Sinensis Samples Research Articles

Establishment and population genetic analysis of SNP fingerprinting of Chinese soft-shelled turtle (Pelodiscus sinensis)

Chinese soft-shelled turtle (Pelodiscus sinensis) is an important aquaculture species in China. However, with the continuous development of P. sinensis cultures, problems related to germplasm degradation and population mixing have become increasingly prominent. This has seriously affected the protection and utilization of germplasm resources by P. sinensis. To broaden the understanding of the germplasm resources of P. sinensis and improve the efficiency of germplasm identification, Super-GBS sequencing technology was used to conduct population genetic analysis of P. sinensis samples from six different populations distributed in five provinces. As a result, 1464,488 SNPs were identified. Genetic structure analysis revealed that the six P. sinensis populations could be divided into three sub-populations. The genetic differentiation coefficient of the DT and CY populations was very low (Fst=0.0088), indicating that differentiation had not yet occurred. Additionally, 15 KASP core markers for the identification of P. sinensis populations were developed using KASP typing technique for the first time. Genetic information can lay a foundation for the protection and utilization of germplasm resources by P. sinensis, and the fingerprinting database developed in this study provides a practical tool for authenticating P. sinensis.

Effects of Drying Methods on Morphological Characteristics, Metabolite Content, and Antioxidant Capacity of Cordyceps sinensis.

Cordyceps sinensis is a rare and endangered medicinal herb in China and a typical medicinal and food plant. Most of the research related to Cordyceps sinensis focuses on its pharmacological effects, artificial cultivation and clinical applications. However, there are few comprehensive evaluations on the quality of Cordyceps sinensis under different drying methods. In this study, the effects of vacuum freeze-drying (DG), oven-drying (HG) and air-drying (YG) on the morphological characteristics, microstructure, antioxidant activity and metabolites of Cordyceps sinensis were investigated using wild Cordyceps sinensis as the research object. The results showed that in their appearance and morphology, the YG- and HG-method Cordyceps sinensis samples were darker in color and wilted, while the DG- method Cordyceps sinensis samples were golden yellow in color and had better fullness. In terms of microstructure, the stomata of the YG and HG method Cordyceps sinensis samples were relatively small and irregularly shaped, whereas those of the DG method Cordyceps sinensis samples were larger and neat. In terms of antioxidant capacity, the HG-method samples were the lowest, followed by the YG group, and the DG group had the highest total antioxidant capacity. A correlation analysis revealed a significant relationship between antioxidant capacity and lipids, lipid molecules, nucleosides, nucleotides, and analogs. A metabolomics analysis identified 1937 metabolites from 18 superclasses, with lipids, lipid-like molecules, organic acids and derivatives, organoheterocyclic compounds, and organic oxygen compounds being the predominant metabolites in Cordyceps sinensis. Differentially accumulated metabolites (DAMs) in DG samples showed higher levels of lipids and lipid molecules, organic oxygen compounds, organic acids and derivatives, and organoheterocyclic compounds compared to the other drying methods, suggesting DG as the optimal preservation method for Cordyceps sinensis. These findings offer insights for selecting appropriate drying methods and maintaining the post-drying quality of Cordyceps sinensis.

The tracement of origins of aquatic products by characterization of their gut or gill microbiome via MALDI-TOF MS analysis

Tracement of the origin of seafoods and aquatic products is an important issue for avoiding the falsification of production regions of aquatic products. Herein, by analyzing black tiger shrimp (Penaeusmonodon) as a model of aquatic products, we demonstrated a method to trace the origin of aquatic products by analyzing the gut microbiome of black tiger shrimp (Penaeusmonodon) collected from three commercial farms in China, via matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis. Multivariate analysis was executed on the obtained mass spectrometric datasets of bacteria extracted and collected from shrimp samples with different production regions. The gut microorganisms of black tiger shrimps can be identified by scoring the gut microbiota of black tiger shrimps collected from three producing areas. The black tiger shrimp from three production regions were found with distinguished characteristics of bacterial prevalence in their digestive gland microbiota. The dominant bacteria genus in digestive gland microbiota from black tiger shrimp samples from the three production regions are completely different. Single-blind shrimp samples with unknown production region was successfully screened by comparing the detected MS data in different ways. This strategy can trace the production region of the analyzed shrimp samples in a quick and efficient mode. The application of the present protocol was further demonstrated by analyzing the biometric species from gill tissue of Chinese mitten crab (Eriocheir sinensis) samples collected from crab-producing areas in Jiangsu Province (China), that is, Taihu Lake, Gaoyou Lake, and Hongze Lake for tracing their production area. It is expected to extend the presently developed method to provide clues for the origin traceability of other aquatic products.

Origin traceability of Cordyceps sinensis based on trace elements and stable isotope fingerprints

Cordyceps sinensis is a kind of valuable Chinese herbal medicine, and its quality and price depend on the place of origin. Building a traceability system for Cordyceps sinensis products is an effective way to protect Cordyceps sinensis geographical indication products and consumers. In this study, concentrations of 45 trace elements and stable C, N, and Pb isotopes were used to distinguish Cordyceps sinensis samples from different habitats and different varieties (natural and artificial). The results showed that there were significant differences in the isotope compositions of N and Pb and trace elements contents in the Cordyceps sinensis samples from different sources. Stepwise discriminant analysis was used to select effective traceability indicators, and three discriminant models were successfully established. A combination of Co, Sr, Cu, Tl, and Zr indexes was selected to distinguish the naturally grown samples from the artificially cultivated ones, with an overall cross-validation correctness rate of 90.0 %; while a combination of As, Cu, Rb, Tl, W, and Zr indexes was adopted to distinguish the naturally grown samples from different regions, with a corresponding 100.0 % overall cross-validation correctness rate. To simultaneously distinguish samples between natural and artificial and between different regions, a combination of As, Cu, Rb, Tl, U, W, and δ15N indexes was employed, with an overall cross-validation correctness rate of 89.3 %.

A novel and sensitive dual signaling ratiometric electrochemical aptasensor based on nanoporous gold for determination of Ochratoxin A

Ochratoxin A (OTA) is a toxic pollutant in foods, and its actual detection is crucial. A novel and sensitive dual signaling ratiometric electrochemical aptasensor based on nanoporous gold (NPG) was proposed to determine OTA. NPG, with high specific surface area and conductivity, improved the sensitivity by immobilizing more aptamers. Meanwhile, the dual signaling ratiometric strategy improved the detection reproducibility through self-referencing and built-in correction. NPG and ratiometric strategy multi-amplified the dual signal changes. The sensitivity of OTA was evaluated by the ratio of methylene to ferrocene current values. Under the optimal conditions, the NPG-based aptasensor demonstrated excellent sensitivity with a wide linear range of 1 pg/mL to 2 ng/mL and the limit of detection (LOD) of 0.4 pg/mL for OTA. This developed aptasensor also effectively detected OTA in spiked Cordyceps sinensis and grape juice samples, with recovery values falling in the 98.49–108.0% range.

Authentication of Tinospora cordifolia derived herbal supplements using high resolution mass spectrometry-based metabolomics approach – A pilot study

Tinospora cordifolia herbal supplements have recently gained prominence due to their promising immunomodulatory and anti-viral effects against SARS-CoV-2. Mislabelling or diluting Tinospora supplements for profit may harm public health. Thus, validating the label claim of these supplements in markets is critical. This study investigated how high resolution mass spectrometry-based metabolomics and chemometrics can be used to distinguish Tinospora cordifolia from two other closely related species (T. crispa and T. sinensis). The Orthogonal Partial Least Square Discriminant Analysis (OPLS-DA) and PLS-DA based chemometric models predicted the species identity of Tinospora with 94.44% accuracy. These classification models were trained using 54 T. cordifolia, 21 T. crispa, and 21 T. sinensis samples. We identified 7 biomarkers, including corydine, malabarolide, ecdysterone, and reticuline, which discriminated Tinospora cordifolia from the two other species. The label claim of 25 commercial Tinospora samples collected from different parts of India was verified based on the relative abundance of the biomarker compounds, of which 20 were found authentic. The relative abundance of biomarkers significantly varied in the 5 suspicious market samples. This pilot study demonstrates a robust metabolomic approach for authenticating Tinospora species, which can further be used in other herbal matrices for product authentication and securing quality.

The Control and Comprehensive Safety Assessment of Heavy Metal Impurities (As, Pb, and Cd) in Green Tea Camellia sinensis (L.) Samples (Infusions) Available in Poland

Tea is the world’s most common drink after water, and the world’s annual sales exceed $43 billion, of which more than $11 billion is green tea (Camellia sinensis (L.)). Increasing evidence continues to show that green tea consumption and its ingredients have a variety of potential health benefits. The aim of the study was to control and assess the toxicological risk (TRA) of three heavy metals (As, Pb, and Cd) in infusions of green tea (n = 12) from Polish markets. We applied the method of inductive coupled plasma mass spectrometry (ICP-MS) to determine the selected heavy metal and designed a specific toxicological risk assessment with three crucial tiers. The first tier of our strategy was to determine the elements investigated (heavy metal impurities, µg/L). The second step was to estimate the weekly intake of green tea infusions (µg/week) based on weekly consumption. The third tier was to estimate the weekly intake per weight (µg/L/week/bw), based on the average weekly intake of green tea infusion per adult compared to the provisional weekly intake (PTWI) established by the FAO/WHO Joint Food Additives Expert Committee (JECFA). The levels of the investigated heavy metals occur at different levels in all of the investigated green tea infusions. The heavy metal profile indicated that As (0.0721–10.585 µg/L), Pb (0.386–1.695 µg/L), and Cd (0.126–0.346 µg/L) were present in all samples. Basic analysis of general content shows that As (average = 0.325 µg/L) was at a level similar to Cd (average = 0.214 µg/L). Surprisingly, the Pb content (average 0.891 µg/L) was approximately 2.75–4 times higher than that of As and Cd, respectively. The application of our proposed safety assessment methodology (three tiers) provides satisfactory results for regulatory purposes. The evaluation of the investigated heavy metals in all products analysed from green tea samples (infusions) showed that there were no health hazards to consumers due to weekly exposure. The results indicated that after drinking green tea infusions from Polish markets, the amount of investigated elements in weekly doses does not represent any health risks to consumers.

First report of apple latent spherical virus infecting Angelica sinensis.

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

Diets of two non-native praying mantids (Tenodera sinensis and Mantis religiosa) show consumption of arthropods across all ecological roles

Introduced predators may affect native arthropod communities and alter the ecosystem services these native species provide. While mantids are known to have a broad diet in terms of consuming taxa from a number of different orders, we currently lack the high taxonomic resolution on the prey species consumed. Without knowing the identity and frequency of species in the diets of introduced mantids, it is difficult to estimate the ecological impacts of these species on local food webs and ecosystem services. To address these issues, we used DNA metabarcoding to identify prey in the diets of two introduced mantids (Tenodera sinensis and Mantis religiosa) in old fields. While both species fed on a broad diversity of taxa across 22 orders, T. sinensis mantids exhibited higher alpha diversity in diet items than M. religiosa mantids. Total beta diversity of mantid diets was moderate (0.39–0.485) across both species, although M. religiosa samples exhibited higher total beta diversity than T. sinensis samples. Herbivorous, predatory and pollinator prey species were the most important contributors to detected patterns of beta diversity. However, degree of diet overlap varied across sites and mantid species, where mantid diets at sites dominated by the same species of mantid were more similar than compared to mantid diets at sites dominated by a different mantid species.

Transcriptome-based variations effectively untangling the intraspecific relationships and selection signals in Xinyang Maojian tea population.

As one of the world's top three popular non-alcoholic beverages, tea is economically and culturally valuable. Xinyang Maojian, this elegant green tea, is one of the top ten famous tea in China and has gained prominence for thousands of years. However, the cultivation history of Xinyang Maojian tea population and selection signals of differentiation from the other major variety Camellia sinensis var. assamica (CSA) remain unclear. We newly generated 94 Camellia sinensis (C. sinensis) transcriptomes including 59 samples in the Xinyang area and 35 samples collected from 13 other major tea planting provinces in China. Comparing the very low resolution of phylogeny inferred from 1785 low-copy nuclear genes with 94C. sinensis samples, we successfully resolved the phylogeny of C. sinensis samples by 99,115 high-quality SNPs from the coding region. The sources of tea planted in the Xinyang area were extensive and complex. Specifically, Shihe District and Gushi County were the two earliest tea planting areas in Xinyang, reflecting a long history of tea planting. Furthermore, we identified numerous selection sweeps during the differentiation of CSA and CSS and these positive selection genes are involved in many aspects such as regulation of secondary metabolites synthesis, amino acid metabolism, photosynthesis, etc. Numerous specific selective sweeps of modern cultivars were annotated with functions in various different aspects, indicating the CSS and CSA populations possibly underwent independent specific domestication processes. Our study indicated that transcriptome-based SNP-calling is an efficient and cost-effective method in untangling intraspecific phylogenetic relationships. This study provides a significant understanding of the cultivation history of the famous Chinese tea Xinyang Maojian and unravels the genetic basis of physiological and ecological differences between the two major tea subspecies.

RNA-Sequencing Reveals the Involvement of Sesquiterpene Biosynthesis Genes and Transcription Factors during an Early Response to Mechanical Wounding of Aquilaria sinensis.

Plants respond to wounding by reprogramming the expression of genes involved in secondary metabolism. Aquilaria trees produce many bioactive secondary metabolites in response to wounding, but the regulatory mechanism of agarwood formation in the early response to mechanical wounding has remained unclear. To gain insights into the process of transcriptome changes and to determine the regulatory networks of Aquilaria sinensis to an early response (15 days) to mechanical wounding, we collected A. sinensis samples from the untreated (Asc1) and treated (Asf1) xylem tissues and performed RNA sequencing (RNA-seq). This generated 49,102,523 (Asc1) and 45,180,981 (Asf1) clean reads, which corresponded to 18,927 (Asc1) and 19,258 (Asf1) genes, respectively. A total of 1596 differentially expressed genes (DEGs) were detected in Asf1 vs. Asc1 (|log2 (fold change)| ≥ 1, Padj ≤ 0.05), of which 1088 were up-regulated and 508 genes were down-regulated. GO and KEGG enrichment analysis of DEGs showed that flavonoid biosynthesis, phenylpropanoid biosynthesis, and sesquiterpenoid and triterpenoid biosynthesis pathways might play important roles in wound-induced agarwood formation. Based on the transcription factor (TF)-gene regulatory network analysis, we inferred that the bHLH TF family could regulate all DEGs encoding for farnesyl diphosphate synthase, sesquiterpene synthase, and 1-deoxy-D-xylulose-5-phosphate synthase (DXS), which contribute to the biosynthesis and accumulation of agarwood sesquiterpenes. This study provides insight into the molecular mechanism regulating agarwood formation in A. sinensis, and will be helpful in selecting candidate genes for improving the yield and quality of agarwood.

Development of a mass spectrometry-based metabolomics workflow for traceability of wild and cultivated Cordyceps sinensis

Cordyceps sinensis, as an expensive traditional Chinese medicine and edible fungus mycelium, lacks an effective quality evaluation method, especially and cultivated Cordyceps sinensis. In this study, a feasible workflow method was developed for traceability evaluation of wild and cultivated Cordyceps sinensis, based on mass spectrometry-based metabolomics. Mass spectrometry data were firstly acquired from Cordyceps sinensis, samples by liquid chromatography-quadrupole and time of flight mass spectrometry. Characteristic mass spectrometry peaks were extracted by applying the MZmine. Then significant markers were obtained from Cordyceps sinensis samples by orthogonal partial least square discriminant analysis. Then, identification of significant markers were identified by MS-FINDER data analytics. The results showed that Changdu, the other four wild origins (Naqu, Xinghai, Yushu and Guoluo) and cultivated samples could be significantly distinguished. This identified significant markers of Cordyceps sinensis, including 174 special significant markers for the wild samples, 204 special significant markers for the cultivated samples and 87 share significant markers. Number of 87 shared significant markers were identified in the wild and cultivated Cordyceps sinensis, especially 28 confident significant compounds, such as adenosine, riboflavin, tyrosine, arginine and glutamine. These shared significant markers might support the quality control of multi-targets of Cordyceps sinensis, compared with a single target in the Chinese Pharmacopoeia. The special significant markers indicated that cultivated Cordyceps sinensis was different from the wild based on mass spectrometry-based metabolomics. In the comparison of chromatographic fingerprint technology, it was found that the established feasible workflow method was easy to acquire significant markers and traceability of Cordyceps sinensis. This feasible workflow method has great potential to be successful for comprehensive and traceability evaluation of the wild and cultivated Cordyceps sinensis.

CATECHIC TANNIN CONTENT OF DIFFERENT TEA SAMPLES

Objective: Camellia sinensis (tea) which is a member of the Theaceae family can be found in many tropical and subtropical areas with diverse cultural forms. It is grown only in the Eastern Black Sea Region of Turkey and originated from China and Japan and is defined as a small evergreen tree. White, green, and black teas are all made from the Camellia sinensis plant species. Scientific studies have shown that distinct types of tea have emerged because of different fermentation processes in the production stages. In this study, the macroscopic and microscopic analysis, diagnosis of tannin, and catechical tannin determination have been conducted on fifteen Camellia sinensis samples purchased from various places. Material and Methods: Five grams of powdered tea samples were extracted with 50 ml of hot water and the catechical tannin determination in the extracts was made by gelatin, ferric and stiasny tests. Results: In the macroscopical examination of A-E (white, green, and black) tea samples the researchers observed no color, odor, or any other substance. When all the samples were microscopically examined, reaserch detected the presence of idioblast which is the characteristic structure of the tea. Conclusion: There was a positive result regarding a diagnosis of tannin and catechical tannin. Catechin substances were determined in each of the one gram samples; The E white tea 0,1300 g, green tea 0,1500 g, black tea 0,0693 g; the D white tea 0,1889 g, green tea 0,1228 g, black tea 0,0710 g; the C white tea 0,2118 g, green tea 0,1306 g, black tea 0,0436 g; the A white tea 0,2400 g, green tea 0,1972 g, black tea 0,0686 g; the B white tea 0,3317 g, green tea 0,1380 g, black tea 0,0517 g.

Untargeted metabolomics analysis to unveil the chemical markers for the differentiation among three Gleditsia sinensis-derived herbal medicines by ultra-high performance liquid chromatography/quadrupole time-of-flight mass spectrometry

Precise identification and differentiation among those congeneric Traditional Chinese Medicines (TCMs) or derived from the same plant trend to be more challenging, particularly in the absence of appearance characteristics. Three TCMs, involving Gleditsiae Sinensis Fructus (GSF), Gleditsiae Fructus Abnormalis (GFA), and Gleditsiae Spina (GS), recorded in Chinese Pharmacopoeia (2020 edition) are derived from Gleditsia sinensis , but prescribed for different clinical uses. The documents aimed to compare their chemical differences are rare, to date. An untargeted metabolomics approach, based on ultra-high performance liquid chromatography/quadrupole time-of-flight mass spectrometry (UHPLC/QTOF-MS), was elaborated to unveil the potential chemical markers to differentiate among GSF, GFA, and GS. Good chromatographic separation of all the GSF/GFA/GS components was achieved within 33 min by utilizing a BEH C18 column, while data-independent MS E in the positive mode was selected for profiling the metabolic features. Notably, the high-mass saponins (1300–2500 Da) gave unique protonated precursors ([M + H] + ) in the positive ESI mode, compared with those complicated ion species occurring in the negative mode. Pattern recognition chemometrics analysis of 45 batches of G. sinensis samples could unveil 70 significantly altered ions assigned as 46 potentially differential components. The positive/negative high-accuracy MS 2 data analysis, phytochemical isolation/NMR analysis, and searching of an in-house library of G. sinensis , were utilized for structural elucidation. Three compounds (saikachinoside A, locustoside A, and locustoside B) rich in GSF could be the markers to differentiate from GFA/GS, while four components were characteristic for GS. These results obtained can greatly benefit the quality control of TCMs derived from G. sinensis .

Concentrations and health risk assessment of 24 residual heavy metals in Chinese mitten crab (Eriocheir sinensis)

In this study, a total of 135 Chinese mitten crab (Eriocheir sinensis) samples were collected from four major crab-producing provinces (Jiangsu, Hubei, Anhui, and Liaoning) in China. The content of 24 trace elements in the edible parts of mitten crabs was determined by inductively coupled plasma mass spectrometry (ICP-MS). In addition, the content of trace elements in crab samples collected from different provinces was compared, and the heavy metal levels exceeding the standard were evaluated. Twenty four trace metallic elements were determined in Chinese mitten crab samples. The single factor pollution index (Pi), percentage of provisionally tolerable weekly intake (PTWI), and target hazard quotients (THQ) were used to evaluate the pollution level and food safety of Chinese mitten crabs. The final assessment results of dietary risks led to the health risk assessment accompanying food safety recommendations on Chinese mitten crabs. The overall finding of this study established that Chinese mitten crab aquatic products can be eaten for nutrition; however, attention should be paid on the potential food safety risks of some heavy metals. Moreover, efforts on developing the industrial economy by the local government and peoples’ safety from food risks may also increase the awareness of environmental protection.

Genomic characterization of silvergrass cryptic virus 1, a novel partitivirus infecting Miscanthus sinensis.

In the present study we report the identification of a novel partitivirus recovered from Miscanthus sinensis, for which the provisional name "silvergrass cryptic virus 1" (SgCV-1) is proposed. High-throughput sequencing (HTS) and rapid amplification of cDNA ends (RACE) allowed the assembly of the complete sequence of each double-stranded RNA genome segment of this novel virus. The largest dsRNA segment, dsRNA1 (1699 bp), was predicted to encode a viral RNA-dependent RNA polymerase protein (RdRp) with 478 aa, and dsRNA2 (1490 bp) and dsRNA3 (1508 bp) were predicted to encode putative capsid proteins (CPs) with 347 and 348 aa, respectively. SgCV-1 has the highest amino acid sequence identity (≤70.80% in RdPp and ≤34.5% in CPs) to members of the genus Deltapartitivirus, family Partitiviridae, especially to unclassified viruses related to members of this genus. Its genome segment and protein lengths are also within the range of those of deltapartitiviruses. Moreover, phylogenetic analysis based on RdRp amino acid sequences also showed clustering of this novel virus with the related unclassified deltapartitiviruses. An RT-PCR survey of 94 imported M. sinensis samples held in quarantine identified seven additional samples carrying SgCV-1. This new virus fulfils all ICTV criteria to be considered a new member of the genus Deltapartitivirus.

Sensitive analytical detection of nitrite using an electrochemical sensor with STAB-functionalized Nb2C@MWCNTs for signal amplification

An electrochemical sensor based on stearyl trimethyl ammonium bromide - functionalized niobium carbide@multi-walled carbon nanotubes (Nb2C@MWCNTs-STAB) for signal amplification was successfully constructed for sensitive detection of nitrite (NO2−). Niobium carbide@multi-walled carbon nanotubes (Nb2C@MWCNTs) with high electrical conductivity and water dispersibility were first prepared in a one-pot hydrothermal synthesis, after which cationic STAB was added to overcome the negative surface charge on the Nb2C@MWCNTs. The electrostatic attraction between Nb2C@MWCNTs-STAB and NO2− was improved by the STAB, which enhanced the sensitivity of the constructed sensor for NO2−. Under optimized conditions, Nb2C@MWCNTs-STAB/GCE exhibited excellent analytical performance for detection NO2− with two wide liner ranges (0.1–100 μmol L−1 and 100–2000 μmol L−1) and a limit of detection of 0.022 μmol L−1. Nitrite recovery tests in milk and spinach samples showed recoveries in the range of 89.82–104.52%. The NO2− residues in ham and pickled vegetable (cedrela sinensis) samples were analysed using the presented sensor and a spectrophotometric method, with no significant difference found between the results of the two methods.

Composition and nutritional qualities of edible tissues of Chinese mitten crab (Eriocheir sinensis) from Ya Lake over different months

The edible tissue yield, proximate, fatty acid, and free amino acid composition were examined and compared among Chinese mitten crabs (Eriocheir sinensis) samples from Ya Lake over different months. Regardless of gender, the gonadosomatic index (GSI) was higher in May and June than that in August and September (P < 0.05), whereas the hepatopancreas index (HSI), meat yield (MY), and total edible yield (TEY) were higher in August and September. For proximate composition, regardless of gender, the total lipid content in the hepatopancreas was significantly higher in September than in other months, and the total lipid and protein content in the gonads was the highest. Furthermore, the content of EPA in female hepatopancreas was the highest in August. Regardless of sex, C16:1n7 in muscle was higher in September than in other months (P < 0.05), and the ratio of n-3/n-6 PUFA was the highest. Moreover, females had the highest glutamate and arginine content in their ovaries in August (P < 0.05). Among the muscles, both sexes contained higher levels of alanine and glutamate in September. Thus, the edible tissue yield, nutritional quality, and taste of Ya Lake E. sinensis in September were the best.

Validation and analysis of the geographical origin of Angelica sinensis (Oliv.) Diels using multi-element and stable isotopes.

BackgroundPlace of origin is an important factor when determining the quality and authenticity of Angelica sinensis for medicinal use. It is important to trace the origin and confirm the regional characteristics of medicinal products for sustainable industrial development. Effectively tracing and confirming the material’s origin may be accomplished by detecting stable isotopes and mineral elements.MethodsWe studied 25 A. sinensis samples collected from three main producing areas (Linxia, Gannan, and Dingxi) in southeastern Gansu Province, China, to better identify its origin. We used inductively coupled plasma mass spectrometry (ICP-MS) and stable isotope ratio mass spectrometry (IRMS) to determine eight mineral elements (K, Mg, Ca, Zn, Cu, Mn, Cr, Al) and three stable isotopes (δ13C, δ15N, δ18O). Principal component analysis (PCA), partial least square discriminant analysis (PLS-DA) and linear discriminant analysis (LDA) were used to verify the validity of its geographical origin.ResultsK, Ca/Al, δ13C, δ15N and δ18O are important elements to distinguish A. sinensis sampled from Linxia, Gannan and Dingxi. We used an unsupervised PCA model to determine the dimensionality reduction of mineral elements and stable isotopes, which could distinguish the A. sinensis from Linxia. However, it could not easily distinguish A. sinensis sampled from Gannan and Dingxi. The supervised PLS-DA and LDA models could effectively distinguish samples taken from all three regions and perform cross-validation. The cross-validation accuracy of PLS-DA using mineral elements and stable isotopes was 84%, which was higher than LDA using mineral elements and stable isotopes.ConclusionsThe PLS-DA and LDA models provide a theoretical basis for tracing the origin of A. sinensis in three regions (Linxia, Gannan and Dingxi). This is significant for protecting consumers’ health, rights and interests.

Tea: Transfer of Mycotoxins from the Spiked Matrix into an Infusion.

Recent surveys report the occurrence of Aspergillus and Penicillium metabolites (aflatoxins (AFLs), ochratoxin A (OTA), cyclopiazonic and mycophenolic acids (MPA), sterigmatocystin (STC), citrinin), Fusarium (trichothecenes, zearalenone (ZEA), fumonisins (FBs), enniatins (ENNs)) and Alternaria (alternariol (AOH), its methyl ether (AME), tentoxin (TE), and tenuazonic acid (TNZ)) toxins in dry Camellia sinensis and herbal tea samples. Since tea is consumed in the form of infusion, correct risk assessment needs evaluation of mycotoxins’ transfer rates. We have studied the transfer of AFLs, OTA, STC, deoxynivalenol (DON), ZEA, FBs, T-2, and HT-2 toxins, AOH, AME, TE, ENN A and B, beauvericin (BEA), and MPA from the spiked green tea matrix into an infusion under variation of preparation time and water characteristics (total dissolved solids (TDS) and pH). Analytes were detected by HPLC-MS/MS. The main factors affecting transfer rate proved to be mycotoxins’ polarity, pH of the resulting infusion (for OTA, FB2, and MPA) and matrix-infusion contact period. The concentration of mycotoxins increased by 20–50% within the first ten minutes of infusing, after that kinetic curve changed slowly. The concentration of DON and FB2 increased by about 10%, for ZEA, MPA, and STC it stayed constant, while for T-2, TE, AOH, and AFLs G1 and G2 it went down. Maximum transfer correlated well with analytes polarity. Maximum transfer of ENNs, BEA, STC, ZEA, and AOH into infusion was below 25%; AFLs—25–45%; DON, TE, and T-2 toxins 60–90%, FB1—80–100%. The concentration of OTA, MPA, and FB2 in the infusion depended on its pH. At pH about four, 20%, 40%, and 60% of these toxins transferred into an infusion, at pH about seven, their concentrations doubled. Water TDS did not affect transfer significantly.