Single Nematode Research Articles

Live <i>C. elegans</i> Diffraction at a Single Point

Using coherent light, we analyze the temporal diffraction at a single point from real-time living C. elegans locomotion in three-dimensional space. We describe the frequency spectrum of single swimming nematodes in an optical cuvette at a single sampling point in the far-field diffraction pattern. An analytical expression of the double slit is used to model the frequency spectra of nematodes as oscillating segments. The frequency spectrum in the diffraction pattern expands discretely and linearly as a multiple of the fundamental frequency with increasing distance from the central maximum. The frequency spectrum of a worm at a single point in the frequency spectrum contains all the frequencies involved in the locomotion and is used to characterize and compare nematodes. The occurrence of resonant frequencies in the dynamic diffraction pattern increases with the distance from the central maximum. The regular spacing of the resonant frequencies is used to identify characteristic swimming frequencies.

A Rapid Diagnostic for Detection of Aphelenchoides besseyi and A. fujianensis Based on Real-Time PCR.

Aphelenchoides besseyi and A. fujianensis have been frequently found in mixed populations associated with forage grass seed in Brazil. The morphological similarity between both species has previously led A. fujianensis to be erroneously identified as A. besseyi. A. besseyi is a quarantine pest in many countries that import Brazilian forage seed; however, there is no current evidence suggesting that A. fujianensis is a plant-parasitic species. Two real-time polymerase chain reaction (qPCR) diagnostics were developed to detect each species and an operational envelope was established. A set of primers and hydrolysis probes for each species was designed targeting the large subunit (LSU) region. To assess their specificity, primers and probes sets were tested with samples of nontarget Aphelenchoides and Paraphelenchus sp. also frequently associated with forage seed. Experiments using dilutions of purified plasmid standards underpinned the sensitivity of the qPCR assays, which detected as few as 10 copies of target nematode ribosomal DNA. Thus, the developed diagnostics were sufficiently sensitive to detect DNA extracted from a fragment of a single target nematode. There was a positive correlation between copy number of the target species and nematode abundance, suggesting the potential of this method for quantification. Evidence of intra-individual variability among cloned sequences of the LSU region in a single A. besseyi population is also reported.

First Report of a New Stunt Nematode Tylenchorhynchus sp. From a Soybean Field in North Dakota

Stunt nematodes in the genus Tylenchorhynchus are common plant-parasitic nematodes, and several species have been reported to damage crops (Handoo et al. 2014). In 2015 and 2016, 11 soil samples were collected from a soybean (Glycine max) field in Richland County, ND. Nematodes were extracted from soil using the sugar centrifugal flotation method (Jenkins 1964). Nine samples contained the stunt nematodes, ranging from 125 to 900 per kg of soil. One soil sample with 600 stunt nematodes per kg was planted with a soybean cultivar Sheyenne in three replicates. After 3 months of growth at 22°C under greenhouse conditions, the stunt nematode population increased to a final density of 1,953 ± 674 individuals per kg of soil. The reproductive factor of this nematode was 3.26. Soybean roots were washed with tap water and brown lesions were observed on the roots. Morphological measurements of adult females (n = 14) included body length (mean = 744.3 μm, range = 622.0 to 830.0), stylet (21.3 μm, 20.0 to 22.5), body width (25.1 μm, 23.0 to 27.5), head end to posterior end of esophageal glands (134.0 μm, 117.0 to 155.0), anal body width (16.2 μm, 15.0 to 17.5), tail length (47.0 μm, 38.0 to 52.0), tail annules (19.9 μm, 16.0 to 25.0), a (29.6, 25.7 to 34.0), b (5.5, 5.0 to 5.8), c (15.8, 13.5 to 18.1), c′ (2.9, 2.6 to 3.3), and V (52.4%, 50.3 to 55.2). Morphological data of adult males (n = 6) included body length (711.7 μm, 630.0 to 775.0), stylet (20.8 μm, 20.0 to 22.5), body width (24.1 μm, 22.5 to 26.0), head end to posterior end of esophageal glands (130.3 μm, 123.0 to 135.0), anal body width (15.0 μm, 13.0 to 18.0), tail length (42.0 μm, 38.0 to 45.0), a (30.0, 28.1 to 32.9), b (5.5, 5.1 to 5.7), c (16.9, 16.4 to 17.6), c′ (2.8, 2.4 to 3.4), spicule (24.3 μm, 22.5 to 25.0), and gubernaculum (12.9 μm, 11.0 to 15.0). DNA was extracted from single nematodes (n = 6). D2-D3 expansion domain of 28S rRNA (Yan et al. 2013) and ITS region of rDNA (Subbotin et al. 2005) were amplified and sequenced. The consensus ITS sequence (accession no. KY200668, 861 bp) deposited into GenBank had the highest identity of 92% with a Tylenchorhynchus sp. (KJ461594.1) which was then named as T. thermophilus (Handoo et al. 2014), and showed 86% identity with T. annulatus. The D2-D3 sequence (KY200667, 715 bp) exhibited the highest identity of 98% with a Tylenchorhynchus sp. (KJ461562.1), which was T. thermophilus based on the paper (Handoo et al. 2014), and showed 96% identity with T. annulatus. However, the tail of the unknown species differs from that of T. thermophilus, and the 71 nucleotide difference in the ITS sequence does not suggest that it is T. thermophilus, although all other morphometric and morphological details fit. The tail resembles that of T. crassicaudatus but is not as clavate. No sequence information of T. crassicaudatus is available in GenBank. The tail of the unknown and the nature of the inner two lines of the lateral field with oblique striae resemble T. annulatus, but the sequence data do not support T. annulatus. To our knowledge, this stunt nematode population from the soybean field in North Dakota represents a new Tylenchorhynchus sp. Our greenhouse bioassay demonstrated that this new species was capable of infecting soybean plants. The impact of this nematode on soybean growth and yield and resistance levels of soybean cultivars need to be assessed.

Neuromodulatory Control of Long-Term Behavioral Patterns and Individuality across Development

Animals generate complex patterns of behavior across development that may be shared or unique to individuals. Here, we examine the contributions of developmental programs and individual variation to behavior by monitoring single Caenorhabditis elegans nematodes over their complete developmental trajectories and quantifying their behavior at high spatiotemporal resolution. These measurements reveal reproducible trajectories of spontaneous foraging behaviors that are stereotyped within and between developmental stages. Dopamine, serotonin, the neuropeptide receptor NPR-1, and the TGF-β peptide DAF-7 each have stage-specific effects on behavioral trajectories, implying the existence of a modular temporal program controlled by neuromodulators. In addition, a fraction of individuals within isogenic populations raised in controlled environments have consistent, non-genetic behavioral biases that persist across development. Several neuromodulatory systems increase or decrease the degree of non-genetic individuality to shape sustained patterns of behavior across the population.

Flexible and disposable paper- and plastic-based gel micropads for nematode handling, imaging, and chemical testing.

Today, the area of point-of-care diagnostics is synonymous with paper microfluidics where cheap, disposable, and on-the-spot detection toolkits are being developed for a variety of chemical tests. In this work, we present a novel application of microfluidic paper-based analytical devices (μPADs) to study the behavior of a small model nematode, Caenorhabditis elegans. We describe schemes of μPAD fabrication on paper and plastic substrates where membranes are created in agarose and Pluronic gel. Methods are demonstrated for loading, visualizing, and transferring single and multiple nematodes. Using an anthelmintic drug, levamisole, we show that chemical testing on C. elegans is easily performed because of the open device structure. A custom program is written to automatically recognize individual worms on the μPADs and extract locomotion parameters in real-time. The combination of μPADs and the nematode tracking program provides a relatively low-cost, simple-to-fabricate imaging and screening assay (compared to standard agarose plates or polymeric microfluidic devices) for non-microfluidic, nematode laboratories.

Significant heterogeneity in Wolbachia copy number within and between populations of Onchocerca volvulus

BackgroundWolbachia are intracellular bacteria found in arthropods and several filarial nematode species. The filarial Wolbachia have been proposed to be involved in the immunopathology associated with onchocerciasis. Higher Wolbachia-to-nematode ratios have been reported in the savannah-ecotype compared to the forest-ecotype, and have been interpreted as consistent with a correlation between Wolbachia density and disease severity. However, factors such as geographic stratification and ivermectin drug exposure can lead to significant genetic heterogeneity in the nematode host populations, so we investigated whether Wolbachia copy number variation is also associated with these underlying factors.MethodsGenomic DNA was prepared from single adult nematodes representing forest and savannah ecotypes sampled from Togo, Ghana, Côte d’Ivoire and Mali. A qPCR assay was developed to measure the number of Wolbachia genome(s) per nematode genome. Next-generation sequencing (NGS) was also used to measure relative Wolbachia copy number, and independently verify the qPCR assay.ResultsSignificant variation was observed within the forest (range: 0.02 to 452.99; median: 10.58) and savannah (range: 0.01 to 1106.25; median: 9.10) ecotypes, however, no significant difference between ecotypes (P = 0.645) was observed; rather, strongly significant Wolbachia variation was observed within and between the nine study communities analysed (P = 0.021), independent of ecotype. Analysis of ivermectin-treated and untreated nematodes by qPCR showed no correlation (P = 0.869); however, an additional analysis of a subset of the nematodes by qPCR and NGS revealed a correlation between response to ivermectin treatment and Wolbachia copy number (P = 0.020).ConclusionsThis study demonstrates that extensive within and between population variation exists in the Wolbachia content of individual adult O. volvulus. The origin and functional significance of such variation (up to ~ 100,000-fold between worms; ~10 to 100-fold between communities) in the context of the proposed mutualistic relationship between the worms and the bacteria, and between the presence of Wolbachia and clinical outcome of infection, remains unclear. These data do not support a correlation between Wolbachia copy number and forest or savannah ecotype, and may have implications for the development of anti-Wolbachia drugs as a macrofilaricidal treatment of onchocerciasis. The biological significance of a correlation between variation in Wolbachia copy number and ivermectin response remains unexplained.

First Report of the Spiral Nematode Helicotylenchus microlobus Infecting Soybean in North Dakota

Spiral nematodes (Helicotylenchus spp.) are common plant-parasitic nematodes in fields of many crops. In June 2015, two soil samples were collected from a soybean field in Richland County, ND. Nematodes were extracted from soil using the sugar centrifugal flotation method (Jenkins, 1964). Plant-parasitic nematodes were identified to genus based on morphological features and counted. Both samples contained spiral nematodes from 1,500 to 3,300 per kilogram of soil. In June and August 2016, 10 soil samples were collected from the same field. Nematodes were extracted, and nine of the samples had spiral nematodes ranging from 125 to 3,065 per kilogram of soil. One soil sample with 1,500 spiral nematodes per kilogram was used to inoculate two soybean cultivars Sheyenne and Barnes each in four replicates. After 15 wk of growth at 22°C in a greenhouse room, the population of spiral nematodes was found to have increased greatly. The final density was 9,300 ± 1,701 spiral nematodes per kilogram of soil for Sheyenne and 9,451 ± 2,751 for Barnes. The reproductive factor in Sheyenne and Barnes was 6.2 and 6.3, respectively, indicating that this spiral nematode infects and reproduces well on these two soybean cultivars. Infected soybean roots had small brown lesions on the surface. Individual spiral nematodes were handpicked and examined morphologically and molecularly for species identification. Morphological measurements of adult females (n = 15) included body length (mean = 708.5 μm, range = 600.0-812.0 μm), stylet (27.6, 26.0-29.0), body width (28.3, 25.0-33.0), lip region end to posterior end of pharyngeal glands (142.5, 130.0-152.0), anal body width (15.8, 14.0-17.5), tail length (20.3, 15.0-25.0), tail annules (11.6, 10.0-14.0), a (25.0, 21.4-27.1), b (5.0, 4.4-5.7), c (35.4, 30.2-41.7), c' (1.3, 1.0-1.6), and V (61.8%, 60.0-63.7). The spiral nematode was identified as Helicotylenchus microlobus according to morphological and morphometric characteristics (Subbotin et al., 2015). DNA was extracted from single nematodes (n = 8) using the Proteinase K method (Kumari and Subbotin, 2012). The internal transcribed spacer (ITS) region of rDNA was amplified with the primers rDNA2/rDNA1.58S (Cherry et al., 1997). The PCR products were then purified and sequenced. The consensus ITS rDNA sequence (accession no. KY271078, 822 bp) that was deposited into the GenBank shared 99% identity with two isolates of H. microlobus from California (KM506860.1 and KM506859.1) and one isolate of H. microlobus from Spain (KM506862.1) (Subbotin et al., 2015). It had only 91% sequence identity with seven isolates of H. pseudorobustus (KM506875.1, KM506880.1, KM506876.1, KM506874.1, KM506872.1, KM506879.1, and KM506878.1) from California, Switzerland, and New Zealand, a spiral nematode species very closely related to H. microlobus in morphology. The molecular tests confirmed the identity of this spiral nematode as H. microlobus. The H. microlobus nematode was reported as one of the most commonly observed spiral nematodes in soil samples in the state of Minnesota, and all 13 soybean cultivars tested except Hawkeye were rated as hosts (Taylor, 1960). To our knowledge, this is the first report of H. microlobus in North Dakota.

Study on the Prevalence of GIT Nematodes on Bovine in and aroundKombolcha and Dessie Town, North Eastern, Ethiopia

A cross sectional study was carried out from November 2014 to April 2015 to determine the prevalence of bovine gastrointestinal tract (GIT) nematodes and associated risk factors by using flotation technique and fecal culture in and around Kombolcha and Dessie town. Out of 384 bovines examined for GIT nematodes, 160 (41.7%) animals were found positive for single or mixed GI nematode infection. The findings of fecal examination revealed eggs of Strongyle, Ascaris and Trichuris type were identified. Cattle harboring single-parasite eggs (83.75%) were more common than those harboring mixed eggs (16.25%) type. The major nematode genera identified by fecal culture were Oesophagostomum (11.5%), Bunostomum (7.0%), Trichuris (5.5%), Stronglyloides (2.6%), Haemonchus (2.9%), Trichostrongylus (2.6%), Toxocara (1.6%) and Ostertagia (1.3%). The prevalence of gastrointestinal nematode infection showed a significant difference (p<0.05) between sex, age, breed, body conditions, management and origin of the animals. In conclusion, the present study has revealed the presence of GIT nematodes which have significant impact on the health and production of the cattle’s in the study area. Therefore, further studies on species identification and seasonal epidemiology of these parasites should be carried out.

Specific Detection of the Root-Lesion Nematode Pratylenchus scribneri Using Conventional and Real-Time PCR.

Pratylenchus scribneri is a plant-parasitic root-lesion nematode causing economic damage to various crops worldwide. Identifying root-lesion nematodes to species using traditional morphological methods is an arduous task requiring extensive training on nematode taxonomy and years of experience. Thus, molecular methods for P. scribneri detection and identification were developed. Conventional and real-time polymerase chain reaction (PCR) assays with new species-specific primers were used in this study, which exclusively amplified DNA of P. scribneri but not DNA from other Pratylenchus spp. or non-Pratylenchus spp. tested. Compared with conventional PCR that was able to detect an equivalent to 1/4 of the DNA of a single nematode, real-time PCR was more sensitive and could amplify an equivalent to 1/128 of the DNA of one nematode. Both conventional and real-time PCR assays successfully identified P. scribneri and distinguished it from P. penetrans and P. neglectus isolated from field samples collected from various locations in North Dakota and Minnesota. The Blast-search based on the sequence information confirmed the reliability of the PCR assays for species identification. This is the first report of P. scribneri identification using a real-time PCR assay. The developed PCR assays are suitable for use in diagnostic laboratories and detection of field infestations with this nematode species.

First Report of the Root-lesion Nematode Pratylenchus neglectus on Wheat (Triticum aestivum) in North Dakota

Root-lesion nematodes (Pratylenchus spp.) are important nematode pests that invade roots of plants and restrict productivity of wheat (Smiley et al. 2005). In August 2015, a soil sample was collected from a harvested wheat field in Walsh County, ND, and was found to contain 1,044 root-lesion nematodes per kg of soil using the sugar centrifugal flotation method. In October 2015, four soil samples were collected from the same field and had root-lesion nematodes ranging from 125 to 1,000/kg soil. One soil sample with 500 lesion nematodes/kg soil was used to inoculate hard red spring wheat cvs. Glenn and Faller. After 10 weeks of growth in a greenhouse room maintained at 22°C, wheat roots were harvested and washed, and light brown lesions were observed on lateral roots. The washed roots were cut into 1-cm segments for nematode extraction using the Whitehead tray method. After 48 h, lesion nematodes were recovered from the root tissues. Averages of 24 and 20 root-lesion nematodes per gram were found in the roots of Glenn and Faller, respectively. Nematodes from soil and wheat roots were examined morphologically and molecularly for species identification. Morphological measurements of adult females (n = 10) included body length (range = 402.0 to 495.0 μm, mean = 446.0 μm), stylet (15.0 to 17.5, 16.4), tail length (16.0 to 22.0, 18.8), body width (17.0 to 22.0, 19.6), anterior end to basal bulb (90.0 to 115.0, 101.6), a = (21.2 to 24.7, 23.1), b = (3.7 to 4.8, 4.4), c = (19.6 to 27.1, 23.8), and V (81.0 to 85.0%, 82.8%). The lip region had two annules, and was not set off, with anterior margins of apical lip annule convex, second annule was slightly wider than the first; lateral field had four lines with central zone of lateral field having oblique striae; tail terminus was smooth, rounded, or slightly oblique. The nematode species was identified as Pratylenchus neglectus (Rensch, 1924) Filipjev & Schuurmans Stekhoven, 1941 based on morphological and morphometric characteristics (Castillo and Vovlas 2007). DNA was extracted from single nematodes (n = 11) isolated from soil and wheat roots, and ITS region of rDNA was amplified (Tanha Maafi et al. 2003). PCR products from three nematodes were cloned using pGEM-T easy vector and sequenced, and the resulting ITS sequences were identical. The consensus sequence (GenBank Accession No. KU705392, 684 bp) was 99% homologous with one population of P. neglectus from China (JX046941) and 83% or less identical to other Pratylenchus spp. including P. thornei, a species closely related to P. neglectus. The specific primers from D3 28S rRNA and ITS rDNA were used to amplify DNA of eight nematodes and produced single bands specific for P. neglectus (Yan et al. 2008, 2013). The combination of the molecular tests confirmed the target species as P. neglectus. Two species of root-lesion nematodes, P. neglectus and P. thornei, were reported as damaging pathogens affecting wheat production in the Pacific Northwest (Smiley et al. 2005). To our knowledge, this is the first report of P. neglectus on wheat in North Dakota. The resistance levels of various wheat cultivars to this lesion nematode are being identified.

Interactions between the oomycete Pythium arrhenomanes and the rice root-knot nematode Meloidogyne graminicola in aerobic Asian rice varieties.

BackgroundAerobic rice fields are frequently infested by pathogenic oomycetes (Pythium spp.) and the rice root-knot nematode Meloidogyne graminicola. Here, the interaction between Pythium arrhenomanes and Meloidogyne graminicola was studied in rice roots of two aerobic rice varieties. In different experimental set-ups and infection regimes, plant growth, rice yield, Pythium colonization, as well as establishment, development and reproduction of M. graminicola were studied.ResultsIn this study, it is shown that the presence of P. arrhenomanes delays the establishment, development and reproduction of M. graminicola compared to single nematode infected plants. The delay in establishment and development of M. graminicola becomes stronger with higher P. arrhenomanes infection pressure.ConclusionsOur data indicate that P. arrhenomanes antagonizes M. graminicola in the rice root and that the plant benefits from this antagonism as shown by the yield data, especially when either of the pathogens is present in high levels.Electronic supplementary materialThe online version of this article (doi:10.1186/s12284-016-0108-3) contains supplementary material, which is available to authorized users.

A modified crude DNA preparation for direct PCR reaction of single plant-parasitic nematodes

A modified crude DNA preparation for direct PCR reaction of single plant-parasitic nematodes

A microfluidic device for efficient chemical testing using Caenorhabditis elegans.

The nematode worm Caenorhabditis elegans has been employed as a popular model organism in many fields of biological research. In this paper, we present a microfluidic device for facilitating chemical testing using C. elegans. For testing chemicals on chip, the device houses single nematodes in microfluidic chambers and precisely adjusts the chamber's chemical environment during experiments. Eight nematodes can be readily loaded into the chambers through separate loading channels in a quick and gentle manner. In addition, a custom-made software with a graphic user interface is also created for quantitative analysis of locomotion parameters (swimming frequency and bend amplitude) of the nematodes in response to chemical stimuli, thus greatly enhancing the efficiency of data collection. We perform proof-of-concept experiments using two chemicals, zinc ion (Zn(2+)) and glucose, to demonstrate the effectiveness of the microfluidic device.

First Report of Trichodorus obtusus on Turfgrass in North Carolina, U.S.A.

In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5' GCTTGTCTCAAAGATTAAGCC 3'), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina.

Population diversity of Pasteuria penetrans from pepper fields and its genetic variation from single root-knot nematodes

Pasteuria penetrans is an obligate parasite of root-knot nematodes. Pepper (Piper nigrum) is one of the main economic crops in Hainan Island, China, and the incidence of root-knot diseases is high. The Pasteuria samples from 20 pepper fields of seven counties in Hainan Island were identified, and the results suggested that there were various P. penetrans populations in the same field but no obvious specificity among different regions. However, five strains appeared to be potentially novel species of the genus Pasteuria by 16S rRNA gene sequence analysis. Additionally, further study showed that a single nematode of Meloidogyne incognita and of M. javanica could be infected by different strains of P. penetrans, and the genetic diversities of P. penetrans between two different host species were found only in gyrB rather than 16S rRNA and sigE gene sequences. These findings will provide some theoretical underpinning for the research of obligate parasitism mechanism between root-knot nematodes and P. penetrans.

Tomato (Solanum lycopersicum) and root-knot nematodes (Meloidogyne spp.) – a century-old battle

The encounter betweenMeloidogynespecies and tomato is many centuries old.Meloidogynespecies are known to cause high levels of economic loss worldwide in a multitude of agricultural crops, including tomato. This review was initiated to provide an overview of the damage potential ofMeloidogynespp. on cultivars of tomato (Solanum lycopersicum), and to compile the different studies done on the management ofMeloidogynespp. on tomato with particular emphasis on theMiresistance gene. Numerous studies have been conducted to assess the damage potential of root-knot nematode on various tomato cultivars; its yield loss potential ranges from 25 to 100%. A range of management options from using synthetic nematicides to soilless cultures have been tried and are available for managingMeloidogynespp. Resistant commercial cultivars and rootstocks carrying theMigene have been used successfully to manageMeloidogyne incognita,M. javanicaandM. arenaria. However, virulent populations have been detected. Relying on a single root-knot nematode management strategy is an outdated concept and different management options should be used in an integrated management context by considering the whole system of disease management. In future management ofMeloidogynespecies, care must be taken in directly extrapolating the tolerance limit determined elsewhere, since it is affected by many factors such as the type of initial inoculum and physiological races ofMeloidogynespp., environmental conditions, types of cultivars and experimental approaches used.

Regulation of the mycotoxin deoxynivalenol by Folsomia candida (Collembola) and Aphelenchoides saprophilus (Nematoda) in an on-farm experiment

• Highest numbers of Aphelenchoides saprophilus were found in presence of deoxynivalenol (DON) contaminated straw. • Population density of Folsomia candida was generally higher after 4 weeks. • Highest reduction of DON concentration was found in single species treatments. • Activity of nematodes and collembolans promotes the decontamination of DON in soil. A field experiment based on a minicontainer-system was conducted on decontamination as an ecosystem service provided by soil fauna ( Folsomia candida , Collembola and Aphelenchoides saprophilus , Nematoda). The objective was to investigate if the introduced soil fauna is able to reduce the concentration of the mycotoxin deoxynivalenol (DON) in wheat straw. The minicontainers were filled with soil and either DON-contaminated or non-contaminated wheat straw. Soil fauna was introduced in different combination into the minicontainers (single-collembolan, single-nematode, mixed and a non-faunal control treatment) and placed into the topsoil (0 – 5 cm) of an arable field. Each treatment was replicated five times. After 2 and 4 weeks, soil fauna was counted and DON content was detected in soil and straw. Population density of A. saprophilus developed mostly when received DON-contaminated wheat straw. Individual numbers of F. candida was highest in the mixed, non-infected treatment after 4 weeks. DON concentration in remaining straw of the contaminated minicontainers was reduced in the single collembolan treatment and in the single nematode treatment after 2 weeks. In contrast, there was an increase of DON in the non-faunal control treatment and the mixed treatment. After 4 weeks DON concentration decreased throughout all treatments compared to the initial concentration. In soil, a DON concentration was measured throughout all treatments after 2 weeks, which was reduced significantly after 4 weeks. We conclude that nematodes and collembolans significantly contribute to the degradation of the mycotoxin DON in wheat straw and protect soil from DON contamination as an ecosystem service.

Temporal dynamics of helminth infections in eastern grey kangaroos (Macropus giganteus) in Victoria

Parasite infection is increasingly recognised as a factor shaping the population dynamics, life history and behaviour of hosts. However, before the impacts of parasites on wildlife hosts can be investigated, seasonal patterns in host exposure to parasitic agents must be determined. We examined infection patterns at three sites in Victoria, and combined field experiments and observations to construct a generalised life cycle of the helminth community in eastern grey kangaroos (Macropus giganteus). Kangaroo populations in Victoria had very similar helminth communities, with 20–25 species detected at each site. Despite examining relatively few hosts in this study, at least 87% of all gastrointestinal helminths were recovered according to bootstrap estimates. The prepatent period of infection in eastern grey kangaroo nematodes was at least 3 months, and faecal egg output showed a distinct seasonal pattern, with a peak in egg counts from October through to January each year. Data from one site indicated that faecal egg counts were influenced predominantly by the abundance of a single nematode species (Pharyngostrongylus kappa), despite adults accounting for only 7% of the total nematode burden. This highlights the problems associated with using faecal egg counts to estimate nematode burdens in this host. Contamination of pasture plots showed that nematode eggs take ~14 days to larvate once deposited, and that autumn rains likely triggered emergence from faecal pellets. The abundance of infective larvae in the environment therefore appears to be closely tied to environmental conditions, with a peak in infection of hosts in the winter months.

Field evaluation of the efficacy and safety of a combination of spinosad and milbemycin oxime in the treatment and prevention of naturally acquired flea infestations and treatment of intestinal nematode infections in dogs in Europe

Two separate randomised, blinded, multicentre field trials were conducted to evaluate the efficacy and safety of a combination of spinosad and milbemycin oxime (MO) (Trifexis®, Elanco Animal Health) in the treatment and prevention of naturally acquired flea infestations and intestinal nematode infections in European dogs. Treatments using Trifexis® and each control veterinary product (CVP) were administered once on Day 0 in both field studies.In the flea field trial, 11 veterinary clinics in France participated in the study. On Day 0, whole body flea comb counts were conducted on all dogs being evaluated for enrolment. Dogs with ≥7 fleas on Day 0 were enrolled, treated once on Day 0 with spinosad/MO or the CVP (Stronghold®; selamectin) and then underwent post-treatment flea counts on Days 14 and 30. There were 150 spinosad/MO treated dogs and 71 CVP treated dogs included in the flea effectiveness population. Effectiveness against fleas (% reduction in geometric means; GM) was 98.97% and 97.37% for the spinosad/MO treated dogs, and 97.43% and 93.96% for the CVP dogs on Days 14 and 30, respectively, compared to the pre-treatment baseline flea counts. Of the spinosad/MO dogs, 89.3% and 80.0% had no live fleas on Days 14 and 30, compared to 77.5% and 70.4% of the CVP dogs, respectively.In the nematode field trial, data from 10 veterinary clinics in France and 19 in Ireland were pooled. Faecal samples from dogs at each clinic were analysed. A positive result at screening (parasite eggs from Toxocara canis, Toxascaris leonina, Trichuris vulpis or Ancylostoma caninum) allowed for enrolment. Dogs were randomised to spinosad/MO or the CVP (Milbemax®; MO/praziquantel). On Day 8, a post-treatment faecal sample was taken and analysed. Of 2333 dogs screened for nematode eggs, 238 dogs were positive with one or more of these nematodes, and 229 were enrolled in the study. Of the 229 dogs, 151 were treated with a single dose of spinosad/MO, and 77 were treated with a single dose of CVP. Post-treatment effectiveness against all nematodes (% reduction GM) was achieved with reductions of 98.57% and 97.57% for the spinosad/MO treated dogs and CVP dogs, respectively, as compared to the pre-treatment baseline faecal egg counts.Trifexis® was shown to be safe and effective against natural infestations of fleas as well as mixed and single intestinal nematode infections in client owned dogs in Europe when administered as a single oral administration at the recommended dose.

Morphological and karyotypic differences within and among populations of Radopholussimilis.

Twenty populations of Radopholus similis from three countries and different hosts (19 populations from ornamental plants and one population from ginger) were compared using morphological characters, morphometrics and karyotype between progeny from both single females and 30 females of each population. Morphological diversity existed in and among the populations, even within the progeny nematodes from single nematodes compared to that of 30 females. The labial disc shape, the number of head annuli, the terminated position of lateral lips, the number of genital papillae before cloacal apertures and female and male tail terminal shape showed variation. In addition, genital papillae arranged in a double row before cloacal apertures was first found in two ornamental populations. The karyotype of all the 20 populations was n = 5. Combining our results and previous studies, we support that Radopholus citrophilus is a synonym of Radopholus similis, and that it is not possible to distinguish physiological races or pathotypes of Radopholus similis according to morphological characters or karyotype.