Simplex Sensu Stricto Research Articles

Anisakis spp. as indicators of latitudinal movements of short‐finned pilot whales, Globicephala macrorhynchus, in the Northeast Atlantic

AbstractIn the Northeast Atlantic, it is unclear whether short‐finned pilot whales, Globicephala macrorhynchus (SFPWs), are transient or resident above 40°N. We used Anisakis spp. to identify the latitudes recently visited by a SFPW pod stranded in NW Spain (43°N) in 2020. Analysis of cox2 gene in 30 nematodes from 6 SFPWs revealed the presence of A. simplex sensu stricto (s.s.) (93.3%) and A. pegreffii (6.7%). Morphological analysis of 972 nematodes corroborated species molecular identification and relative proportions; in males (n = 66), the estimated proportions of A. simplex s.s. and A. pegreffii were 86.4% and 13.6%, respectively. These percentages resembled those reported in fish/cetaceans above 40°N, and L4 larvae or adults of A. typica (a tropical‐temperate species found in SFPWs up to 38°N–39°N) were not detected. Population structure of A. simplex s.s. + A. pegreffii in SFPWs suggested a continuous recruitment of nematodes starting at least 3 weeks before stranding. We interpret that either the SFPW pod was within the range of the species (perhaps as a recent northern shift) or represented a vagrant group that visited waters off Northwest Spain for a protracted period. Future analysis on nematode assemblages could shed light on movements and climate‐driven shifts in cetacean distribution.

Location and elimination of Anisakis simplex third stage larvae in Atlantic herring Clupea harengus L

We here describe the location of anisakid third stage larvae in Atlantic herring Clupea harengus L. caught in the North Sea in August 2023. We further demonstrate how industrial processing (mechanical gutting, removal of entrails, head, tail, hypaxial anterior musculature and vertebral column) reduces the overall infection and worm load in the musculature. The isolated anisakid larvae were identified as Anisakis simplex sensu stricto by a combination of morphometrics and molecular methods (PCR of rDNA and mtDNA, sequencing, BLAST analysis). As a baseline we examined a total of 75 specimens of freshly caught and ungutted herring and showed a positive correlation between host size (fish length and weight) and infection level. The overall prevalence of infection was 84 %, the mean intensity 11.3 (range 1–38 parasites per fish) and the abundance 9.52. The main part of the overall worm population was associated with stomach and pyloric caeca in the body cavity (77 %) and only 5 % was found in the musculature. Larvae occurred in the hypaxial part of the musculature (21), the epaxial part (7 worms) and the caudal part (5 worms). The prevalence of muscle infection was 28 % and the mean intensity 1.6 (range 1–5) parasites per fish and abundance 0.44 parasites per fish. In order to assess the effect of industrial processing on worm occurrence in the fish we examined a total of 67 specimens of herring, from exactly the same batch, but following processing. This included removal of organs in the body cavity, cutting the lower part of the hypaxial segment but leaving the right and left musculature connected by dorsal connective tissue. Five out of these fish carried one larva (prevalence 7.5%, mean intensity 1, abundance 0.07 larvae per fish), and these worms were located in the ventral part of the anterior musculature (2), in the central part of the anterior musculature (2) and one larva in the central part of the caudal musculature. The industrial processing reduced the overall occurrence (abundance) of worms in the fish from 9.52 to 0.07 (136 times reduction) and the occurrence in the musculature from 0.44 to 0.07 (6.28 times reduction). The overall prevalence was reduced from 84 % to 7.5 % (11.2 times reduction). Muscle infection prevalence fell from 28 % to 7.5 % (3.7 times reduction). We then followed another batch of herring following a marinating process (11% NaCl for 24 h and subsequent incubation in acetic acid and vinegar) by artificially digesting the flaps during week 1–8. Although a total of 31 larvae were recovered from 144 fish examined no live nematode larvae were isolated. The importance of fish handling, processing and marination for consumer safety is discussed.

Variation in the levels of anisakid infection in the European anchovy Engraulis encrasicolus (Linnaeus) from the Bay of Biscay during the period 2000-2023 (ICES Subarea 8).

The European anchovy Engraulis encrasicolus is one of the most important commercial species in the Bay of Biscay (ICES Subarea 8), and our analysis focused on the analysis of the temporal mean abundance, prevalence, and intensity of Anisakis spp. larvae species in anchovies from ICES Subarea 8 in the years 2000, 2001, 2014-2016, and 2019-2023. Prevalence in adult individuals of anchovy was only 1% in 2000 but increased to 90% in 2014. Since 2015, the prevalence has decreased, and the number of individuals affected in 2023 accounted for 17.6%. The mean abundance showed a similar trend, with a peak of 3.79 nematodes/anchovy in 2014, falling to 0.21 in 2023. The species A. simplex sensu stricto and A. pegreffii were identified by PCR/SANGER sequencing and PCR/RLFP techniques in 2019 and 2020. Anisakis simplex (s.s.) was the most abundant species and, according to the results returned by these two techniques, it accounted for an average of 62.4% and 52.1% of total nematodes in 2019 and 2020, respectively. The results of studies monitoring infection levels in anchovies showed that the mean abundance and prevalence changed over the course of the study period and that the proportion of different species of Anisakis is also subject to variation from year to year.

Post-mortem tissue migration of Anisakis simplex (s.s.) larvae (Nematoda: Anisakidae) in three commercially harvested fish species from the Northeast Atlantic: The role of storage time and temperature

Anisakis simplex sensu stricto is a parasite infecting several commercial fish species in the Northeast (NE) Atlantic, known to be the aetiological agent of the human zoonosis anisakiasis. The present study investigated the response of A. simplex (s. s.) third stage larvae (identified to species level by mtDNA cox2 sequencing) to the storage time and temperature of Atlantic herring (Clupea harengus), Atlantic mackerel (Scomber scombrus) and blue whiting (Micromesistius poutassou) from NE Atlantic fishing areas. A total of 300 fish per species were divided in batches of 50 individuals straight after catch. Each batch was stored at different temperature conditions (2 °C, 5 °C, 15 °C) for different time intervals (24h and 48h). A batch of 50 fish of each species was frozen immediately after catch and used as control (time zero). All fish were inspected by the UV-press method. Blue whiting was the most infected fish species while mackerel harboured the highest proportion of intra-vitam A. simplex (s. s.) larvae in the musculature. In blue withing there was a significant increase in the proportion of larvae in the muscle with increasing storage temperatures (5 °C < 15 °C) and time (24h < 48h). Herring showed a weak trend of increasing parasite infection in the muscle with increasing temperature/time. In contrast, no significant differences of muscle/viscera larval distribution were observed between batches of mackerel stored at different temperatures for different time intervals. Storage temperature and time seem to play a role in the post-mortem motility of A. simplex (s. s.) larvae in herring and blue whiting. Keeping the temperature at ≤ 2 °C seems to prevent post-mortem larval migration into the flesh during fish storage, handling, and transport. Besides abiotic variables, the differences observed in larval post-mortem motility in the different fish species are biologically determined, and attributable to species-specific host-parasite interactions.

Fecundity, in vitro early larval development and karyotype of the zoonotic nematode Anisakis pegreffii

The in vitro life cycle of zoonotic helminths is an essential tool for -omic translational studies focused on disease control and treatment. Anisakiosis is an emerging zoonosis contracted by the ingestion of raw or undercooked fish infected with the third stage larvae (L3) of two sibling species Anisakis simplex sensu stricto (s.s.) and Anisakis pegreffii, the latter being the predominant species in the Mediterranean basin. Recently, in vitro culture of A. pegreffii has been developed to enable fast and large-scale production of fertile adults. However, the conditions for larval development from hatching to infective L3 were not fulfilled to complete the cycle. Herein, we used a Drosophila medium supplemented with chicken serum and adjusted different osmolarities to maintain the culture of L3 hatched from eggs for up to 17 weeks. The highest survival rate was observed in the medium with the highest osmolarities, which also allowed the highest larval exsheathment rate. Key morphological features of embryogenesis and postembryogenesis studied by transmission electron microscopy revealed that the excretory gland cell is differentiated already up to 48 h post-hatching. Extracellular vesicles and cell-free mitochondria are discharged between the two cuticle sheets of the second stage larvae (L2). Contemporarly cultivated, two populations of adult A. simplex s.s. and A. pegreffii reached an average production of 29,914.05 (± 27,629.36) and 24,370.96 (± 12,564.86) eggs/day/female, respectively. The chromosome spreads of A. pegreffii obtained from mature gonads suggests a diploid karyotype formula of 2n = 18. The development of a reliable protocol for the in vitro culture of a polyxenous nematode such as Anisakis spp. will serve to screen for much needed novel drug targets, but also to study the intricated and unknown ecological and physiological traits of these trophically transmitted marine nematodes.

Occurrence of Anisakis larvae in Atlantic horse mackerel (Trachurus trachurus) sold in the city of Marrakesh, Morocco

Human anisakidosis is a parasitic infection caused by the ingestion of nematode larvae of the Anisakidae family contained in various organs of fish and cephalopods consumed raw or undercooked. The aim of this work was to detect and identify morphologically and genetically (PCR and sequencing) the nematode larvae present in both flesh and abdominal cavity of horse mackerel (Trachurus trachurus) which are widely consumed by the population of Marrakesh. For this purpose, 299 fish were purchased at the wholesale market in refrigerated conditions. They were originated from seven different landing ports along the Atlantic coast (Agadir, Dakhla, El Jadida, Essaouira, Mohammedia, Safi and Sidi Ifni). The fishes were analyzed from November 2017 to December 2019, and 4815 larvae were detected out of 294 positive horse mackerel. This resulted in a prevalence of 98.33% and a mean intensity of 16.38 larvae per fish. Horse mackerel from Mohammedia, El Jadida, Safi, Essaouira, Agadir and Sidi Ifni were more infested than those from Dakhla with a mean intensity of 25.29, 21.33, 18.88, 16.15, 15.90 and 13.86 larvae per fish, respectively, while that from Dakhla was the least infested with a mean intensity of 11.83. These results could be explained by the availability of primary intermediate hosts of Anisakis spp., such as crustaceans (shrimps), which are more abundant in the northern Moroccan Atlantic coast. Furthermore, we have recorded a higher infection in fish during warm seasons (spring and summer) than during cold ones. We also have noticed that as the distance from the fishing area increased, the larvae had more time to migrate from the abdominal cavity to the muscles. All detected larvae were identified morphologically as Anisakis type I and genetically as Anisakis simplex sensu stricto. Statistical analysis showed that the intensity of infection by Anisakis L3 larvae was positively correlated with the weight of horse mackerel and that origin had no impact on fish parasitism.

Occurrence and prevalence of third-stage larvae of the Anisakidae family in Macrouridae species captured from bathyal depths of Sagami Bay, Japan

Anisakiasis is the prevailing form of foodborne illness in Japan, with Anisakidae larvae, specifically Anisakis simplex sensu stricto, serving as its causative agents. These larvae are commonly found in mackerel, sardines, and skipjacks retailed at fresh fish establishments. While the infection rates of Anisakidae larvae in these surface-dwelling fish have been extensively studied, their prevalence in deep-sea fish species remains inadequately understood. This investigation aims to determine the infection rates of Anisakidae larvae in three Macrouridae species—namely Coryphaenoides acrolepis, Coelorinchus japonicus, and Coelorinchus macrochir—which represent the most significant inhabitants of the deep-sea realm. Employing artificial digestion techniques, we successfully retrieved all internal contents of the fish, including the nematode larvae. Some Anisakidae larvae were morphologically identified as A. simplex sensu lato and further identified to species by PCR-RFLP analysis. Two larvae showed a band pattern that appeared to be a hybrid between A. simplex sensu stricto and A. berlandi, which after sequence analysis was considered to be an intraspecific variation of A. berlandi. On the other hand, species considered to be unknown were sequenced and phylogenetic analysis was carried out along with identified larvae. The findings indicate that A. simplex sensu stricto was notably more abundant in C. acrolepis, obtained at a depth of 1000 m. In C. japonicus and C. macrochir, captured at a depth of 400 m, a considerable number of Skrjabinisakis paggiae and Pseudoterranova ceticola, were detected in the deep-sea dwelling Kogia breviceps and K. sima as definitive hosts, were detected. Notably, a single C. macrochir harbored seven species of Anisakidae larvae, with an infection tally of nearly 200 individuals of S. paggiae. Thus, a substantial prevalence of Anisakidae larvae in the deep-sea-dwelling Macrouridae species potentially plays a significant role in the transmission pathway to cetaceans as their final hosts.

Phylogenetic and phylogeographic analyses of Anisakis simplex sensu stricto (Nematoda: Anisakidae) from the common minke whale in Korean waters.

The genus Anisakis is among the most significant parasites to public health, as it causes anisakiasis, a parasitic infection in humans resulting from consuming raw or undercooked seafood. Although the infection status of i>Anisakis in second intermediate hosts, such as marine fishes and cephalopods, and humans have been severally reported in Korea, no information about the definitive host in Korean waters is available. In 2014, 2 adult gastric nematodes were collected from a common minke whale (Balaenoptera acutorostrata) found in the East Sea, Korea. These worms were identified as A. simplex sensu stricto (s.s.) by comparing the mitochondrial COX2 marker with previously deposited sequences. Phylogenetic and phylogeographic analyses of A. simplex (s.s.) worldwide revealed 2 distinct populations: the Pacific population and the European waters population. This is the first report on adult i>Anisakis and its definitive host species in Korea. Further studies on Anisakis infection in other cetacean species and marine mammals in Korean seas are warrantedi>Anisakis.

Prevalence of Anisakis larvae in cultured mackerel Scomber japonicas in Japan and the relationship between the intensity of Anisakis infection in cultured mackerel and fish fatness

Incidences of food poisoning caused by Anisakis have increased in Japan, and a significant number of anisakiasis cases in Tokyo attributed to the consumption of mackerel (Scomber japonicus) have been reported. There are two types of cultured mackerel in Japan: those cultured fully from controlled parent fish eggs and those cultured from wild juveniles collected from the sea. In this study, we aimed to investigate the prevalence of Anisakis larvae in cultured mackerel (184 fish) in 15 products and identified the species using molecular analysis to evaluate the risk of food poisoning. In total, 1567 Anisakis larvae were detected in 70 of 130 mackerel in 10 products; however, Anisakis larvae were not detected in 54 mackerel using artificially reared juveniles in 5 products. Moreover, 277 larvae were detected in fish muscle, and 98.6 % (273/277 larvae) were molecularly identified as Anisakis simplex sensu stricto (A. simplex). Conversely, 1043 Anisakis pegreffii larvae were identified genetically and/or morphologically but only 2 larvae were identified in the muscle. There was no significant relationship between the host coefficient of fatness and the infection intensity of Anisakis larvae in individual fish (Spearman's rank correlation coefficient test, P > 0.05). Based on the results of the analysis of the cytochrome c oxidase subunit2 (cox2) gene of A. simplex and A. pegreffii detected in this study, we attempted to estimate the catch area of the juveniles (Pacific stock and Tsushima Warm Current stock). The clusters on the phylogenetic tree of the cox2 gene of A. pegreffii from the mackerel presumed to be the two above mentioned geographic distributions were not separated and these geographic origins could not be estimated. This study revealed that mackerel cultured using wild juveniles are likely to be contaminated with Anisakis larvae, which can be detected not only in the visceral organs, but also in the muscle. Anisakis infection in cultured mackerel did not influence fish growth and evaluating the intensity of Anisakis based on the fatness level of the mackerel was complicated. To prevent anisakiasis caused by the consumption of mackerel cultured using wild juveniles, it is important to steadily control Anisakis through heating and freezing.

Effects of temperature on Anisakis simplex sensu stricto L3 larvae experimentally challenged in rainbow trout (Oncorhynchus mykiss) and Mozambique tilapia (Oreochromis mossambicus)

Human anisakiasis is a foodborne disease that has been increasingly reported worldwide and is caused by the consumption of raw or undercooked seafood infected with zoonotic nematodes of the genus Anisakis Dujardin, 1845. One of the most frequently reported species, both in fish paratenic hosts as well as in human patients, is Anisakis simplex sensu stricto (s.s.), which is distributed within some of the globe's main fishing grounds in the North Pacific and Atlantic oceans. In order to clarify the influence of temperature on this parasite in vivo, third-stage larvae of A. simplex s.s. were surgically challenged in the body cavities of rainbow trouts (Oncorhynchus mykiss) and Mozambique tilapias (Oreochromis mossambicus). Larval survival and tissue migration were then analyzed after 6 and 12weeks. The results showed that survival rates of larvae were lower at 27 and 33°C than at 3, 9, 15 and 21°C. Also, migration to the body muscle was observed to be highest at 9°C. These results suggest that third-stage larvae of A. simplex s.s. are more adapted to lower temperatures in experimentally challenged fish, which may justify its distribution in cold northern waters.

Türk Süpermarketlerindeki İthal Balıklarda Zoonotik Anisakis Larvalarının Varlığına İlişkin Devam Eden Veriler: Dondurulmuş Atlantik Uskumru (Scomber Scombrus) ve Füme Atlantik Somonu (Salmo Salar)

Anisakis pegreffii and A. simplex sensu stricto (s.s.) are the main etiological agents causing human anisakiasis. Here, we aimed to investigate based on the pepsin digestion method of the occurrence of Anisakis larvae in imported deep-frozen whole Atlantic mackerel (Scomber scombrus) from FAO 27 to Turkey and smoked Norwegian farmed Atlantic salmon fillets (Salmo salar) between 2018 and 2019. A total of 100 whole Atlantic mackerel and 180 Atlantic salmon fillets were randomly sampled from local Turkish supermarkets. No Anisakis larvae were detected in smoked Atlantic salmon fillets. In total, 827 Anisakis larvae were found in mackerel, and the prevalence was 68% (68/100). The mI and mA of Anisakis larvae in mackerel were 13.1 and 8.2, respectively. Whereas the 95.28% (788/827) of the Anisakis larvae were found in abdominal cavity/viscera, the 4.72 % (39/827) of the larvae in the muscle. The prevalence and mI of Anisakis larvae in the abdominal cavity/viscera and muscle of mackerel was 63.0% (63/100) and 42.0% (42/100), and 12.5 and 0.9, respectively. The subsample of 100 larvae was molecularly identified by ITS RFLP patterns. The 99 (99.0%) larvae were identified as A. simplex (s.s.), and 1 (1.0%) larva was A. pegreffii. Consequently, there is low or no risk of anisakiasis in smoked farmed Atlantic salmon for Turkish consumers. The 42.0% prevalence of zoonotic Anisakis species larvae in imported Atlantic mackerel fillets could have public health risk in Turkish consumers for anisakiasis or allergy.

In vitro culture of the zoonotic nematode Anisakis pegreffii (Nematoda, Anisakidae)

BackgroundAnisakiasis is a foodborne disease caused by the third-stage larvae (L3) of two species belonging to the genus Anisakis: Anisakis pegreffii and Anisakis simplex sensu stricto. Both species have been the subject of different -omics studies undertaken in the past decade, but a reliable in vitro culture protocol that would enable a more versatile approach to functional studies has never been devised. In nature, A. pegreffii shows a polyxenous life-cycle. It reproduces in toothed whales (final host) and disseminates embryonated eggs via cetacean faeces in the water column. In the environment, a first- (L1) and second-stage larva (L2) develops inside the egg, and subsequently hatched L2 is ingested by a planktonic crustacean or small fish (intermediate host). In the crustacean pseudocoelom, the larva moults to the third stage (L3) and grows until the host is eaten by a fish or cephalopod (paratenic host). Infective L3 migrates into the visceral cavity of its paratenic host and remains in the state of paratenesis until a final host preys on the former. Once in the final host’s gastric chambers, L3 attaches to mucosa, moults in the fourth stage (L4) and closes its life-cycle by becoming reproductively mature.MethodsTesting two commercially available media (RPMI 1640, Schneider’s Drosophila) in combination with each of the six different heat-inactivated sera, namely foetal bovine, rabbit, chicken, donkey, porcine and human serum, we have obtained the first reliable, fast and simple in vitro cultivation protocol for A. pegreffii.ResultsSchneider’s Drosophila insect media supplemented with 10% chicken serum allowed high reproducibility and survival of adult A. pegreffii. The maturity was reached already at the beginning of the third week in culture. From collected eggs, hatched L2 were maintained in culture for 2 weeks. The protocol also enabled the description of undocumented morphological and ultrastructural features of the parasite developmental stages.ConclusionsClosing of the A. pegreffii life-cycle from L3 to reproducing adults is an important step from many research perspectives (e.g., vaccine and drug–target research, transgenesis, pathogenesis), but further effort is necessary to optimise the efficient moulting of L2 to infective L3.Graphical

Anisakiasis Annual Incidence and Causative Species, Japan, 2018-2019.

Using data from 2018–2019 health insurance claims, we estimated the average annual incidence of anisakiasis in Japan to be 19,737 cases. Molecular identification of larvae revealed that most (88.4%) patients were infected with the species Anisakis simplex sensu stricto. Further insights into the pathogenesis of various anisakiasis forms are needed.

Effects of temperature on eggs and larvae of Anisakis simplex sensu stricto and Anisakis pegreffii (Nematoda: Anisakidae) and its possible role on their geographic distributions

Effects of temperature on development of eggs, recently hatched larvae and L3 larvae of the marine parasitic nematodes Anisakis simplex sensu stricto (s.s.) and A. pegreffii were examined in vitro. The eggs of A. simplex s.s. hatched at 3–25 °C and those of A. pegreffii hatched at 3–27 °C. Days before hatching varied between 2 days at 25 °C and 35–36 days at 3 °C in A. simplex s.s. and between 2 and 3 days at 27 °C and 65 days at 3 °C in A. pegreffii. Hatching rates of A. simplex s.s. were maintained high at temperatures between 3 and 25 °C but decreased to 0% at 27 °C. In contrast, those of A. pegreffii were lowest particularly at 3 °C, but also at 27 °C. The mean 50% survivals of hatched larvae ranged from 5.3 days at 25 °C to 82.3 days at 9 °C in A. simplex s.s., while in A. pegreffii it ranged from 1.2 days at 27 °C to 77.2 days at 9 °C. L3 larvae of A. pegreffii exhibited higher survival rates and activity than those of A. simplex s.s., particularly at 20 and 25 °C. These results suggest that the early stages of A. simplex s.s. are more adapted to lower temperatures whereas those of A. pegreffii are more tolerant to warm environments, which may correspond to their distribution patterns in Japan and Europe.

Proteomic Profiling and In Silico Characterization of the Secretome of Anisakis simplex Sensu Stricto L3 Larvae.

Anisakis simplex sensu stricto (s.s.) L3 larvae are one of the major etiological factors of human anisakiasis, which is one of the most important foodborne parasitic diseases. Nevertheless, to date, Anisakis secretome proteins, with important functions in nematode pathogenicity and host-parasite interactions, have not been extensively explored. Therefore, the aim of this study was to identify and characterize the excretory-secretory (ES) proteins of A. simplex L3 larvae. ES proteins of A. simplex were subjected to liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis, and the identified proteins were then analyzed using bioinformatics tools. A total of 158 proteins were detected. Detailed bioinformatic characterization of ES proteins was performed, including Gene Ontology (GO) analysis, identification of enzymes, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways analysis, protein family classification, secretory pathway prediction, and detection of essential proteins. Furthermore, of all detected ES proteins, 1 was identified as an allergen, which was Ani s 4, and 18 were potential allergens, most of which were homologs of nematode and arthropod allergens. Nine potential pathogenicity-related proteins were predicted, which were predominantly homologs of chaperones. In addition, predicted host-parasite interactions between the Anisakis ES proteins and both human and fish proteins were identified. In conclusion, this study represents the first global analysis of Anisakis ES proteins. The findings provide a better understanding of survival and invasion strategies of A. simplex L3 larvae.

Pathological findings in bycaught harbour porpoises (Phocoena phocoena) from the coast of Northern Norway

Due to little prior knowledge, the present study aims to investigate the health status of bycaught harbour porpoises from the northernmost Arctic Norwegian coastline. Gross, histopathological and parasitological investigations were conducted on 61 harbour porpoises (Phocoena phocoena phocoena) accidentally captured in fishing gear from February to April 2017 along the coast of Northern Norway. Most animals displayed a good nutritional status, none were emaciated. Pulmonary nematodiasis (Pseudalius inflexus, Halocercus invaginatus and Torynurus convolutus) was found in 77% and associated with severe bronchopneumonia in 33% of the animals. The majority (92%) had parasites in the stomach and intestine (Anisakis simplex sensu stricto (s. s.), Pholeter gastrophilus, Diphyllobothrium stemmacephalum, Hysterothylacium aduncum and Pseudoterranova decipiens s. s.). The prevalence of gastric nematodiasis was 69%. In the 1st stomach compartment A. simplex s. s. was found in 30% of the animals, causing severe chronic ulcerative gastritis in 23%. Campula oblonga infected the liver and pancreas of 90% and 10% of the animals, respectively, causing severe cholangitis/pericholangitis/hepatitis in 67% and moderate pancreatitis in 10% of the animals. Mesenteric and pulmonary lymphadenitis was detected in 82% and 7% of the animals, respectively. In conclusion, the major pathological findings in the investigated Arctic porpoises were parasitoses in multiple organs with associated severe lesions, particularly in the lung, liver and stomach. The animals were generally well nourished and most showed freshly ingested prey in their stomachs. The present study indicates that the harbour porpoises were able to tolerate the detected parasitic burden and associated lesions without significant health problems.

Hybrid Genotype of Anisakis simplex (s.s.) and A. pegreffii Identified in Third- and Fourth-Stage Larvae from Sympatric and Allopatric Spanish Marine Waters.

Simple SummaryThe nematode species Anisakis simplex sensu stricto (s.s.) and Anisakis pegreffii are wormlike parasites found in commonly consumed fish and are the main cause of human anisakiasis. Outwardly, the two nematodes are extremely similar and difficult to distinguish, especially in their larval forms. Genetic analysis has discovered the existence of a hybrid between these two “sibling species”, but its identification is a controversial matter, as results differ according to the specific region of the DNA analysed. The aim of our work was to confirm the presence of this hybrid genotype in fish off the Spanish coast and to obtain fourth-stage larvae in the laboratory to study if different genotypes are associated with different growth behaviour. Our results confirm that hybrid genotypes can be overestimated if identification is based on a particular molecular marker. We also obtained fourth-stage larvae with a hybrid genotype, which has not been reported previously. These findings are valuable for the taxonomic classification of Anisakis species, and for further epidemiological and biomedical research.The sibling species Anisakis simplex (s.s.) and Anisakis pegreffii are parasites of marine mammals and fish worldwide and the main causative agents of human anisakiasis. In sympatric areas, a hybrid genotype between the two species has been identified, mainly in third-stage larvae, but rarely in fourth-stage and adult forms. The aim of this study was to confirm the presence of hybrid genotypes in larvae parasitizing fish caught in sympatric and allopatric Spanish marine waters, the North-East Atlantic and West Mediterranean, respectively, and to study possible differences in the growth behaviour between genotypes. Of the 254 molecularly analysed larvae, 18 were identified as hybrids by PCR-RFLP analysis of the rDNA ITS region, 11 of which were subsequently confirmed by EF1 α-1 nDNA gene sequencing. These results therefore indicate an overestimation of hybrid genotypes when identification is based only on the ITS region. We also report the detection of a hybrid specimen in a host from the West Mediterranean, considered an allopatric zone. Additionally, fourth-stage larvae with a hybrid genotype were obtained in vitro for the first time, and no differences were observed in their growth behaviour compared to larvae with A. simplex (s.s.) and A. pegreffii genotypes.

Prevalence and identification of Anisakis nematodes in fish consumed in Marrakesh, Morocco.

Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.

Analysis of the Prevalence and Species of &lt;i&gt;Anisakis&lt;/i&gt; nematode in Sekisaba, &lt;i&gt;Scomber japonicus&lt;/i&gt; Caught in Coastal Waters off Saganoseki, Oita in Japan

Anisakidosis is developed by ingesting Anisakis in marine fish, including the chub mackerel, Scomber japonicus, without proper pre-treatment such as cooking or freezing. Two sibling species of Anisakis are found in S. japonicus from Japanese waters, and the prevalence and species of Anisakis in the fish depend on the sea area. For example, Anisakis simplex sensu stricto (s.s.) is found in the Pacific stock of S. japonicus, whereas A. pegreffii is found in the Tsushima Warm Current stock. S.japonicus caught in the Bungo Channel, off the coast of Saganoseki in Oita Prefecture, which is branded as Sekisaba, inhabits a very limited area; however, the infection states of Anisakis found in Sekisaba remain unclear. In this study, we compared the infection states of Anisakis in Sekisaba with those in S. japonicus caught in the South Oita area and Nagasaki Prefecture. All Anisakis from the Nagasaki Prefecture were A. pegreffii, while most of them found in Sekisaba and fish from the South Oita area were A. simplex s.s. Interestingly, the prevalence of Anisakis in Sekisaba was significantly lower than that in the other two areas. This may reflect the fact that Sekisaba might belong to a distinct stock of S. japonicus, varying from other stocks.

Current Status of Anisakiasis and Anisakis Larvae in Tokyo, Japan.

Anisakiasis is a gastrointestinal disease caused by infection with anisakid nematodes. Anisakis larvae have been listed as distinct food poisoning agents in the manual of Food Poisoning Statistics, Japan since 2013. The reported numbers of food poisoning cases caused by Anisakis larvae are gradually increasing. A total of 94.0% of the causative larvae species were identified as Anisakis simplex sensu stricto (A. simplex), and 4.4% were identified as Anisakis pegreffii, among human-isolated anisakid nematodes examined in Tokyo Metropolitan Institute of Public Health, Japan from 2011 to 2018. Anisakis species infecting fishes in Japanese waters differ depending on their habitat and depth. A. simplex mainly infects fishes in the Pacific side of Japan, and A. pegreffii mainly infects fishes in the East China Sea and Sea of Japan sides. Regarding the causative foods of anisakiasis, cases by ingestion of mackerel (Scomber spp.) have been the most common in Japan, and cases caused by eating “marinated mackerel” accounted for 32.8% of the total in Tokyo from 2011 to 2017. However, the number of reports of food poisoning caused by skipjack tuna (Katsuwonus pelamis) was highest in May 2018 in Japan. A parasitological surveys of Anisakis third-stage larvae in skipjack tuna in Japanese waters were conducted in 2018 and 2019, and it was confirmed that more A. simplex infections of skipjack tuna may have occurred in 2018 than usual due to the meandering flow of the Black Current. Moreover, a portion of A. simplex larvae migrated from visceral organs to the ventral muscle in live skipjack tuna before capture, suggesting that an extensive cold chain after capture cannot prevent anisakiasis. In fish species that were reported to be high frequency of causative food of anisakiasis, it is necessary to freeze or at least remove the ventral muscle.