMCs. Aberrant DNA methylation and histone modifications occur in PBMCs of patients with PV, possibly due to the deregulation of epigenetic modifier genes. These changes may contribute to the pathological immune responses in PV.

Ultrastructural and molecular confirmation of the trichodysplasia spinulosa‐associated polyomavirus in biopsies of patients with trichodysplasia spinulosa

Trichodysplasia spinulosa (TS) is a rare and only recently characterized cutaneous disease occurring in immunocompromised patients. The disease is characterized by spiny follicular papules on clinical examination and by the presence of viral inclusions at ultrastructural examination. In the last year, this virus has been identified as a new member of the polyomavirus family and designated as TS-associated polyomavirus (TSPyV). We report two organ transplant patients with this disease in which we were able to identify the TSPyV at ultrastructural and molecular level from formalin-fixed paraffin-embedded biopsies of lesional skin. Similar to prior described cases, the patients presented with follicular papules which were concentrated on the central face and associated with alopecia. Histopathology of both cases showed dilated follicular infundibula plugged with cornified eosinophilic cells containing large trichohyaline granules. Transmission electron microscopy on paraffin-embedded tissue in case 1 showed 28-nm intracellular viral particles morphologically consistent with polyoma virus. For both cases the presence of TSPyV was confirmed by polymerase chain reaction with virus-specific primers followed by identification by direct sequencing. These two cases show the presence of the newly described TSPyV in TS further establishing its association with this distinctive disease.

Levamisole-Adulterated Cocaine: A Case Series

The percentage of cocaine adulterated with levamisole is steadily increasing in the United States. In susceptible persons, this combination of drugs leads to a clinical syndrome that can include leukopenia and cutaneous manifestations. Many patients also demonstrate positive autoimmune markers. Biopsies of skin lesions often reveal a thrombotic pattern, leukocytoclastic vasculitis, or both. We report 2 cases of this clinical phenomenon, one of which was severe enough to require skin grafting. It is important for clinicians be aware of this emerging public health threat.

Recalcitrant eosinophilic pustular folliculitis of Ofuji with palmoplantar pustulosis: dramatic response to narrowband UVB phototherapy

Eosinophilic pustular folliculitis of Ofuji is a recalcitrant disease typified by non-infective eosinophilic spongiosis involving the infundibular region of the hair follicle. We present a case of a 49-year-old Chinese man with known palmoplantar pustulosis and acrodermatitis continua of Hallopeau which was promptly resolved with methotrexate therapy. He returned with an erythematous papulopustular eruption with coalescence to annular plaques, occurring over the face, chest and back with active palmoplantar pustulation. Histology from skin biopsy of the palmar lesion was in keeping with palmoplantar psoriasis, while biopsy of the facial and truncal lesions revealed florid perifollicular eosinophilic congregation diagnostic of eosinophilic pustular folliculitis of Ofuji. Indomethacin was initiated with partial improvement of lesions with cyclical flares. A trial of narrowband ultraviolet-B phototherapy at a frequency of thrice weekly achieved sustained clearance of both eosinophilic pustular folliculitis and palmoplantar lesions. Indomethacin was tailed down and eventually discontinued with maintenance of narrowband ultraviolet-B therapy; this achieved successful control of the disease.

Histologic Assessment of Perilesional Skin in Vesiculobullous Diseases

To the Editor: Direct immunofluorescence of perilesional uninvolved skin (PS) is performed in most vesiculobullous dermatoses (VBL). Although immunopathologic and ultrastructural changes are described in PS, there is no data on histopathologic changes.1–3 The few studies available affirm the absence of changes on morphology.1,2 We studied hematoxylin and eosin–stained frozen sections of perilesional skin biopsies from 36 VBL, the majority of which were pemphigus (19) and bullous pemphigoid (9). In cases of pemphigus, we observed incipient acantholysis (18) (Fig. 1A), clefts between strata basale and spinosum (18) (Fig. 1B), adnexal involvement (9) (Fig. 1C), and suprabasal vesicles (5) (Fig. 1D). PS in pemphigoid showed spongiosis (4) (Fig. 2A), sub/intraepidermal clefts (4), eosinophils in the papillary dermis (3) (Fig. 2D), and frank subepidermal vesicles (4) (Fig. 2C). Eosinophils sticking to the basement membrane were noted in 2 cases of pemphigoid (Fig. 2B). Dermal melanophages were noted in most sections of both pemphigus and pemphigoid. We had 2 cases of bullous vasculitis that showed spongiotic vesicles and leukocytoclastic vasculitis. Freezing artifacts were noted in some cases but did not hamper interpretation. The only confounding factor among these was the nuclear/cytoplasmic vacuolization (Fig. 1B) that was difficult to tell apart from early suprabasal clefting. The presence of acantholysis came to rescue in such instances. We also examined frozen sections from 12 samples sent for vasculitis as a control group. None of the above changes were seen in these biopsies, except for focal nuclear and cytoplasmic vacuoles.FIGURE 1: Morphologic changes in cases of pemphigus. A, Incipient acantholysis involving suprabasal and spinous keratinocytes [hematoxylin and eosin (H&E), ×200]. B, Vacuoles between strata basale and spinosum, along with intranuclear vacuoles (H&E, ×200). C, Acantholysis involving a hair follicle (H&E, ×100). D, Suprabasal vesicle (H&E, ×200).FIGURE 2: Morphologic changes in cases of pemphigoid. A, Foci of spongiosis within epidermis [hematoxylin and eosin (H&E), ×200]. B, Eosinophils adherent to basement membrane (H&E, ×400). C, Subepidermal vesicle (H&E, ×100). D, Eosinophils in the dermal infiltrate (H&E, ×400).Significant morphologic changes are seen in perilesional skin of VBL, which are representative of the etiology and not due to freezing artifact. Credence to this observation comes from another study, which concluded that the number of mononuclear inflammatory cells was greater in perilesional than in clinically uninvolved pemphigus skin.4 The proportions of CD4+, CD8+, and Langerhans cells were also higher.4 It is particularly useful to study the morphologic features when a biopsy of lesional skin is not done simultaneously or is inconclusive. It is also potentially useful in identifying sample mix-ups and errors. Hence, we conclude that a detailed histologic evaluation of perilesional skin is pertinent in bullous lesions.

Primary cutaneous CD30+ anaplastic large-cell lymphoma in a young patient with psoriasis

Abstract Psoriasis is a common chronic inflammatory cutaneous disease, while primary cutaneous CD30+ anaplastic large-cell lymphoma (PC-ALCL) is a rare T-cell lymphoma which always has an excellent prognosis, although multifocal PC-ALCL tends to relapse after systemic chemotherapy. Psoriasis associated with PC-ALCL is exceptionally rare. We report a 29-year-old Chinese female with a 5-year history of psoriasis treated with Chinese herbs alone, who was referred to our institution with a tumor on the left clavicular region for 1 year and another one on the left palm for 2 months. Skin biopsies of both lesions showed diffuse infiltration of tumor cells, composed of large atypical cells with marked nuclear pleomorphism, prominent nucleoli, and eosinophilic cytoplasm. Large numbers of neutrophilic infiltrations were also noted in the lesion. Immunostaining revealed the lesion to be positive for CD30, vimentin, CD45, and CD68, and weakly positive for epithelial membrane antigen, but negative for anaplastic lymphoma receptor tyrosine kinase. The patient was diagnosed to have psoriasis associated with PC-ALCL; she died 18 months after the final diagnosis with unknown cause. We consider that immune dysregulation and/or Chinese herbs may play roles in the development of the present PC-ALCL.

Management of Non-Melanoma Skin Cancer in Immunocompromised Solid Organ Transplant Recipients

The management of non-melanoma skin cancers (NMSCs) in solid organ transplant recipients (OTRs) presents a variety of clinical challenges for physicians. OTRs are at a 65-fold increased risk for developing cutaneous squamous cell carcinomas (SCC), the most common NMSC that develops after transplantation. Risk factors contributing to the development of NMSCs in OTRs include a past medical history of any previous skin cancer, a personal history of significant sun exposure and a fair skin complexion or phototype. Further, greater immunosuppressive medication levels lead to an increased risk of NMSCs. Among immunosuppressants, specific older agents such as azathioprine and cyclosporine may increase the risk of developing NMSCs in contrast to newer agents such as sirolimus. Early skin biopsy and treatment of premalignant and malignant lesions are essential for treating these patients successfully. In this regard, the concept of field cancerization has been instructive in broadening treatments to include entire affected areas rather than individual lesions given that the areas with significant ultraviolet irradiation will continue to develop numerous individual precancerous and cancerous lesions. Field therapy with photodynamic therapy or topical 5-fluorouracil, imiquimod or diclofenac is often used in OTRs according to individual patient tolerability. Prompt excision or Mohs micrographic surgery is the standard of care of primary, uncomplicated squamous cell and basal cell carcinomas. For patients with in-transit or metastatic squamous cell carcinomas, adjuvant radiation, chemotherapy, and staging by sentinel lymph node dissection may be employed. For patients who develop numerous SCC per year, chemoprophylaxis can be effective in limiting the burden of disease. In consultation with the multidisciplinary transplant team, the immunosuppressive regimen can be revised to lower overall immunosuppression or altered to include newer drugs that have decreased oncogenic potential in OTRs. The greatest impact may be made by the prevention of NMSCs through simple, but rigorous, patient education on the benefits of UV protection, periodic self-skin examinations, and regular follow-ups. Accordingly, vitamin D and calcium supplementation should also be incorporated in transplant recipients. Management of OTRs requires patient education, frequent motivation for vigilance, regular follow-up, and interdisciplinary collaboration between transplant surgeons, nephrologists, hepatologists, cardiologists, transplant nurses, dermatologists, oncologists, pharmacists, and other relevant physicians ideally orchestrated by the essential transplant coordinators.

Allergic contact dermatitis induces upregulation of identical microRNAs in humans and mice

MicroRNAs are short, endogenous RNA molecules that can bind to parts of target mRNAs, thus inhibiting their translation and causing accelerated turnover or degradation of transcripts, thereby regulating gene expression. Several microRNAs have been found to be upregulated in atopic dermatitis and psoriasis, indicating a role in inflammatory skin diseases. However, there have been no studies on the expression of microRNAs in allergic contact dermatitis. To investigate expression of microRNAs in allergic contact dermatitis. Methods. Lesional and non-lesional skin biopsies were collected from subjects with allergic responses to diphenylcyclopropenone (DPCP). Additional samples for profiling were collected from an experimental mouse model by use of the strong allergen dinitrofluorobenzene. RNA was purified from all samples, and locked nucleic acid microarray analysis was performed, followed by validation with quantitative polymerase chain reaction (PCR). In humans sensitized with DPCP, we found significant upregulation of miR-21, miR-142-3p, miR-142-5p and miR-223 in challenged skin. The same microRNAs were significantly upregulated in the skin of mice in a mouse model of contact allergy. The upregulation of microRNA was confirmed by quantitative PCR. These are the first results indicating that microRNAs may be involved in the pathogenesis of allergic contact dermatitis, and they show that mouse models are valuable tools for further study of the involvement of microRNAs in allergic contact dermatitis.

Phase I Clinical Trial of O6-Benzylguanine and Topical Carmustine in the Treatment of Cutaneous T-Cell Lymphoma, Mycosis Fungoides Type

To evaluate the toxic effects and maximum tolerated dose of topical carmustine [1,3-bis(2-chloroethyl)-1-nitrosourea] following intravenous O6-benzylguanine in the treatment of cutaneous T-cell lymphoma (CTCL), and to determine pharmacodynamics of O6-alkylguanine DNA alkyltransferase activity in treated CTCL lesions. Open-label, dose-escalation, phase I trial. Dermatology outpatient clinic and clinical research unit at a university teaching hospital. A total of 21 adult patients (11 male, 10 female)with early-stage (IA-IIA) refractory CTCL, mycosis fungoides type, treated with topical carmustine following intravenous O6-benzylguanine. Treatment once every 2 weeks with 120 mg/m(2) intravenous O6-benzylguanine followed 1 hour later by whole-body, low-dose topical carmustine starting at 10 mg, with 10-mg incremental dose-escalation in 3 patient cohorts. Cutaneous T-cell lymphoma lesional skin biopsy specimens were taken at baseline and 6 hours, 24 hours, and 1 week after the first O6-benzylguanine infusion for analysis of O6-alkylguanine-DNA alkyltransferase activity. Clinical response measured by physical examination and severity-weighted assessment tool measurements, safety data acquired by review of adverse events at study visits, and O6-alkylguanine-DNA alkyltransferase activity in treated lesion skin biopsy specimens. A minimal toxic effect was observed through the 40-mg carmustine dose level with 76% of adverse events being grade 1 based on the National Cancer Institute Common Terminology Criteria for Adverse Events. Mean baseline O6-alkylguanine-DNA alkyltransferase activity in CTCL lesions was 3 times greater than in normal controls and was diminished by a median of 100% at 6 and 24 hours following O6-benzylguanine with recovery at 1 week. Clinical disease reduction correlated positively with O6-alkylguanine-DNA alkyltransferase activity at 168 hours (P=.02) and inversely with area under the curve of O6-alkylguanine-DNA alkyltransferase over 1 week (P=.01). Twelve partial responses and 4 complete responses were observed (overall response, 76% [95% CI, 0.55-0.89]). Five patients discontinued therapy owing to adverse events with a possible, probable, or definite relationship to the study drug. O6-benzylguanine significantly depletes O6-alkylguanine-DNA alkyltransferase in CTCL lesions and in combination with topical carmustine is well tolerated and shows meaningful clinical responses in CTCL at markedly reduced total carmustine treatment doses.

Linear Arrangement of Neutrophils Along the Basal Layer in Bullous Pemphigoid

Bullous pemphigoid is an inflammatory autoimmune subepidermal bullous disease with distinct immunohistological features. We report an unusual case of a 59-year-old woman with a bullous eruption whose lesional skin biopsy showed a subepidermal blister with a linear arrangement of neutrophils, mimicking linear IgA bullous dermatosis. However, direct immunofluorescence studies demonstrated IgG and C3 linear deposition along the basement membrane zone, compatible with bullous pemphigoid. We suggest that bullous pemphigoid should therefore be considered in the differential diagnosis of neutrophil-rich subepidermal bullous diseases along with dermatitis herpetiformis and linear IgA.

Melanoma diagnosed 27 years after a benoxaprofen-induced photosensitivity reaction

The propionic acid derivative Benoxaprofen was introduced for the treatment of rheumatic disorders in 1980. Its product license was then withdrawn 2 years later due to concerns over serious dermatologic, hepatic and renal side effects. Photosensitivity was the most common side effect with reported incidence of up to 50%. We present the first case report of a patient who presented with a melanoma diagnosed 27 years after a benoxaprofen-induced photosensitivity reaction. With an estimated 1.5 million patients previously on benoxaprofen, a large number of patients may potentially face increased risk of developing malignant melanoma. This case report can only suggest an association between solar injury secondary to benoxaprofen-related photosensitivity and subsequent melanoma. However the primary factor that improves survival from melanoma is early diagnosis, and so clinicians treating this group of patients should be aware of this risk. Although benoxaprofen is no longer in clinical use, the long-term sequelae to its photosensitizing effects may still be clinically important. Clinicians treating this group of patients should be vigilant, and consider a low threshold for diagnostic biopsy of suspicious skin lesions.

Cutaneous sarcoidosis in southern Taiwan: clinicopathologic study of a series with high proportions of lesions confined to the face and angiolupoid variant

Sarcoidosis is a multisystem granulomatous disorder of unknown aetiology. Our clinical experience suggests that facial involvement and the angiolupoid variant appear more common in our patients compared with series reported from the western countries. To characterize the clinicopathologic features of cutaneous sarcoidosis diagnosed in our department and to compare our data with those in the literature. We conducted a clinicopathologic review of biopsy-proved cases of cutaneous sarcoidosis diagnosed during January 2002-December 2010. Our study consisted of 37 patients, ages 26-84 years (mean 54.3 years), of whom 84% were females. Systemic involvement was detected in 73%, affecting the lung in 57%, lymph nodes in 65% and eyes in 43%. Most skin lesions were the papulonodular type (70%) and confined to the face (54%). The angiolupoid variant, while rare in Europe and America, was the most common variant (38%) in our series and often associated with eye involvement. The histology was characterized by infiltration of naked sarcoidal granulomas, mostly (86%) mixed with variable amounts of tuberculoid granulomas in the dermis and/or the subcutis. Other findings included fibrinoid necrosis (23%), foreign bodies (16%), osteoclast-like cells (14%) and granuloma annulare-like and necrobiosis lipoidica-like features. The present series of cutaneous sarcoidosis was characterized by a marked female predominance and by high proportions of facial involvement and the angiolupoid variant. Angiolupoid sarcoidosis was often associated with eye involvement. A complete dermatologic examination and biopsy of suspicious skin lesions should be routinely performed to facilitate early diagnosis of sarcoidosis.

Granulomatous Variant of Giant Centrifugal Miliaria Profunda

Two infants presented with multiple asymptomatic papules and geographic and annular plaques over the extensor aspect of the upper and lower extremities and trunk. Skin biopsy of both lesions showed plugged and hyperplastic dilated acrosryingia and deep dermal ducts, along with granulomatous inflammatory reaction. These lesions showed self-healing with complete resolution. A previous report described similar clinical and histopathologic features and labeled it giant centrifugal miliaria profunda. Because of the large granulomatous plaques and deep infiltrate, we propose that it was a granulomatous variant of giant centrifugal miliaria profunda. We report these cases for their rarity and self-healing nature.

Buschke-Ollendorff syndrome associated with hypertrophic scar formation: a possible role for LEMD3 mutation

Funding sources: none. Conflicts of interest: none declared. Madam, Buschke–Ollendorff syndrome (BOS; OMIM 166700) is a rare autosomal dominant condition characterized by the development of multiple connective tissue naevi in association with osteopoikilosis and occasionally melorheostosis.1 The clinical expression of this syndrome is quite variable; skin and skeletal lesions may arise independently in affected family members.2 BOS results from loss‐of‐function mutations in the LEMD3 gene, which encodes a potent negative regulator of transforming growth factor (TGF)‐β and bone morphogenic protein signalling pathways;1 the pathogenetic role played by LEMD3 defects in BOS is not fully understood. We report a Japanese family with BOS associated with hypertrophic scar (HS) after traumatic injury. A 5‐year‐old boy presented with asymptomatic multiple cutaneous nodules on his trunk. The lesions had gradually increased in number since they were first noticed on his lower back when he was 5 months old. On physical examination, multiple flesh‐coloured round or oval cutaneous plaques were noted on his abdomen (Fig. 1a) and lower back (Fig. 1b). The lesions were asymmetrically distributed and covered by normal‐appearing skin. There were firm, nodular hypertrophic lesions on his left knee (Fig. 1d) and glabella. These lesions were reported to have arisen after traumatic injury. Lesional skin biopsy from the lower back of the proband revealed increased levels of collagen in the dermis extending into the subcutaneous fat (Fig. 1c). Notably, HS formed at the biopsy incision as it healed. Physical examination of the other family members demonstrated that the proband’s father and elder sister had, to a lesser extent, similar skin plaques on their lower backs, presenting as connective tissue naevi, whereas the mother had no significant skin involvement. Hypertrophic skin lesions at sites of injury, reportedly less elevated than ∼10 years before, were seen on the upper left arm of the father (Fig. 1e) and the right knee of the sister. Neither the collagenous naevi nor the HS lesions followed known cutaneous segments such as Blaschko’s lines. X‐rays of the long bones and pelvis revealed osteopoikilosis, which was distributed symmetrically, in the father (Fig. 1f), but not in the proband. In the affected family members, routine laboratory examinations were within normal limits. Based on these findings, we made a diagnosis of BOS associated with HS. Reverse transcription–polymerase chain reaction (RT‐PCR) was performed as follows: the partial cDNA of LEMD3, spanning exons 5–9, was RT‐PCR amplified from total RNA extracted from peripheral blood leucocytes using an RNeasy extraction kit (Qiagen, Hilden, Germany). Reverse transcription with 0·25 μg of total RNA was carried out using the reverse transcriptase ReverTra Ace™ (Toyobo, Osaka, Japan). First‐strand cDNAs were synthesized by incubation for 10 min at 30 °C, 20 min at 42 °C, 5 min at 99 °C, and 5 min at 4 °C. cDNA for exons 5–9 was PCR amplified using the following specific primers: forward 5′‐TTGGAATAAGGTGTGTTGGT‐3′; reverse 5′‐CTCATTAGCAGCAAGGAAGT‐3′.

A Rare Case of Multiple skin metastasis from squamous cell carcinoma of the esophagus: case report and brief review of literature.

SummaryBackground:Esophageal cancer is an aggressive disease that generally has a poor prognosis. Patients affected by the disease usually present with signs and symptoms related to local growth of the tumor, gastrointestinal bleeding and nutritional impairment. Skin metastases are rare events, associated with advanced stage and poor survival.Case Report:We report the case of a 51-year-old man who presented poor general status, dysphagia, weight loss and skin lesions disseminated throughout the body. Endoscopic examination revealed the presence of esophageal squamous cell carcinoma, and biopsies of skin lesions showed metastasis of this cancer to the esophagus.Conclusions:We believe that any suspicious lesion that presents together with a history of gastrointestinal malignancy should be biopsied, since it can change the staging and prognosis of patients.

Photo Quiz: Skin Rash and Extremity Swelling in an Adolescent

A previously well 15-year-old male presented to our institution with a 3-week history of sacral edema that began in his feet then spread to his hands, face, shins, and forearms. The edema was described as taut and shiny, and it was followed by rash of the extremities and trunk. Swelling of the hands made it difficult for the patient to make a fist. He complained of decreased appetite, a 10-lb weight loss, and some mild fatigue, but he denied having fevers, chills, and night sweats. He denied having any ill contacts, and all of his family members were well. The patient had immigrated to the United States from Haiti 3 years earlier. He had received one Mycobacterium bovis BCG vaccine. Physical examination revealed a well-grown, afebrile patient with normal vital signs who was essentially unremarkable except for diffuse, nonpitting edema of the face, hands, feet, and forearms that was not tender to palpation, with erythematous, raised plaques covering his chest, abdomen, back, and extremities. He had a normal joint and neurological exam. A complete blood count (CBC) and metabolic panel were unremarkable. He had a normal albumin level and normal urinalysis and thyroid function test results. His total serum protein was slightly elevated, and his erythrocyte sedimentation rate (ESR) was elevated, at 51 mm/h. A chest X ray was normal. A skin biopsy of a right arm lesion was performed and established the correct diagnosis (Fig. 1). Fig 1 Histopathological appearance of the skin lesion biopsy specimen stained with hematoxylin-phloxine B-saffron.(a) Low-power panoramic view. (b) Higher magnification. (c) Small nerves (arrow). (d) Modified Ziehl-Neelsen (Wade-Fite) stain. (For answer and discussion, see page 213 in this issue [doi:10.1128/JCM.05729-11])