Single-stranded RNA Virus Research Articles

Enhanced selective discrimination of point-mutated viral RNA through false amplification regulatory direct insertion in rolling circle amplification

Coronaviruses are single-stranded RNA viruses with high mutation rates. Although a diagnostic method for coronaviruses has been developed, variants appear rapidly. Low test accuracy owing to single-point mutations is one of the main factors in the failure to prevent the early spread of coronavirus infection. Although reverse transcription-quantitative polymerase chain reaction can detect coronavirus infection, it cannot exclude the possibility of false positives, and an additional multiplexing kit is needed to discriminate single nucleotide polymorphism (SNP) variants. Therefore, in this study, we introduced a new nucleic acid amplification method to determine whether an infected person has a SNP mutation using a lateral flow assay (LFA) as a point-of-care test. Unlike traditional DNA amplification methods, direct insertion into rolling circle amplification amplifies the target genes without false amplification. After SNP-selective nucleic acid amplification, nuclease enzymes are used to make double-stranded DNA fragments that the LFA can detect, where specific mismatched DNA is found and cleaved to show different signals when a SNP-type is present. Therefore, wild- and SNP-type variants can be selectively detected. In this study, the limit of detection was 400 aM for viral RNA, and we successfully identified a dominant SNP variant selectively. Clinical tests were also conducted.

Phase I Pharmacokinetics Study of Oral Administration of Esperavir® (INN: Molnupiravir) (LLC "PROMOMED RUS", Russia)

Introduction. The pandemic of the new coronavirus infection COVID-19 (Coronavirus Disease 2019) was caused by a single-stranded RNA virus SARS-CoV-2 (Severe acute respiratory syndrome-related coronavirus 2). Molnupiravir is an antiviral drug with activity against RNA viruses including SARS-CoV-2. Molnupiravir exerts the antiviral effect by introducing copy errors during viral RNA replication – by that the replication of SARS-CoV-2 inhibits. For oral administration of molnupiravir the drug Esperavir® has been registered in Russia.Aim. The aim is pharmacokinetics study of Esperavir®, capsules 200 mg (the manufacturer is JSC "Biokhimic", LLC "PROMOMED RUS", Russia, as registration certificate holder) by a single dose (800 mg) and multiple doses oral administration (800 mg twice a day with a gap of 12 hours between doses) in healthy volunteers in a phase I pharmacokinetics study, comparison the obtained data of pharmacokinetic parameters with the literature data.Materials and methods. The clinical and analytical phases of the pharmacokinetic study as well as pharmacokinetic analyses have been performed as a part of a clinical trial of the drug Esperavir®, capsules 200 mg (the manufacturer is JSC "Biokhimic", LLC "PROMOMED RUS", Russia, as registration certificate holder). Chromatographic separation and detection by Nexera XR high-performance liquid chromatograph with triple quadrupole tandem mass spectrometry LCMS-8040 (Shimadzu Corporation, Japan). The pharmacokinetic parameters were calculated with the Boomer pharmacokinetic analysis add-in for Microsoft Excel (Department of Pharmacokinetics and Drug Metabolism, Allergan, Irvine, CA 92606, USA). Descriptive pharmacokinetic statistics were calculated with Microsoft Excel (Microsoft Corporation, USA).Results and discussion. Pharmacokinetic parameters for cohort 1 (800 mg single dose of Esperavir®) and for cohort 2 (800 mg of Esperavir® twice a day with a gap of 12 hours between doses) were calculated. Averaged pharmacokinetic profiles of mean NHC concentrations over time in linear and log-linear scales were plotted. The geometric mean of Cmax and T1/2, the median, minimum and maximum of Tmax showed the comparability of the obtained data after a single dose administration of 800 mg of Esperavir® and the available literature data.Conclusion. According to the concentrations from the analytical phase of the pharmacokinetic study the pharmacokinetic parameters were calculated, averaged pharmacokinetic profiles in linear and log-linear scales were plotted after a single dose and multiple doses of the drug Esperavir®, capsules (the manufacturer is JSC "Biokhimic", LLC "PROMOMED RUS", Russia, as registration certificate holder). The comparability of the obtained data and the available literature data was shown. The results justified the study of the subsequent phases of clinical trials of Esperavir®.

The Role of Furin in the Pathogenesis of COVID-19-Associated Neurological Disorders.

Neurological disorders have been reported in a large number of coronavirus disease 2019 (COVID-19) patients, suggesting that this disease may have long-term adverse neurological consequences. COVID-19 occurs from infection by a positive-sense single-stranded RNA virus called severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The membrane fusion protein of SARS-CoV-2, the spike protein, binds to its human host receptor, angiotensin-converting enzyme 2 (ACE2), to initiate membrane fusion between the virus and host cell. The spike protein of SARS-CoV-2 contains the furin protease recognition site and its cleavage enhances the infectivity of this virus. The binding of SARS-CoV-2 to the ACE2 receptor has been shown to downregulate ACE2, thereby increasing the levels of pathogenic angiotensin II (Ang II). The furin protease cleaves between the S1 subunit of the spike protein with the binding domain toward ACE2 and the S2 subunit with the transmembrane domain that anchors to the viral membrane, and this activity releases the S1 subunit into the blood circulation. The released S1 subunit of the spike protein also binds to and downregulates ACE2, in turn increasing the level of Ang II. Considering that a viral particle contains many spike protein molecules, furin-dependent cleavage would release many free S1 protein molecules, each of which can downregulate ACE2, while infection with a viral particle only affects one ACE2 molecule. Therefore, the furin-dependent release of S1 protein would dramatically amplify the ability to downregulate ACE2 and produce Ang II. We hypothesize that this amplification mechanism that the virus possesses, but not the infection per se, is the major driving force behind COVID-19-associated neurological disorders.

First Report of the Emergence of Peste des Petits Ruminants Lineage IV Virus in Senegal.

Peste des petits ruminants (PPR) is a highly contagious viral disease and one of the deadliest affecting wild goats, sheep, and small ruminants; however, goats are generally more sensitive. The causative agent is the Peste des Petits Ruminants virus (PPRV), which is a single-stranded RNA virus of negative polarity belonging to the Paramyxoviridae family. In February 2020, an active outbreak of PPR was reported in a herd of a transhumant farmer in the village of Gainth Pathé (department of Kounguel, Kaffrine region, Senegal). Of the ten swabs collected from the goats, eight returned a positive result through a quantitative real-time PCR. The sample that yielded the strongest signal from the quantitative real-time PCR was further analyzed with a conventional PCR amplification and direct amplicon sequencing. A phylogenetic analysis showed that the sequence of the PPR virus obtained belonged to lineage IV. These results confirm those found in the countries bordering Senegal and reinforce the hypothesis of the importance of animal mobility between these neighboring countries in the control of PPRV. In perspective, following the discovery of this lineage IV in Senegal, a study on its dispersion is underway throughout the national territory. The results that will emerge from this study, associated with detailed data on animal movements and epidemiological data, will provide appropriate and effective information to improve PPR surveillance and control strategies with a view to its eradication.

The complete genome sequences of a negative single-stranded RNA virus and a double-stranded RNA virus coinfecting the entomopathogenic fungus Beauveria bassiana Vuillemin.

Beauveria bassiana Vuillemin is an entomopathogenic fungus that has been developed as a biological insecticide. B. bassiana can be infected by single or multiple mycoviruses, most of which are double-stranded RNA (dsRNA) viruses, while infections with single-stranded RNA (ssRNA) viruses, especially negative single-stranded RNA (-ssRNA) viruses, have been observed less frequently. In the present study, we sequenced and analyzed the complete genomes of two new different mycoviruses coinfecting a single B. bassiana strain: a -ssRNA virus which we have named "Beauveria bassiana negative-strand RNA virus 1" (BbNSRV1), and a dsRNA virus, which we have named "Beauveria bassiana orthocurvulavirus 1" (BbOCuV1). The genome of BbNSRV1 consists of a single segment of negative-sense, single-stranded RNA with a length of 6169 nt, containing a single open reading frame (ORF) encoding a putative RNA-dependent RNA polymerase (RdRp) with 1949 aa (220.1 kDa). BLASTx analysis showed that the RdRp had the highest sequence similarity (59.79%) to that of Plasmopara viticola lesion associated mononegaambi virus 2, a member of the family Mymonaviridae. This is the first report of a -ssRNA mycovirus infecting B. bassiana. The genome of BbOCuV1 consists of two dsRNA segments, 2164 bp and 1765 bp in length, respectively, with dsRNA1 encoding a protein with conserved RdRp motifs and 70.75% sequence identity to the putative RdRp of the taxonomically unassigned mycovirus Fusarium graminearum virus 5 (FgV5), and the dsRNA2 encoding a putative coat protein with sequence identity 64.26% to the corresponding protein of the FgV5. Phylogenetic analysis indicated that BbOCuV1 belongs to a taxonomically unassigned group of dsRNA mycoviruses related to members of the families Curvulaviridae and Partitiviridae. Hence, it might be the member of a new family that remains to be named and formally recognized.

First Report of Cucurbit aphid-borne yellows virus infecting five cucurbits in India.

Cucurbits are among the most popular vegetables cultivated globally. They have high economic importance, especially in India, where they are cooked and eaten as vegetables (Dhillon et al. 2016). In February 2023, yellowing symptoms were observed on cucurbitaceous species, viz. Trichosanthes cucumerina (Snake gourd - SG), Luffa acutangula (Ridge gourd - RG), Lagenaria siceraria (Bottle gourd - BG), Luffa aegyptiaca (Sponge gourd - SPG) and yellow chlorotic spots were recorded on Benincasa hispida (Ash gourd - AG) growing in the experimental farm at the Indian Agricultural Research Institute, Regional Station, Pune (Supplementary Figure 1). The average disease incidence ranged from 5% to 30%. A total of 175 leaf samples, including thirty symptomatic and five asymptomatic plants of each cucurbit, were collected and tested by DAS-ELISA using antisera against cucurbit aphid-borne yellows virus (CABYV) (DSMZ, Germany), cucurbit yellow stunting disorder virus (CYSDV) (Arsh Biotech, India), cucumber mosaic virus (CMV), zucchini yellow mosaic virus (ZYMV), and papaya ringspot virus (PRSV) (Agdia, USA). All 150 symptomatic cucurbit samples tested positive for CABYV, while five samples from SG, 14 from RG, two from AG, and 11 from SPG hosts were also positive for PRSV. Asymptomatic samples were negative for all viruses tested. In order to further confirm the presence of the virus, total RNA was extracted from ten samples of each cucurbit host that were positive only for CABYV and the asymptomatic samples using the RNeasy Plant Mini Kit (Qiagen, Germany) as per the manufacturer's protocol. Two-step RT-PCR was carried out using the extracted RNA and CABYV-specific primers, amplifying c. 484 bp of the coat protein gene region (Boubourakas et al. 2006). Amplicons of expected size were obtained in all symptomatic samples, whereas the asymptomatic samples tested negative. Three amplicons obtained from positive samples from each of the cucurbit species were directly sequenced and found to be identical to each other. A representative virus sequence obtained from each cucurbit was deposited in GenBank (Snake gourd - OQ921128, Ridge gourd - OQ921127, Bottle gourd - OQ921126, Ash gourd - OQ921125, Sponge gourd - OQ921129). In BLASTn analysis, the isolates shared from 94.23 to 100% nucleotide identities with the Indian CABYV isolates of various cucurbits and clustered closely with other Pune isolates in the phylogenetic analysis (Supplementary Figure 2). CABYV (genus Polerovirus) is a single-stranded positive-sense RNA virus, and is known to infect and cause severe economic losses in cucurbits worldwide. Previously, occurrences of CABYV have been reported in cucurbits such as watermelon, bitter gourd, cucumber, squash, teasel gourd, and muskmelon in India (Nagendran et al. 2022; Tripathi et al. 2023). It has also been reported to infect a weed species - Abelmoschus moschatus from the same geographical region (Verma et al. 2023). To our knowledge, this is the first report of the natural occurrence of CABYV in snake gourd and ridge gourd worldwide and bottle gourd, ash gourd and sponge gourd in India. The present findings have significant epidemiological importance, as they demonstrate that CABYV is spreading to other cucurbits and occurring widely in India.

Authorizing of Immunogenicity of Concentrated and Purified Newcastle Disease Virus V4 Strain using Downstream Processing.

Newcastle disease virus (NVD) from the Paramyxoviridae family is a single-stranded negative-sense RNA virus. This infection can affect both domestic poultry and almost all other bird species. It has been considered a very severe difficulty for the poultry industry all over the world. Even though it remains a potential threat to poultry industries, this virus is a powerful oncolytic virus as well. In this study, a process was accomplished to achieve concentrated and highly purified NDV V4 strain particles. Downstream processing of Newcastle virus strain V4 was characterized by amplifying virus in embryonated chicken eggs. Through a sequence of steps, harvesting allantoic fluid, clarification by centrifuge, concentration by ultrafiltration, and size exclusion separation, the reduced volume and pure virus particles were considered for the amount of ovalbumin, hemagglutinin activity, transmission electron microscopy (TEM), electrophoresis, and additionally immunogenicity of prepared antigens. The results presented a high recovery of HA activity in concentrated and purified virus with the removal of ovalbumin and the typical morphology based on TEM. Sepharose CL-4B was determined as the best media among all used resins to purify the virus. Prepared formulations as vaccines demonstrated positive hemagglutinin inhibition for 6 months and stability for 2 years. Strong evidence from organized studies supports the effectiveness of this method in concentrating and purifying intact NDV, which could be valuable in vaccine research, antiserum preparation, or even as an alternative oncotic agent to traditional methods. Despite further studies being conducted, this method can be utilized particularly on a semi-industrial scale to produce various vaccine components.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Antivirals for Broader Coverage against Human Coronaviruses.

Coronaviruses (CoVs) are enveloped positive-sense single-stranded RNA viruses with a genome that is 27-31 kbases in length. Critical genes include the spike (S), envelope (E), membrane (M), nucleocapsid (N) and nine accessory open reading frames encoding for non-structural proteins (NSPs) that have multiple roles in the replication cycle and immune evasion (1). There are seven known human CoVs that most likely appeared after zoonotic transfer, the most recent being SARS-CoV-2, responsible for the COVID-19 pandemic. Antivirals that have been approved by the FDA for use against COVID-19 such as Paxlovid can target and successfully inhibit the main protease (MPro) activity of multiple human CoVs; however, alternative proteomes encoded by CoV genomes have a closer genetic similarity to each other, suggesting that antivirals could be developed now that target future CoVs. New zoonotic introductions of CoVs to humans are inevitable and unpredictable. Therefore, new antivirals are required to control not only the next human CoV outbreak but also the four common human CoVs (229E, OC43, NL63, HKU1) that circulate frequently and to contain sporadic outbreaks of the severe human CoVs (SARS-CoV, MERS and SARS-CoV-2). The current study found that emerging antiviral drugs, such as Paxlovid, could target other CoVs, but only SARS-CoV-2 is known to be targeted in vivo. Other drugs which have the potential to target other human CoVs are still within clinical trials and are not yet available for public use. Monoclonal antibody (mAb) treatment and vaccines for SARS-CoV-2 can reduce mortality and hospitalisation rates; however, they target the Spike protein whose sequence mutates frequently and drifts. Spike is also not applicable for targeting other HCoVs as these are not well-conserved sequences among human CoVs. Thus, there is a need for readily available treatments globally that target all seven human CoVs and improve the preparedness for inevitable future outbreaks. Here, we discuss antiviral research, contributing to the control of common and severe CoV replication and transmission, including the current SARS-CoV-2 outbreak. The aim was to identify common features of CoVs for antivirals, biologics and vaccines that could reduce the scientific, political, economic and public health strain caused by CoV outbreaks now and in the future.

Molecular characterization of a novel mycovirus from binucleate Rhizoctonia AG-A strain A46.

The complete genome sequence of a positive-sense single-stranded RNA (+ ssRNA) virus, Rhizoctonia beny-like virus 1 (RBLV1), isolated from binucleate Rhizoctonia AG-A strain A46, was determined. The RBLV1 genome is 10,280 nt in length and contains a short stretch of adenines at the 3' terminus. It contains a single open reading frame (ORF) encoding a 376.30-kDa protein with viral helicase and RNA-dependent RNA polymerase (RdRp) motifs. The encoded protein exhibited the highest sequence similarity to Rhizoctonia cerealis beny-like virus 0928-1 (RcBeLV 0928-1, 45.25%), with a sequence coverage of 63%. Phylogenetic analysis based on ORF protein sequences revealed that RBLV1 is a novel unclassified mycovirus.

Autophagy and Apoptosis in Rabies Virus Replication.

Rabies virus (RABV) is a single-stranded negative-sense RNA virus belonging to the Rhabdoviridae family and Lyssavirus genus, which is highly neurotropic and can infect almost all warm-blooded animals, including humans. Autophagy and apoptosis are two evolutionarily conserved and genetically regulated processes that maintain cellular and organismal homeostasis, respectively. Autophagy recycles unnecessary or dysfunctional intracellular organelles and molecules in a cell, whereas apoptosis eliminates damaged or unwanted cells in an organism. Studies have shown that RABV can induce both autophagy and apoptosis in target cells. To advance our understanding of pathogenesis of rabies, this paper reviews the molecular mechanisms of autophagy and apoptosis induced by RABV and the effects of the two cellular events on RABV replication.

Different viral genes modulate virulence in model mammal hosts and Culex pipiens vector competence in Mediterranean basin lineage 1 West Nile virus strains.

West Nile virus (WNV) is a single-stranded positive-sense RNA virus (+ssRNA) belonging to the genus Orthoflavivirus. Its enzootic cycle involves mosquito vectors, mainly Culex, and wild birds as reservoir hosts, while mammals, such as humans and equids, are incidental dead-end hosts. It was first discovered in 1934 in Uganda, and since 1999 has been responsible for frequent outbreaks in humans, horses and wild birds, mostly in America and in Europe. Virus spread, as well as outbreak severity, can be influenced by many ecological factors, such as reservoir host availability, biodiversity, movements and competence, mosquito abundance, distribution and vector competence, by environmental factors such as temperature, land use and precipitation, as well as by virus genetic factors influencing virulence or transmission. Former studies have investigated WNV factors of virulence, but few have compared viral genetic determinants of pathogenicity in different host species, and even fewer have considered the genetic drivers of virus invasiveness and excretion in Culex vector. In this study, we characterized WNV genetic factors implicated in the difference in virulence observed in two lineage 1 WNV strains from the Mediterranean Basin, the first isolated during a significant outbreak reported in Israel in 1998, and the second from a milder outbreak in Italy in 2008. We used an innovative and powerful reverse genetic tool, e.g., ISA (infectious subgenomic amplicons) to generate chimeras between Israel 1998 and Italy 2008 strains, focusing on non-structural (NS) proteins and the 3'UTR non-coding region. We analyzed the replication of these chimeras and their progenitors in mammals, in BALB/cByJ mice, and vector competence in Culex (Cx.) pipiens mosquitoes. Results obtained in BALB/cByJ mice suggest a role of the NS2B/NS3/NS4B/NS5 genomic region in viral attenuation in mammals, while NS4B/NS5/3'UTR regions are important in Cx. pipiens infection and possibly in vector competence.

The phosphorylation of the movement protein TGBp1 regulates the accumulation of the Bamboo mosaic virus.

Phosphorylation and dephosphorylation of viral movement proteins plays a crucial role in regulating virus movement. Our study focused on investigating the movement protein TGBp1 of Bamboo mosaic virus (BaMV), which is a single-stranded positive-sense RNA virus. Specifically, we examined four potential phosphorylation sites (S15, S18, T58, and S247) within the TGBp1 protein. To study the impact of phosphorylation, we introduced amino acid substitutions at the selected sites. Alanine substitutions were used to prevent phosphorylation, while aspartate substitutions were employed to mimic phosphorylation. Our findings suggest that mimicking phosphorylation at S15, S18 and T58 of TGBp1 might be linked to silencing suppressor activities. The phosphorylated form at these sites exhibits a loss of silencing suppressor activity, leading to reduced viral accumulation in the inoculated leaves. Furthermore, mimicking phosphorylation at residues S15 and S18 could diminish viral accumulation at the single-cell level, while doing so at residue T58 could influence virus movement. However, mimicking phosphorylation at residue S247 does not appear to be relevant to both functions of TGBp1. Overall, our study provides insights into the functional significance of specific phosphorylation sites in BaMV TGBp1, illuminating the regulatory mechanisms involved in virus movement and silencing suppression.

Antiviral discovery in toxic cyanobacteria: Low hanging fruit in the age of pandemics.

The power of novel vaccination technologies and their rapid development were elucidated clearly during the COVID-19 pandemic. At the same time, it also became clear that there is an urgent need to discover and manufacture new antivirals that target emerging viral threats. Toxic species of cyanobacteria produce a range of bioactive compounds that makes them good candidates for drug discovery. Nevertheless, few studies demonstrate the antiviral potential of cyanobacteria. This is partly due to the lack of specific and simple protocols designed for the rapid detection of antiviral activity in cyanobacteria and partly because specialized facilities for work with pathogenic viruses are few and far between. We therefore developed an easy method for the screening of cyanobacterial cultures for antiviral activity and used our private culture collection of non-pathogenic virus isolates to show that antiviral activity is a prominent feature in the cyanobacterium Microcystis aeruginosa. In this proof-of-concept study, we show that M. aeruginosa extracts from three different cyanobacterial strains delay infection of diatom-infecting single-stranded DNA and single-stranded RNA viruses by up to 2 days. Our work shows the ease with which cyanobacteria from culture collections can be screened for antiviral activity and highlights the potential of cyanobacteria as an excellent source for the discovery of novel antiviral compounds, warranting further investigation.

Dynamic evolution of the sofosbuvir-associated variant A1343V in HEV-infected patients under concomitant sofosbuvir-ribavirin treatment

In the absence of a hepatitis E virus (HEV)-specific antiviral treatment, sofosbuvir has recently been shown to have antiviral activity against HEV invivo. However, a variant, A1343V, that is strongly associated with viral relapse impedes treatment success. In this study, we investigated the occurrence of variants during sofosbuvir and ribavirin treatment invivo and assessed the sensitivity of resistance-associated variants to concurrent treatment in cell culture. Two patients with chronic HEV infection that did not clear infection under ribavirin treatment were subsequently treated with a combination of sofosbuvir and ribavirin. We determined response to treatment by measuring liver enzymes and viral load in blood and stool. Moreover, we analyzed viral evolution using polymerase-targeted high-throughput sequencing and assessed replication fitness of resistance-associated variants using a HEV replicon system. Combination treatment was successful in decreasing viral load towards the limit of quantification. However, during treatment sustained virological response was not achieved. Variants associated with sofosbuvir or ribavirin treatment emerged during treatment, including A1343V and G1634R. Moreover, A1343V, as a single or double mutation with G1634R, was associated with sofosbuvir resistance during concomitant treatment invitro. These results highlight the importance of variant profiling during antiviral treatment of patients with chronic infection. Understanding how intra-host viral evolution impedes treatment success will help guide the design of next-generation antivirals. The lack of hepatitis E virus (HEV)-specific antivirals to treat chronic infection remains a serious health burden. Although ribavirin, interferon and sofosbuvir have been reported as anti-HEV drugs, not all patients are eligible for treatment or clear infection, since resistant-associated variants can rapidly emerge. In this study, we analyzed the efficacy of sofosbuvir and ribavirin combination treatment in terms of HEV suppression, the emergence of resistance-associated variants and their ability to escape treatment inhibition invitro. Our results provide novel insights into evolutionary dynamics of HEV during treatment and thus will help guide the design of next-generation antivirals.

White islands in a sea of red

Dengue is a viral disease caused by a single-stranded RNA virus from the Flaviviridae family, primarily transmitted by the Aedes aegypti mosquito, although Aedes albopictus also plays a role as a vector. Clinical features of dengue range from nonspecific symptoms to severe forms like dengue shock syndrome. Among these clinical features, dermatological manifestations are particularly noteworthy, as they can aid in differentiating dengue from other illnesses.

Novel approaches for HTLV-1 therapy: innovative applications of CRISPR-Cas9.

The human T-cell lymphotropic virus type 1 (HTLV-1) is a single-stranded positive-sense RNA virus that belongs to the Retroviridae family, genus Deltaretro, and infects approximately five to 10 million people worldwide. Although a significant number of individuals living with HTLV-1 remain asymptomatic throughout their lives, some develop one or more severe clinical conditions, such as HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP), a progressive and debilitating disease, and/or a subtype of non-Hodgkin's lymphoma with a more threatening course known as adult T-cell leukemia/lymphoma (ATLL). Moreover, current therapeutic options are limited and focus primarily on treating symptoms and controlling viral latency. CRISPR-Cas9 gene editing is proposed as a promising tool to address the intricate links associated with HTLV-1. By targeting or silencing key genes during initial infection and dysregulating immune signaling pathways, CRISPR-Cas9 offers potential intervention opportunities. In this review, we address the therapeutic potential of CRISPR-Cas9 gene editing, as well as examine the primary mechanisms involved in editing potential target genes and discuss the existing evidence in the current scientific literature.

Isolation of dsRNA from Plants by Cellulose Chromatography.

As the constitutive molecules of double-stranded RNA (dsRNA) virus genomes and replicative intermediates of single-stranded RNA (ssRNA) viruses, the high-molecular-weight dsRNAs are commonly found in RNA virus-infected plants. Therefore, the dsRNA is recognized as a hallmark of RNA virus infection and the profile of dsRNA has been applied as an efficient tool for diagnoses or characterization of unreported RNA viruses. Cellulose chromatography is one of the most useful procedures for the isolation of viral dsRNAs from total nucleic acids. Here, we describe rapid cellulose-based methods for purification of dsRNAs from plant tissue.

Molecular detection and genotyping of bovine viral diarrhea virus in Selangor, Malaysia.

Bovine viral diarrhea (BVD) disease is a viral infection in cows caused by a single-stranded plus-sense RNA virus of the Pestivirus genus under the Flaviviridae family. The clinical manifestation of BVD mainly includes diarrhea and immunosuppression, thereby exacerbating various respiratory diseases. This study was conducted to detect and molecularly characterize the bovine viral diarrhea disease virus (BVDV) in cattle on selected farms in Selangor, Malaysia. A reverse transcription polymerase chain reaction (RT-PCR) was performed for antigen detection in 253 plasma samples collected from cows using a cross-sectional study design. We selected the 5 untranslated regions (5'-UTR) region and the E2 region to compare the genetic differences between the isolates. One sample was found to be positive (1/253) following RT-PCR targeting the conserved 5'-UTR region of BVDV. Thus, BVDV antigen prevalence was 0.40% (95% confidence interval: 0.0%-2.2%). By targeting the hypervariable E2 region of the isolated virus, UPM/MAL/BVDV/D17, the virus was classified under the subgenotype BVDV-1a. BVDV is present and circulating on selected cattle farms in Selangor, Malaysia. Given the presence of BVDV in several subgenotypes, the screening of all incoming cattle at Malaysia's border is pertinent to prevent the entry of other BVDV subgenotypes into the country.

Construction of Gene Expression Patterns to Identify Critical Genes Under SARS-CoV-2 Infection Conditions.

Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) is a positive-stranded single-stranded RNA virus with an envelope frequently altered by unstable genetic material, making it extremely difficult for vaccines, drugs, and diagnostics to work. Understanding SARS-CoV-2 infection mechanisms requires studying gene expression changes. Deep learning methods are often considered for large-scale gene expression profiling data. Data feature-oriented analysis, however, neglects the biological process nature of gene expression, making it difficult to describe gene expression behaviors accurately. In this article, we propose a novel scheme for modeling gene expression during SARS-CoV-2 infection as networks (gene expression modes, GEM), to characterize their expression behaviors. On this basis, we investigated the relationships among GEMs to determine SARS-CoV-2's core radiation mode. Our final experiments identified key COVID-19 genes by gene function enrichment, protein interaction, and module mining. Experimental results show that ATG10, ATG14, MAP1LC3B, OPTN, WDR45, and WIPI1 genes contribute to SARS-CoV-2 virus spread by affecting autophagy.