Single Conidial Isolates Research Articles

First report of Ilyonectria liriodendri causing black foot on walnut in Chile.

Walnut (Juglans regia L.) is the primary nut tree cultivated in Chile, covering 44.626 ha. In autumn 2021, walnut decline and tree mortality were observed in young and old orchards (two and 18-years-old, respectively) in the O´Higgins Region in the Chilean Central Valley. In the surveyed walnut orchards cv. Chandler (n = 2), the incidence of symptomatic plants ranged from 35 to more than 90 %. Affected trees showed poor growth, twig and branch death, early defoliation, and shoot dieback. In addition, collar base necrosis and root rot were observed in symptomatic trees, resembling the symptoms of black foot disease, with blackening of complete roots and even the entire root system. Symptomatic root tissues from 5 independent trees were cut into pieces of about 25 mm2. The samples were sterilized for three minutes in a sodium hypochlorite solution (1%), rinsed in sterile distilled water, and plated onto Potato Dextrose Agar (PDA) medium supplemented with lactic acid (10%) and 0.5 g/L of streptomycin sulfate. Mycelium grew from the samples after seven days of incubation at 24°C. The characteristics of the culture and morphology of conidiophores and conidia indicated a Cylindrocarpon-like fungus. Then, 5 single-conidial isolates were obtained and subsequently grown on a PDA medium. Genomic DNA was extracted from cultures of three representative isolates (CNCO5; CNCO6; CNSF2) and used for amplification and sequencing of the Internal Transcribed Spacer of rDNA (ITS), β-tubulin (TUB2), Histone3 (HIS3), and Translation Elongation Factor 1-alpha (TEF1-α) partial gene regions using the primers ITS1/ITS4 (White et al. 1990), T1/Bt2b (O'Donnell and Cigelnik 1997; Glass and Donaldson 1995), CYLH3F/CYLH3R (Crous et al. 2004), and EF1-728F/EF1-986R (Carbone and Kohn 1999), respectively. Isolates clustered consistently with Ilyonectria liriodendri after a multilocus molecular phylogenetic analysis. Sequences were deposited in at NCBI Genbank data base (ITS: OR871536-OR871537-OR871538, TUB2: PP780828-PP780829-PP780830, HIS3: PP780822-PP780823-PP780824, and TEF1-α: PP780825-PP780826-PP780827). A pathogenicity test was conducted by inoculating three walnut Vlach rootstocks (six months old) with one representative I. liriodendri isolate (CNCO6). Plant roots were cut 5 cm from the root tip and immersed in a 105/mL conidial suspension for 30 min; control plants were immersed in sterile distilled water. Then, the plants were transplanted to a sterile substrate. After six weeks of growing in a greenhouse, necrosis characterized by brown-black coloration of the roots was observed developing upwards from the wounded roots. Necrotic lesions were found even in secondary roots of infected plants; however, control plants remained asymptomatic. The fungus was re-isolated, completing Koch's postulates. Black foot disease caused by Ilyonectria spp. has been reported worldwide on grapevines (Ye et al., 2021) and causing root rot of other fruit trees such as olive (Úrbez-Torres et al., 2012) and kiwifruit (Erper et al., 2011). Ilyonectria liriodendri was recently identified as the cause of walnuts root rot in California (Lawrence et al. 2019). To our knowledge, this is the first detection of I. liriodendri causing black foot of walnut in Chile and worldwide. The symptoms of this disease closely resemble those of Phytophthora spp. in walnuts. This similarity could lead to misdiagnosis, highlighting the necessity for specific diagnostic tools to accurately identify the pathogen.

Genomic regions associated with spot blotch resistance in elite barley breeding populations

Spot blotch (SB), a prevalent foliar disease of barley, is caused by the hemibiotrophic fungal pathogen Bipolaris sorokiniana. Predominately occurring in humid growing regions worldwide, SB can result in yield losses of up to 30%. Genetic resistance remains the most effective strategy for disease management; however, most Australian barley cultivars exhibit susceptibility despite the previous identification of major resistance loci. This study investigates the genetic architecture underlying spot blotch resistance within an Australian barley breeding program. Resistance was assessed at both the seedling and adult growth stages using a single conidial isolate (SB61) across two consecutive years. A total of 337 barley lines were genotyped with 16,824 polymorphic DArT-seq™ markers. Two mapping approaches were employed: a single-marker genome-wide association study (GWAS) and a haplotype-based local genomic estimated breeding values (Local GEBV) approach. Both methodologies identified two major resistance-associated regions on chromosomes 3H and 7H, effective across growth stages. Additionally, the haplotype-based Local GEBV approach revealed resistance-associated regions on 1H, 3H, and 6H that were not detected by GWAS. Haplotype stacking analysis underscored the critical role of the 7H region for adult-plant resistance when combined with other resistance haplotypes, suggesting significant gene-by-gene interactions and highlighting the complex, quantitative nature of spot blotch resistance. This research confirms the presence of key resistance loci within Australian barley breeding populations, provides novel insight into the genetic architecture of spot blotch resistance, and emphasises the potential to enhance resistance through haplotype stacking and whole-genome prediction approaches.

Cross-species transmission of a novel bisegmented orfanplasmovirus in the phytopathogenic fungus Exserohilum rostratum

Mycoviruses have been found in various fungal species across different taxonomic groups, while no viruses have been reported yet in the fungus Exserohilum rostratum. In this study, a novel orfanplasmovirus, namely Exserohilum rostratum orfanplasmovirus 1 (ErOrfV1), was identified in the Exserohilum rostratum strain JZ1 from maize leaf. The complete genome of ErOrfV1 consists of two positive single-stranded RNA segments, encoding an RNA-dependent RNA polymerase and a hypothetical protein with unknown function, respectively. Phylogenetic analysis revealed that ErOrfV1 clusters with other orfanplasmoviruses, forming a distinct phyletic clade. A new family, Orfanplasmoviridae, is proposed to encompass this newly discovered ErOrfV1 and its associated orfanplasmoviruses. ErOrfV1 exhibits effective vertical transmission through conidia, as evidenced by its 100% presence in over 200 single conidium isolates. Moreover, it can be horizontally transmitted to Exserohilum turcicum. Additionally, the infection of ErOrfV1 is cryptic in E. turcicum because there were no significant differences in mycelial growth rate and colony morphology between ErOrfV1-infected and ErOrfV1-free strains. This study represents the inaugural report of a mycovirus in E. rostratum, as well as the first documentation of the biological and transmission characteristics of orfanplasmovirus. These discoveries significantly contribute to our understanding of orfanplasmovirus.

Association of Single Nucleotide Polymorphisms (SNPS) to Black Spot Resistance in Roses

Rose black spot caused by Diplocarpon rosae is the most severe and global disease of garden roses. Breeding of disease resistant varieties is one of the most important goals of modern garden rose breeding. Single nucleotide polymorphisms (SNPs) are the most abundant type of polymorphism found in eukaryotic genomes. SNP markers can be used in a wide variety of applications, including association studies, genetic diversity analysis, and marker-assisted selection in plant breeding programs. The aim of this project was to analyze black spot resistance in a rose association panel through leaf inoculation assays with single isolate pathotypes as well as a field mixture of D. rosae isolates and to establish a relationship between resistance and the available SNP markers. In this study, 96 diverse cultivars of roses were evaluated phenotypically for resistance against black spot through artificial inoculations. 63000 SNPs that were developed in previous studies were used to genetically analyze the cultivars and find associations with resistance against black spot disease using mixed linear model in TASSEL 3.0. Differences in the phenotypic reaction to field mixture of isolates and the Ab13 single conidial isolate of this pathogen were observed between genotypes. One hundred and forty-nine SNPs were found to be significantly associated with resistance against field mixtures of black spot. For the Ab13 single isolate, only one significant SNP was found. These SNPs were mapped on the rose chromosomes, and found on chromosome one, three and four. These associated SNP and Rdr1 markers can be used for marker-assisted selection in breeding for black spot resistance in rose.

Evaluation of Maize Hybrids for Resistance to Ear Rot Caused by Dominant Fusarium Species in Northeast China

Ear rot caused by the Fusarium species has led to a decline in maize yield and kernel quality worldwide. The changes in the population structure of pathogens and the widespread planting of susceptible maize varieties have exacerbated the occurrence and harm of ear rot in China. Therefore, it is very important to establish the species composition of Fusarium and evaluate the resistance of the main cultivated hybrids. In this study, 366 single conidial isolates of Fusarium spp. were obtained from three provinces of Northeast China. F. verticillioides, F. subglutinans, F. proliferatum, F. oxysporum, and F. graminearum species complex (FGSC) were identified, with F. verticillioides being the most prevalent with a frequency of 44.0%. Based on the TEF-1α gene sequences analysis, the FGSC populations consisted of two independent species: F. boothii and F. graminearum, which account for 23.8% and 5.7% of the total isolates, respectively. Additionally, the resistance to ear rot by 97 maize hybrids commonly planted in Northeast China was evaluated by inoculation with F. verticillioides during 2021 and 2022. The results showed that the disease parameters of different hybrids varied significantly (p < 0.05). Approximately half of the hybrids had damage rates ranging from 0 to 15%, and 79.4% of the hybrids had a severity rating of less than 5.5. In total, 49 (50.5%) hybrids were rated as moderately resistant, which was the dominant resistance category, and 71 hybrids (73.2%) were identified as moderately to highly resistant to ear rot. Current research confirms that Fusarium ear rot in maize is mainly caused by F. verticillioides in Northeast China, and many hybrids are resistant to the disease. This study will guide growers to scientifically deploy resistant commercial hybrids to control ear rot.

Occurrence of Black Mold on Sweet Pepper Fruits Caused by Alternaria alternata in Korea

In July 2022 and 2023, black mold symptoms were observed sporadically on fruits of sweet pepper (<i>Capsicum annuum</i>) plants grown in a greenhouse located in Suwon, Korea. The incidence of black mold on the fruits was 5−24% (average 14.8%) in variety SP-504 (yellow and elongate type) and 1−8% (average 5%) in variety SP-505 (red and round type) investigated. Four single-conidium isolates of <i>Alternaria</i> sp. obtained from the diseased fruits were identified as <i>Alternaria alternata</i> based on the morphological characteristics and molecular phyogenetic analyses. The isolates were tested for pathogenicity to sweet pepper fruits of varieties SP-504 and SP-505 through artificial inoculation. The isolates mostly induced large lesions on fruits of the two varieties in the wound inoculation, but only two isolates small lesions on fruits of the variety SP-504 in the non-wound inoculation. No lesions formed on fruits of the variety SP-505 in the non-wound inoculation. The pathogenicity tests revealed that susceptibility of sweet pepper fruits to the disease differs between the varieties. The symptoms induced by pathogenicity tests with the isolates were similar to those observed on fruits from the greenhouse investigated. This is the first report of <i>A. alternata</i> causing black mold on sweet pepper fruits in Korea.

First Report of Leaf Spot Caused by Botrytis cinerea on Strawberry in China.

In the winter of 2022, circular or irregular leaf spots were observed on strawberry (Fragaria × ananassa) planted in commercial fields (cultivar 'xuetu', 'mengzhifu') in Yinzhou, Ningbo, Zhejiang, China (N29°48'48″, E121°39'47″), with disease incidence ranging from 10 to 15% in a field approximately 0.67 ha in size. The estimated crop loss associated with this disease was ~10%. Symptoms included circular or irregular lesions with brown halos and wheel marks, which eventually developed into leaf blight and petiole decay, but spore masses were seldom found on the leaf surface. In severe cases, leaves withered and abscissed. To isolate the causal agent, ten diseased leaves from ten different plants were collected, surface-sterilized with 75% ethanol for 50 s, rinsed twice with sterile distilled water, cut into small pieces (0.5 cm × 0.5 cm), and plated on potato dextrose agar (PDA), then incubated at 25°C in darkness for 5 days. Isolates , which displayed one kind of colony morphology were consistently obtained from each of the ten samples, and 58 single-conidium isolates with the same colony morphology were obtained. The isolation frequency was 58 of 60 samples. The colonies that grew on PDA produced white mycelia, which sporulated after 1 week, producing typical Botrytis-like gray spores. Three isolates (NBCM-1, NBCM-2, NBCM-3) were selected for identification and pathogenicity assays. Conidia were round to ellipsoid, 9.2 to 14.3 μm long (n=50), and 6.4 to 9.2 μm wide (n=50). Sclerotia were not observed on PDA. Based on these characteristics, the pathogen was tentatively identified as Botrytis cinerea (Zhang 2001). PCR was conducted for each of the three isolates to amplify the G3PDH, HSP60, RPB2, NEP1, and NEP2 genes, which are typically used for molecular identification of Botrytis species (Staats et al. 2005; Liu et al. 2016). The resulting amplicons were sequenced, and the sequences were processed using BLAST in the National Center for Biotechnology Information. Sequences of the three isolates were deposited in GenBank (accession nos. OR052082 to OR052086, OR493405 to OR493414). BLASTn analyses showed that isolates were 99 to 100% identical to B.cinerea reported causing leaf spot on strawberry in California; accession numbers MK919496 (G3PDH, 883/883 bp), MK919494 (HSP60, 992/992 bp), and MK919495 (RPB2, 1081/1081 bp). The resulting concatenated data set of G3PDH-HSP60-RPB2-NEP1-NEP2 was used to conduct a multilocus phylogenetic analysis (MLSA) using the maximum likelihood method. The MLSA tree indicated that the three isolates belonged to Botrytis cinerea. To test for pathogenicity, three 1-month-old strawberry (cultivar 'xuetu') plants were inoculated with each isolate (NBCM-1, NBCM-2, NBCM-3). A noninoculated control (sterile water only) was also included. The strawberry plants were inoculated by spraying with conidia suspension (1.0 × 105/ml) until run-off. Inoculations with sterile water served as controls. All plants were kept at 28/25°C (day/night), under a 12:12-h light/dark photoperiod. All plants were covered with transparent plastic bags to maintain humidity for the first 48 h, after which the bags were removed. After 4 to 7 days, leaf spot symptoms similar to those observed in the field were observed in all inoculated plants, while the controls remained healthy. The experiment was repeated three times. The pathogen was reisolated from the inoculated leaves and again identified as B. cinerea, with the same methodology used for the initial identification. Leaf spot caused by B. cinerea on strawberry was recently reportedin California (Mansouripour and Holmes 2020) and Florida (Marin and Peres 2022). To our knowledge, this is the first report of B. cinerea causing leaf spot on strawberry in China. The pathogen is also the causal agent of Botrytis fruit rot on strawberry. Given the high variability of this pathogen (Marin and Peres 2022), further studies on its occurrence, spread, management, and control are required. The identification of this pathogen provides a basis for further research on its management and control.

First Report of Fusarium solani and Fusarium oxysporum Causing Basal Stem Rot on Celery in China.

Celery (Apium graveolens L.) is an economically important vegetable crop in China. In recent years, celery has been widely planted in Yuzhong county, Gansu province. From 11 April to 24 May, 2019-2021, basal stem rot of celery was observed with incidences up to 15% in the Yuzhong region (35°49'N, 104°16'E, 1865 m a.s.l.), which caused serious economic losses to local farmers. Typical symptoms of the disease included wilting and darkening of the basal stem, leading to plant death. To identify the cause of the disease, small pieces (5mm×5mm) of the margin of asymptomatic and rotting basal stem tissues were sterilized with 70% ethanol for 30 s and 3% NaClO for 5 min, then placed on potato dextrose agar (PDA) plates, and incubated at 25℃ (Zhao et al. 2021). Twenty-seven single-conidium isolates with morphological characteristics similar to Fusarium spp. were obtained (Ma et al. 2022), which displayed two kinds of colony morphology. On PDA, seven isolates developed white, fluffy aerial mycelium and twenty isolates developed light pink abundant aerial mycelium. Isolate F5 and F55 from each distinct morphological group were cultured on PDA and synthetic low nutrient agar (SNA) for pathogenicity tests, morphological and molecular identification. The macroconidia (18.3 to 29.6 × 3.6 to 5.3 μm, n=50) with 1 to 2 septa and microconidia (7.5 to 11.6 × 2.6 to 3.5 μm, n=50) with 0 to 1 septum were observed in F5. For F55, the size of macroconidia was 14.2 to 19.5 × 3.3 to 4.2 μm (n = 50) with 1 to 2 septa; Microconidia were mostly 0 to 1 septum and measured 7.3 to 12.8 × 2.2 to 4.2 μm (n = 50). To confirm the identity of the isolates, the internal transcribed spacer region (ITS) and the translation elongation factor-1 alpha (TEF-1α) gene were amplified using primers ITS1/ITS4 and EF-1/EF-2 (Uwaremwe et al. 2020), respectively. The sequence similarities of isolate F5 (GenBank No. OL616048 and OP186480) and F55 (GenBank No. OL616049 and OP186481) with the corresponding sequences of F. solani (MT447508 and MN650097) and F. oxysporum (MG461555 and OQ632904) ranged from 99.22% to 100.00%, with matching base pairs of 531/532, 416/416, 511/515 and 394/395, respectively. The voucher samples were deposited in the sample center of Northwest Institute of Ecological Environment and Resources, Chinese Academy of Sciences. Morphological and molecular results confirmed the species of F5 and F55 as F. solani and F. oxysporum, respectively. A pathogenicity test was conducted under greenhouse conditions (19-31°C, avg. 26°C). Conidial suspension (105 spores/mL) of isolates F5 and F55 were poured onto the basal stems of healthy celery seedlings at the age of 1 month and mock-inoculated control treatments with sterile water. Ten plants were inoculated for each treatment. After 21 days, all plants inoculated with both fungal isolates developed symptoms similar to those observed in the field, whereas the mock-inoculated plants remained healthy. The pathogen was successfully reisolated from the inoculated symptomatic plants onto PDA medium and had morphology as described above, confirming Koch's postulates. F. solani and F. oxysporum have been reported to infect many plant species, including carrot (Zhang et al. 2014) and Angelica sinensis (Liu et al. 2022). To our knowledge, this is the first report that F. solani and F. oxysporum cause basal stem rot on celery in China. The identification of pathogens of the observed basal stem rot on celery provides a clear target for the prevention and management of this disease.

First report of Colletotrichum shisoi causing anthracnose of Perilla frutescens in the United States.

Perilla mint (Perilla frutescens (L.) Britt.) is an annual plant native to Asia and considered invasive in North America where it has escaped cultivation as an ornamental (Miller 1947; Swearingen et al. 2010). In August 2021, an anthracnose disease was observed on invasive perilla found along the disturbed margins of a forest in Frederick County, Maryland, United States. Symptoms included necrotic lesions with chlorotic halos, were concentrated in the lower canopy, and caused premature defoliation of lower leaves (Figure S1). Leaves from four plants were surface sterilized by rinsing for 30 s in 70% ethanol, 60 s in 0.8% NaClO, and 60 s in sterile water and then incubated on 2% water agar under ambient laboratory conditions to permit sporulation. After three days, spores that exuded from individual lesions were streaked onto acidified potato dextrose agar. Two single-conidium isolates were recovered from each plant. All eight isolates were identified to species using DNA sequences. A single isolate (21-067) was selected at random for morphological characterization and completion of Koch's postulates. Morphological features were recorded after seven days of growth on synthetic low-nutrient agar (SNA) and potato dextrose agar (PDA) incubated at 22°C under 12 hr UV-B and white fluorescent lighting. Measurements were based on a minimum of 20 observations per structure. Cultures on SNA were flat, hyaline to pale salmon, lacked sporodochia and grew at a rate of 1.3 mm day-1 (n = 3). Vegetative hyphal width was (minimum-maximum) 1.5-4.0 μm, (average ± standard deviation) 2.7 ± 0.9 μm. Conidiophores arose directly from hyphae, were hyaline, smooth, unbranched and measured 40.0-180.0 x 1.5-4.5 μm, 102.3 ± 33.9 x 2.7 ± 0.8 μm. Conidia were single celled, straight, hyaline, glabrous, rounded at both ends and measured 10.0-20.0 x 3.8-6.3 μm, 15.4 ± 2.5 x 4.9 ± 0.7 μm. Setae, observed only on PDA, were pale brown, 1-2 septate, straight, blunt tipped and measured 42.5-97.5 μm, 70.8 ± 13.4 μm. Appressoria formed on PDA were single-celled, pigmented, smooth, and obovoid with entire margins, measuring 5.2-7.7 x 8.6-13.8 μm, 6.8 ± 0.6 x 10.8 ± 1.4 μm. These characteristics were consistent with members of the Colletotrichum destructivum species complex. Partial DNA sequences from five loci were amplified following the procedures of Damm et al. 2014: internal transcribed spacer region of rDNA (ITS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), chitin synthase 1 (CHS-1), actin (ACT), and beta-tubulin (TUB2). Pairwise sequence comparisons to references using the Blastn algorithm found 99.8% similarity between isolate 21-067 and ex-type C. shisoi isolate JCM 31818: MH660930 (ITS, 545/546 bp), MH660931 (GAPDH,192/192 bp), MH660929 (CHS-1, 278/280 bp), MH660928 (ACT, 262/262 bp), and MH660932 (TUB2, 511/511 bp) (Altschul et al. 1990; Gan et al. 2019). Subsequently, sequences from all eight isolates were aligned with Clustal Omega (Sievers and Higgins 2018), concatenated, and used in a Bayesian phylogenetic reconstruction (Huelsenbeck and Ronquist 2001) of the C. destructivum species complex (Figure S2), confirming the species identity as C. shisoi. Sequences were deposited in NCBI GenBank under accession numbers OM865277-OM865284 and OM885059-OM885090. Koch's postulates were fulfilled using perilla grown in a greenhouse until second true leaves emerged. Inoculum washed from two-week-old fungal cultures grown on potato dextrose agar was adjusted to 4 x 104 conidia mL-1 and applied to three replicate plants with an aspirator until runoff. Three plants were sprayed with sterile water as a negative control. Plants were covered with plastic bags for 72 hrs and maintained in a growth chamber at 20°C and 80% RH for 14 days. Inoculated plants displayed disease symptoms similar to those observed under field conditions, and control plants did not develop symptoms. Colletotrichum shisoi was reisolated from symptomatic tissue and reidentified based on morphology. The experiment was completed twice. To the authors' knowledge, this is the first report of C. shisoi on P. frutescens in the United States. Colletotrichum shisoi has not been reported as a pathogen on other plants in the United States and may have potential use as a biological control agent for invasive perilla.

Culm blight on Phyllostachys aureosulcata 'Spectabilis' caused by Apiospora locuta-pollinis in China.

Phyllostachys aureosulcata McClure 'Spectabilis' C.D. Chu. et C.S. Chao is predominantly native to subtropical to warm temperate areas and is widely cultivated for landscaping in China (Neményi et al. 2015). In November 2020 (10 - 16 ℃), culm blight symptoms were observed on P. aureosulcata 'Spectabilis' in Wangjiang Tower Park (all kinds of plant areas are about 9.8 ha), Chengdu City (104°09'30.42″ E, 30°63'18.89″ N). Fifty plants were surveyed, and disease incidence was recorded as approximately 30%. Initially, chlorotic necrotic patches appeared on the culms, and gradually the patches became white, expanded to both ends, and encircled the whole culm with black edge and conidiomata, which eventually led to wilt and death. Five samples from different bamboos were collected and one of them were used for morphological observation. Five single conidia isolates were carried out on potato dextrose agar (PDA) at 25±1℃ (Chomnunti et al. 2014). Colonies were initially white and then yellowish in the center with abundant aerial mycelia. On the culm, conidiomata were dry, black, and filamentous. Conidiophores were reduced to conidiogenous cells. Conidiogenous cells were smooth, hyaline, ampulliform to doliiform. Conidia were ellipsoid to globose, dark brown, smooth and aseptate, measuring 5.2 to 9.4 × 4.4 to 7.3 μm, (=8.2 × 6.5μm, n=50). On the PDA medium, conidia were globose to subglobose, olive green to pale brown, and smooth, larger than those from the host in size, measuring 9.0 to 18 × 7.5 to 9.5 μm ( =36.6 × 18.8 μm, n=50). These asexual structures were extremely similar to Apiospora locuta-pollinis (F. Liu & L. Cai) X.G. Tian & Tibpromma (Zhao et al. 2018). DNA was extracted from the representative strain (SICAUCC 22-0036), and the internal transcribed spacer (ITS), translation elongation factor 1-alpha (tef1-α), beta-tubulin (tub2), 28S large subunit rDNA (LSU) were amplified and sequenced with primers ITS1/ITS4 (White et al. 1990), EF1-728F (Carbone & Kohn 1999)/EF2 (O'Donnell et al. 1998), T1 (O'Donnell & Cigelnik 1997)/Bt2b (Glass & Donaldson 1995) and LR0R/LR5 (Rehner & Samuels 1994). The newly generated sequences were deposited in GenBank with accession nos. ON228609 (ITS), ON324018 (tef1-α), ON237657 (tub2), and ON228665 (LSU). Nucleotide blast showed 98.97%, 100% and 99.46% identities with A. locuta-pollinis (LC11683, ex-holotype) (accession nos. MF939595, MF939622, MF939616), and LSU data missing. Phylogenetic analyses using maximum likelihood showed a 92% bootstrap support value in a clade with A. locuta-pollinis (Fig 2). Eight healthy plants (2-year-old) were used for the pathogenicity test. Culms of four healthy bamboos were wounded via sterile double-edged blade and sprayed with conidial suspension (105 conidia/ml) prepared from 4-week-old cultures that were incubated on PDA at 25℃. The other four bamboos were sprayed with sterile distilled water as controls. Inoculated plants were placed in a growth chamber (25℃, 90% relative humidity, 12-h photoperiod). About 60 days later, necrotic patches similar to those observed in the field were found on the inoculated culms, and no symptoms were observed on the controls. The pathogen was reisolated from the diseased culms with identical morphology as previously described. To our knowledge, this is the first report of culm blight on P. aureosulcata 'Spectabilis' caused by A. locuta-pollinis. The risk of this pathogen needs further evaluation, and effective control measures should be taken.

First report of Corn Ear Rot Caused by Fusarium asiaticum in China.

Corn (Zea maysL.) ear rot, caused by various pathogens, is one of the most significant diseasesofcorn worldwide. In September 2020, a survey was undertaken to identify pathogenic fungi associated with corn ear rot in Suihua city (46.63°N 126.98°E), Heilongjiang Province, China. The average disease incidence was 14.2% and 15.6% in each of two fields sampled (~5 ha) usingafive-pointmethod (100 plants/each point). Twenty tissue samples from 20 diseased ears, showing white or pink mold on the surface of corn ears, were surface disinfected in 0.5% NaOCl for 5 min, rinsed 3 times in autoclaved distilled water. After drying, four treated corn kernels (one kernel/each ear) were placed onto potato dextrose agar (PDA) amended with 50 µg/mL streptomycin. The plates were sealed with parafilm sealing film and cultured in the dark at 26℃ with 80% RH for 3 days inanincubator. A total of 12 morphologically similar fungal isolates were obtained and subcultured by transferring hyphal tips for 3-5 days. Single-conidium isolates were generated with methods reported previously (Leslie and Summerell 2006). Colonies on PDA, reaching 20.3-20.9 mm·d-1 at 26℃, consisted of white to pale yellow, locculent, lush and dense aerial mycelium with red to apricot color. Macroconidia of six isolates randomly selected on carnation leaf agar (CLA) were falciform with a foot cell, three- to six-septate, measuring 12.6-67.2 × 2.6-5.4 µm (n = 100) in the dark at 26℃ with 80% RH for 5 days. No microconidia were observed. Based on these characteristics, the isolates were preliminarily identified asFusarium asiaticum (Chang et al. 2020; Leslie and Summerell 2006). Genomic DNA of three representative isolates YSF2, YSF4 and YSF7 were extracted and the translation elongation factor 1-α (TEF-1ɑ) gene was amplified and sequenced using the primers EF1-728F/EF1-986R (Carbone and Kohn 1999). The DNA sequences of YSF2, YSF4 and YSF7 were deposited in GenBank (OL631287.1, OP272129 and OP272130). Analysis of TEF-1ɑ sequences of YSF2, YSF4 and YSF7 showed that they were 100% identical to F. asiaticumisolates NRRL 26156 (AF212452.1) in NCBI and NRRL 13818 (AF212451.1) in Fusarium MLST. A pathogenicity test was performed on corn cv. Xinxin 1. Four days after silk emergence, 3 mL conidial suspension (106 macroconidia/ml) of each 12 isolates was individually injected into the center of the ear through the husk sideways, penetrating the kernels to a depth of about 5 mm (6 ears/each isolate) in the field (Guo et al. 2020). Six corn ears treated with sterile distilled water were used as the control. After inoculation, normal field management was carried out. All inoculated ears showed symptoms similar to those observed in the field 50 days after inoculation, while no symptoms were observed on the blank control ears. Five fungal isolates with the same colony morphology as the naturally occurring ear rot in the field were re-isolated from the inoculated corn kernels and confirmed to be F. asiaticum according to morphological characteristics and sequence analysis of five fungal isolates. F. asiaticum has previously been reported to cause corn ear rots in Japan (Kawakami et al. 2015). To our knowledge, this is the first report of F. asiaticum causing corn ear rot in Northeast China. Corn ear rot poses a threat to significantly reduce the quality of corn in a major production zone of maize in China. Therefore, its distribution needs to be investigated and effective disease management strategies developed.

Occurrence of Geranium wilfordii anthracnose caused by Colletotrichum dematium in China.

GeraniumwilfordiiMaxim. is aweed of perennial herbs and considerable medicinal plant for treating acute and chronic rheumatalgia in China. In August 2019, leaf spots on G.wilfordii were observed in Harbin (45°60'N, 126°64'E), Heilongjiang Province, China. The disease occurred on 15 to 30% of G.wilfordii leaves in three nurseries (~1.5 ha/each nursery).Initial symptoms were brown necrotic spots with a gray-white center, which enlarged gradually from approximately 1 to 5 mm in diameter, and produced concentric rings and became necrotic. Twelve infected tissues from twelve diseased leaves were surface disinfested in 0.5% NaOCl for 5 min, rinsed three times in sterile distilled water, dried on sterilized filter paper and cultured on potato dextrose agar (PDA) amended with 50 µg/ml streptomycin at 26°C for 5 days. Eight fungal cultures with consistent characteristics were obtained and subcultured by transferring hyphal tips onto fresh PDA. Single-conidium isolates were generated with methods reported previously (Leslie and Summerell 2006). Colonies on PDA consisted of cottony, dense, grayish white mycelium, pale gray colony. Conidia of a representative isolate LGC2 were single-celled, hyaline, cylindrical to slightly curved with a rounded apex and truncated base that measured 16.2 to 22.5 μm (length) × 2.6 to 3.7 μm (width) (n = 50). The appressoria were elliptic to claviform or slightly lobed on synthetic nutrient-poor agar. Based on these characteristics, the eight isolates were identified as Colletotrichum dematium (Damm et al. 2009).Genomic DNA was extracted from representative isolates LGC2, LGC3, LGC5 and the internal transcribed spacer regions (ITS)，beta-tubulin (TUB2) and actin (ACT) were amplified and sequenced using the primers ITS1/ITS4 (Yin et al. 2012), T1/Bt2b (Glass and Donaldson 1995) and ACT-512F/ACT-783R (Carbone and Kohn 1999), respectively. DNA sequences of isolates LGC2, LGC3, and LGC5 were identical and deposited onto the GenBank (accession nos. MW193053.1 for ITS, MZ357349.1 for TUB2, and OL956946.1 for ACT). MegaBLAST analysis showed 100%, 99.7% and 100% identical to C. dematiumisolates CBS 125.25 (accession nos. NR_111453.1 for ITS 552/553 bp, GU228113.1 for TUB2 386/387 bp, and GU227917.1 for ACT 231/231 bp respectively. A pathogenicity test was performed on with a representative isolate LGC2 by spraying spore suspension (1 × 106 conidia/ml) on the surfaces of all leaves of ten healthy three-month-old G.wilfordii plants. All leaves of ten control plants were inoculated with sterile water to serve as the control. All plants were placed in a humidity chamber (>95% RH, 26℃) for 48 h after inoculation and then transfered in a greenhouse at 22/28°C with a 12:12h light-dark cycle for 10 days. All inoculated leaves showed symptoms similar to those observed in the fields, while no symptoms were observed on the control leaves. The experiment was conducted twice. The fungus was re-isolated from the infected leaves and confirmed to be C. dematium according to morphological and molecular characteristics. C. dematium has previously been reported on common knotgrass (Liu et al. 2016), on piper betle (Sun et al. 2020), peanut anthracnose in China (Yu et al. 2020). To our knowledge, this is the first report of C. dematium causing G.wilfordiianthracnose in China. G.wilfordiianthracnose caused by C. dematium poses a threat to significantly reduce the quality of G.wilfordii. Therefore, its distribution needs to be investigated and effective disease management strategies developed.

Hybridization between Pyrenophora teres Forms in Natural Populations of Russia and the Republic of Belarus

Two forms of the pathogenic fungus Pyrenophora teres, P. teres f. teres (a net form) and P. teres f. maculata (a spot form), cause different disease signs, net or spot blotch, on barley leaves. The net form of P. teres is widespread wherever barley is cultivated, while the spot form was first identified in Krasnodar krai of Russia in 2011 and Brest oblast of Belarus in 2016. The two forms of the pathogen easily mate each other in laboratory conditions, but their hybrids either do not form or are difficult to detect in nature. The question as to whether hybrids between the net and spot forms are produced and maintained in natural populations is pressing and bears applied significance because different genes determine resistance to the different P. teres forms in barley. Hybrid forms may be virulent to resistance donors used in breeding. The objective of this work was to search Russian and Belarussian natural populations for hybrids between P. teres f. teres and P. teres f. maculata with the use of new form-specific markers, Ptt and Ptm. The study included 138 single-conidium isolates from four P. teres f. maculatа and four P. teres f. teres populations. The isolates were collected from commercial barley plantations of Leningrad oblast, Krasnodar krai (Russia), and Brest oblast (Belarus) from 2013 to 2016. A genotyping with 10 form-specific markers was performed in all isolates. Several isolates were found to combine markers of both of the P.teres forms and were conventionally identified as hybrids between the forms. Hypotheses were advanced to explain the occurrence of hybrids in natural populations. The most plausible hypothesis suggests that sexual or somatic hybridization between the two forms coexisting in barley plantations accounts for the origin of the P. teres isolates that combine markers specific to P. teres f. teres and markers specific to P. teres f. maculata in their genomes. It is also possible that a third, possibly ancestral, intermediate form was preserved during divergence in the species P. teres.

Anthracnose: A New Leaf Disease on Radermachera sinica (China Doll) in China.

Radermachera sinica (China doll) is a popular evergreen horticultural crop worldwide. However, little information has been provided to describe the anthracnose disease of R. sinica. In 2018, symptoms suspected of leaf anthracnose were observed on R. sinica in gardens and commercial greenhouses in Guangzhou, China. Lesions on diseased leaves showed thinned and grayish white centers, dark-brown to black borders, and raised black spots. Twenty-seven single-conidia isolates were obtained from symptomatic leaf lesions. Based on morphological characteristics and multilocus phylogenetic analysis, 19 isolates were identified as Colletotrichum siamense and six and two isolates were identified as C. fructicola and C. karstii, respectively. An invivo pathogenicity test was conducted on leaves of R. sinica plants, and it was discovered that C. siamense was more aggressive under wounded conditions than under unwounded conditions, and caused symptomatic necrotic lesions on the leaf. Afterward, the same pathogen was reisolated from lesions of inoculated leaves to fulfill Koch's postulates. However, neither C. fructicola nor C. karstii caused visible lesions on leaves of R. sinica under wounded or unwounded conditions, indicating that they may be asymptomatic endophytes or opportunistic pathogens on R. sinica. To our knowledge, this study is the first report of Colletotrichum spp. associated with anthracnose disease on R. sinica in China.

Leaf Blight on Photinia × fraseri Caused by Pestalotiopsis trachicarpicola in China.

Photinia × fraseri is a well-known green plant mainly distributed in the Yangtze River and Yellow River Basin, east and southwest of China (Guan et al. 2013). In October 2020, typical leaf blight symptoms on roughly 10% leaves in a Photinia × fraseri shrub were observed in the campus of Sichuan Agricultural University (30°42'19″ N, 103°51'29″ E). Initially, chlorotic lesions with brown margins occurred on the leaf margin, then the large patches formed to cause leaves necrotic, finally lesions to dry and acervulus bred in 2-4 months later. Five single conidium isolates were carried out (Chomnunti et al. 2014) cultured on potato dextrose agar (PDA) at 25 ℃. All isolates shared similarly morphological characteristics, which was white and thin, and the reverse were yellowish. Mycelium was hyaline, sparsely septate, measuring 1-4 μm in diam. Conidiogenesis formed after 7 days. Conidiogenous cells were discrete, lageniform, smooth, thin-walled, colorless. Conidia were fusiform, straight to slightly curved, 4-septate, 21-30 × 5-7 μm (x ̅= 27 × 6.0 μm, n=30); basal cells were obconic with truncate base, hyaline, thin- and smooth-walled, 4-7 μm long (x ̅= 5.5 μm, n=30); three median cells were doliiform with thick walls, concolorous, olivaceous, constricted at the septa, and septa and periclinal walls were darker than the rest of the cell, 14-20 μm long (x ̅= 17 μm, n=30); apical cells were hyaline, conic to cylindrical, 3.0-6.5 μm long (x ̅= 4.5 μm, n=30), with 2-4 (mostly 3) tubular apical appendages arising from the upper portion, rarely branched, 7.5-18 μm long (x ̅= 12 μm, n=50); basal appendage was single, unbranched, 3-10 μm long (x ̅= 6.5 μm, n=30). DNA was extracted from the representative strain (SICAUCC 21-0012), and the internal transcribed spacer (ITS) region, the large subunit of the nrDNA (LSU), translation elongation factor 1-alpha (tef1-α), and partial sequences of β-tubulin (tub2) were amplified by polymerase chain reaction and sequenced with primers ITS5/ITS4, LR0R/LR5, 728F/1567R, and Bt2a/Bt2b, respectively (Zhang et al. 2012, Ariyawansa & Hyde 2018). The sequences were deposited in GenBank, viz. MZ453106, MZ453108, MZ467300, MZ467301, respectively. The nucleotide blast showed 99% (ITS, 0 gaps), 100% (tub2, 0 gaps), 100% (tef1-α, 0 gaps) identities with the ex-type Pestalotiopsis trachicarpicola Yan M. Zhang & K. D. Hyde (IFRDCC 2440). The fungus was identified as P. trachicarpicola combined with phylogeny and morphology (Maharachchikumbura et al. 2012, Zhang et al. 2012). To conduct Koch's postulates, five healthy 6-year-old P. × fraseri were inoculated with 10 µl spore suspension (106 conidia/ml) onto the wounded sites (five leaves per plant, ~1 to 2 years old) via sterile pin, and five healthy plants treated with sterile dH2O as controls (Yang et al. 2021). The plants were placed in a greenhouse at 25°C with relative humidity >80%. After 2 months, leaf blight symptoms gradually emerged on inoculated leaves, and the controls were symptomless. Fungal isolates from symptomatic plants showed similar morphological characteristics as SICAUCC 21-0012, and the pathogen was not isolated from asymptomatic plants. To our knowledge, this is the first report of leaf blight caused by P. trachicarpicola on Photinia × fraseri in China. Disease management should be adopted properly to restore and improve its ornamental value.

First report of Fusarium concentricum causing wilt on Podocarpus macrophyllus in China.

Podocarpus macrophyllus (Thunb.) D. Don is used in many fields, including landscape, medicine, and forest interplanting. In July 2019, shoot blight was observed on P. macrophyllus at three nurseries in Harbin, China. Approximately 15% of plants had symptoms of the disease, which included rapid, synchronized death of leaves on individual branches. Eventually the whole plant wilted. Leaves and stems turned dark blue to brown. Ten infected vascular tissue samples from 10 individual plants were surface-disinfested in 0.5% NaOCl for 5 min, rinsed 3 times in sterile distilled water, and cultured on potato dextrose agar (PDA) amended with 50 µg/ml streptomycin at 26°C. Six similar fungal isolates from ten samples were isolated and subcultured. Single-conidium isolates were generated with methods reported previously (Leslie and Summerell 2006). Colonies on PDA consisted of densely floccose aerial hyphae with light yellow and pinkish pigments. Microconidia were oval to obovoid or allantoid, 3.8 to 11.8 μm in length and 2.8 to 4.6 μm in width, mostly non-septate on carnationleafagar (CLA). Macroconidia were naviculate-to-fusiform slender, 24.9 to 57.2 μm in length and 2.8 to 4.5 μm in width with 3- to 5- septate, with a beaked apical cell and a foot-shaped basal cell. According to these morphological characteristics, all isolates were identified as Fusarium spp. (Aoki et al. 2001 ). Genomic DNA was extracted from a representative isolate LHS1. Theinternal transcribed spacer regions (ITS), translation elongation factor 1-alpha gene (TEF-1ɑ)andβ-tubulin (TUB2) gene were amplified using the primers ITS1 and ITS4 (Yin et al. 2012)，EF1-728F/EF1-986R (Carbone and Kohn 1999)and T1/Bt2b (Glass and Donaldson 1995), respectively. DNA sequences of LHS1 were deposited in GenBank (accession nos. MT914496 for ITS, MT920920 for TEF-1ɑ and MT920921 for TUB2, respectively). MegaBLAST analysis of the ITS, TEF-1a, and TUB2 sequences indicated 100%, 97.7% and 100% similarity withFusarium concentricum isolate CBS 450.97 (accession no. MH862659.1 for ITS, MT010992.1 for TEF-1a, and MT011040.1 for TUB2, respectively). To determine pathogenicity, P. macrophyllus plants were grown in 10-cm pots containing a commercial potting mix (five plants/pot). At the 10 to 12 leaf stage, 10 healthy plants (2 pots) were inoculated by spraying 5 ml of a conidial suspension (4×106spores/ml) onto every plant. Ten plants treated with sterile distilled water served as a control. Thetestwasrepeatedtwice. All plants were placed in a humidity chamber (>95% RH, 26℃) for 48 h after inoculation and then transferred to a greenhouse at 22/28°C (night/day). All inoculated wilted with leaves and stems turning dark blue to brown 15 days after inoculation. No symptoms were observed on the control plants. The fungus was re-isolated and confirmed to be F. concentricum according to morphological characteristics and molecular identification. To our knowledge, this is the first report of F. concentricum on P. macrophyllus in world. The disease caused a large number of plants to wilt and die, seriously impacting the ability of the horticulture industry to produce P. macrophyllus. Although this pathogen causes leaf and shoot blight symptoms, it is not clear if the pathogen is also a vascular wilt disease. The occurrence of the new disease caused by F. concentricum highlights the importance of developing management strategiestoprotect P. macrophyllus.

A new tetra-segmented splipalmivirus with divided RdRP domains from Cryphonectria naterciae, a fungus found on chestnut and cork oak trees in Europe

Positive-sense (+), single-stranded (ss) RNA viruses with divided RNA-dependent RNA polymerase (RdRP) domains have been reported from diverse filamentous ascomycetes since 2020. These viruses are termed splipalmiviruses or polynarnaviruses and have been characterized largely at the sequence level, but ill-defined biologically. Cryphonectria naterciae, from which only one virus has been reported, is an ascomycetous fungus potentially plant-pathogenic to chestnut and oak trees. We molecularly characterized multiple viruses in a single Portuguese isolate (C0614) of C. naterciae, taking a metatranscriptomic and conventional double-stranded RNA approach. Among them are a novel splipalmivirus (Cryphonectria naterciae splipalmivirus 1, CnSpV1) and a novel fusagravirus (Cryphonectria naterciae fusagravirus 1, CnFGV1). This study focused on the former virus. CnSpV1 has a tetra-segmented, (+)ssRNA genome (RNA1 to RNA4). As observed for other splipalmiviruses reported in 2020 and 2021, the RdRP domain is separately encoded by RNA1 (motifs F, A and B) and RNA2 (motifs C and D). A hypothetical protein encoded by the 5′-proximal open reading frame of RNA3 shows similarity to a counterpart conserved in some splipalmiviruses. The other RNA3-encoded protein and RNA4-encoded protein show no similarity with known proteins in a blastp search. The tetra-segment nature was confirmed by the conserved terminal sequences of the four CnSpV1 segments (RNA1 to RNA4) and their 100% coexistence in over 100 single conidial isolates tested. The experimental introduction of CnSpV1 along with CnFGV1 into a virus free strain C0754 of C. naterciae vegetatively incompatible with C0614 resulted in no phenotypic alteration, suggesting asymptomatic infection. The protoplast fusion assay indicates a considerably narrow host range of CnSpV1, restricted to the species C. naterciae and C. carpinicola. This study contributes to better understanding of the molecular and biological properties of this unique group of viruses.

First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China.

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 μm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 μm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only forP. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus's pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

Physiological Races and Virulence Dynamics of Setosphaeria turcica in Northeast China.

Northern corn leaf blight (NCLB), caused by Setosphaeria turcica, is an important foliar disease in corn. Since 2005, the damage from NCLB has increased in Northeast China, probably from the emergence of new physiological races. In this study, 883 single conidial isolates of S. turcica were obtained from 12 sites across three provinces of Northeast China between 2007 and 2017. The virulence of the isolates was evaluated in five corn lines (B37, B37Ht1, B37Ht2, B37Ht3, and B37HtN). Sixteen physiological races (0, 1, 2, 3, N, 12, 13, 1N, 23, 2N, 3N, 123, 12N, 13N, 23N, and 123N) were obtained, depending on their resistance or susceptibility. Three races (0, 1, and 2) were most prevalent, with frequencies of 40.5, 19.6, and 11.3% in all isolates, respectively. Races varied across provinces and years. Virulence to more than one Ht resistance genes occurred in 21.5% of isolates, with 8.5% virulent to three or more genes. Overall, 41% of isolates were avirulent to all Ht genes, 36% were virulent to Ht1, 28% to Ht2, 11% to Ht3, and 16% to HtN. Isolates from Heilongjiang had a greater frequency of virulence to Ht2 and Ht3, whereas isolates from Jilin and Liaoning were more frequently virulent to Ht1 and HtN, respectively. The frequency of isolate virulence to Ht2 ranged from 8% in 2009 to a maximum of 29% in 2015, and in 2015, isolates were more virulent to Ht2 than Ht1. This study will help growers to purposefully select commercial hybrids with multiple effective Ht resistance genes, and reduce the utilization of Ht1 and Ht2 genes in the process of corn production to strengthen NCLB control.

Investigating the sensitivity of Venturia inaequalis isolates to difenoconazole and pyraclostrobin in apple orchards in China

The resistance level of 90 single lesion conidial isolates of Venturia inaequalis collected from multiple commercial orchards in Shaanxi and Gansu Provinces and Xinjiang Autonomous Region of China to the demethylation inhibitor (DMI) fungicide difenoconazole and quinone outside inhibitor (QoI) fungicide pyraclostrobin was examined. The EC50 values of the 90 isolates to difenoconazole and pyraclostrobin ranged from 0.143 to 6.735 μg/mL and 0.084 to 2.026 μg/mL, respectively. Among the isolates, 19 had resistance, 66 had reduced sensitivity, and five had sensitivity to difenoconazole; eight had resistance, 81 had reduced sensitivity, and one had sensitivity to pyraclostrobin. Although a weak correlation between difenoconazole and pyraclostrobin was detected, four isolates were identified as resistant to difenoconazole and pyraclostrobin. However, isolates with practical resistance were not found widely in our study and were only sporadic in a few places, indicating that at present, difenoconazole and pyraclostrobin are still safe for disease management in the apple-growing areas of Shaanxi, Gansu and Xinjiang. However, the risk of fungicide resistance should be managed with caution, and yearly monitoring of resistance development is necessary.