Significant Changes In Expression Research Articles

Correlation between the RNA Expression and the DNA Methylation of Estrogen Receptor Genes in Normal and Malignant Human Tissues.

Estrogen plays a multifaceted function in humans via interacting with the estrogen receptors ERα, ERβ, and G protein-coupled estrogen receptor 1 (GPER1). Previous research has predominantly concentrated on elucidating the signaling route of estrogen. However, the comprehensive understanding of the expression profile and control of these estrogen receptors in various human tissues is not well known. In the present study, the RNA levels of estrogen receptors in various normal and malignant human tissues were retrieved from the human protein atlas, the cancer genome atlas (TCGA), and the genotype-tissue expression (GTEx) databases for analyzing the expression profile of estrogen receptors through gene expression profiling interactive analysis (GEPIA). The status of DNA methylation of estrogen receptor genes from TCGA were analyzed through the software Wanderer and cBioPortal. The MethSurv tool was utilized to estimate the relevance between specific cytosine-guanine (CG) methylation and tumor survival. The expression profile analysis revealed that ERα, ERβ, and GPER1 have unique expression patterns in diverse tissues and malignancies. The interesting results were the higher expression of ERβ RNA in the male testis than in females and the positive association between the RNA level of ERα and the androgen receptor in different human normal tissues. Especially, the significant changes in GPER1 expression in multiple malignancies showed a consistent decrease with no exception, which indicates the role of GPER1 in common tumor inhibition. The finding on the expression profile provides clues for exploring novel potential physiological and pathophysiological functions of estrogen. The DNA methylation analysis manifested that the expression of GPER1 and ERα showed a substantial correlation with the methylation of specific CG sites in the cis-regulating region of the gene. However, no such association was observed for ERβ. When comparing tumor tissues to normal tissues, the DNA methylation of certain CG sites of estrogen receptors showed a correlation with tumor survival but did not always correlate with the expression of that gene or with the expression of DNA methyltransferases. We proposed that the variation in DNA methylation at different CG sites in estrogen receptor genes had other functions beyond its regulatory role in its gene expression, and this might be associated with the progression and therapy efficiency of the tumor based on the modulation of the chromatin configuration.

132 Detailed Characterization of a Novel Human Ex Vivo Model for Burn Injuries

Abstract Introduction Burn injuries belong to the most common soft tissue injuries and often result in extensive trauma but are also associated with cases of major emergency such as sepsis or systemic inflammatory response syndrome. The early phase after burn injury is critical and decides about later potential complications in wound healing. Burn injuries activate numerous processes, including heat shock, inflammation and tissue regeneration responses and thereby promote the release of cytokines and other signalling molecules such as miRNAs and metabolites. Despite extensive research, skin tissue reactions in the early phases after burn injuries still need to be investigated in more detail. Therefore, reliable burn models are needed to elucidate the exact sequence of events during the healing process and to monitor potential biomarkers that could give information about treatment success. Methods We induced contact burns on fresh human abdominal skin explants that were resected during abdominoplasty. Gene and miRNA expression patterns, cytokine production profiles of key mediators such as IL8 and IL6 and skin ultrastructure were analysed for 24 hours after the burn injury. Additionally, we used open flow microperfusion (OFM), a sampling technique that allows time and location dependent collection of dermal interstitial fluid (dISF), to also monitor the release of specific miRNAs, cytokines and metabolites. Results In burn injuries, we found significant changes in gene and miRNA expression as soon as one hour after burn injury. Inflammatory genes such as IL8 were significantly up-regulated whereas miRNAs were systematically down-regulated. miRNAs were actively released and mobilized into the dISF, while miR-497-5p could be identified stably downregulated in tissue and dISF in the early phase after a burn injury. Metabolome analysis of dISF showed a striking metabolic shift in burn injuries, linking burn injury to increased amino acid and glucose turnover in wounds. Conclusions By using this ex vivo human skin model for burn injuries we were able to study the immediate early responses to burns for up to 24 h. We found that miR-497-5p could serve as potential biomarker to assess burn severity since it is not only down-regulated in skin but also mobilized into the dISF after burn injury. Furthermore, we found distinct metabolite signatures after burn injury. Applicability of Research to Practice Identification and research on potential biomarkers to assess burn severity and treatment success.

Effects of porcine epidemic diarrhea virus infection on CD21+ B cells activation

Porcine epidemic diarrhea virus (PEDV) is a devastating pathogen of acute- gastrointestinal infectious diseases, which can cause vomiting, diarrhea, dehydration and high morbidity and mortality among neonatal piglets. Humoral immunity plays a vital role in the host anti-PEDV infection process, but the mechanism of PEDV-induced B-cell immune response remains unknown. In this study, the effects of PEDV infection on CD21+ B cell activation were systematically analyzed through animal experiments. Enzyme-linked immunosorbent assays (ELISA) revealed that low levels of serum-specific IgA, IgM, or IgG were detected in piglets after PEDV infection, respectively. Serum interleukin (IL)-6 levels increased significantly at 4 d after infection, and the levels of IL-4, B-cell activating factor (BAFF), interferon (IFN)-γ, transforming growth factor (TGF)-β and IL-10 decreased at 7 d after infection. Fluorescence-activated cell sorting (FACS) showed that expression levels of CD21, MHC Ⅱ, CD40, and CD38 on B cell surfaces were significantly higher. In contrast, the proportions of CD21+IgM+ B cells were decreased in peripheral blood mononuclear cells (PBMCs) from the infected piglets. No differences were found in the percentage of CD21+CD80+ and CD21+CD27+ B cells in PBMCs from the infected piglets. In addition, the number of CD21+B cells in PBMCs stimulated with PEDV in vitro was significantly lower. No significant change in the mRNA expression of BCR molecules was found while the expression levels of paired immunoglobulin-like receptor B (PIR-B), B cell adaptor molecule of 32 kDa (Bam32) and BAFF were decreased. In conclusion, our research demonstrates that virulent strains of PEDV profoundly impact B cell activation, leading to alterations in phenotypic expression and BCR signaling molecules. Furthermore, this dysregulation results in compromised specific antibody secretion and perturbed cytokine production, highlighting the intricate immunological dysfunctions induced by PEDV infection.

OsSCYL2 is Involved in Regulating ABA Signaling-Mediated Seed Germination in Rice.

Seed germination represents a multifaceted biological process influenced by various intrinsic and extrinsic factors. In the present study, our investigation unveiled the regulatory role of OsSCYL2, a gene identified as a facilitator of seed germination in rice. Notably, the germination kinetics of OsSCYL2-overexpressing seeds surpassed those of their wild-type counterparts, indicating the potency of OsSCYL2 in enhancing this developmental process. Moreover, qRT-PCR results showed that OsSCYL2 was consistently expressed throughout the germination process in rice. Exogenous application of ABA on seeds and seedlings underscored the sensitivity of OsSCYL2 to ABA during both seed germination initiation and post-germination growth phases. Transcriptomic profiling following OsSCYL2 overexpression revealed profound alterations in metabolic pathways, MAPK signaling cascades, and phytohormone-mediated signal transduction pathways, with 15 genes related to the ABA pathways exhibiting significant expression changes. Complementary in vivo and in vitro assays unveiled the physical interaction between OsSCYL2 and TOR, thereby implicating OsSCYL2 in the negative modulation of ABA-responsive genes and its consequential impact on seed germination dynamics. This study elucidated novel insights into the function of OsSCYL2 in regulating the germination process of rice seeds through the modulation of ABA signaling pathways, thereby enhancing the understanding of the functional significance of the SCYL protein family in plant physiological processes.

Analysis of gene expression dynamics and differential expression in viral infections using generalized linear models and quasi-likelihood methods.

Our study undertakes a detailed exploration of gene expression dynamics within human lung organ tissue equivalents (OTEs) in response to Influenza A virus (IAV), Human metapneumovirus (MPV), and Parainfluenza virus type 3 (PIV3) infections. Through the analysis of RNA-Seq data from 19,671 genes, we aim to identify differentially expressed genes under various infection conditions, elucidating the complexities of virus-host interactions. We employ Generalized Linear Models (GLMs) with Quasi-Likelihood (QL) F-tests (GLMQL) and introduce the novel Magnitude-Altitude Score (MAS) and Relaxed Magnitude-Altitude Score (RMAS) algorithms to navigate the intricate landscape of RNA-Seq data. This approach facilitates the precise identification of potential biomarkers, highlighting the host's reliance on innate immune mechanisms. Our comprehensive methodological framework includes RNA extraction, library preparation, sequencing, and Gene Ontology (GO) enrichment analysis to interpret the biological significance of our findings. The differential expression analysis unveils significant changes in gene expression triggered by IAV, MPV, and PIV3 infections. The MAS and RMAS algorithms enable focused identification of biomarkers, revealing a consistent activation of interferon-stimulated genes (e.g., IFIT1, IFIT2, IFIT3, OAS1) across all viruses. Our GO analysis provides deep insights into the host's defense mechanisms and viral strategies exploiting host cellular functions. Notably, changes in cellular structures, such as cilium assembly and mitochondrial ribosome assembly, indicate a strategic shift in cellular priorities. The precision of our methodology is validated by a 92% mean accuracy in classifying respiratory virus infections using multinomial logistic regression, demonstrating the superior efficacy of our approach over traditional methods. This study highlights the intricate interplay between viral infections and host gene expression, underscoring the need for targeted therapeutic interventions. The stability and reliability of the MAS/RMAS ranking method, even under stringent statistical corrections, and the critical importance of adequate sample size for biomarker reliability are significant findings. Our comprehensive analysis not only advances our understanding of the host's response to viral infections but also sets a new benchmark for the identification of biomarkers, paving the way for the development of effective diagnostic and therapeutic strategies.

Dynamics of miRNA expression in urine extracellular vesicles of prostate cancer patients after radical prostatectomy

Introduction. It is known that the treatment of oncological diseases including prostate cancer (PCa) causes changes in the expression of oncogenic and oncosuppressive miRNAs. The analysis of miRNA expression dynamics can be used to predict the course of the disease and its response to therapy. However, the effect of PCa therapy on the expression of extracellular miRNAs is just beginning to be investigated.Aim. To study the expression dynamics of 14 miRNAs (miR-19b, -22-3p, -30e, -31, -92a, -125b, -144, -200b, -205, -222, -375, -378a, -425, -660) in urine extracellular vesicles of PCa patients after radical prostatectomy and to reveal prognostic miRNA ratios.Materials and methods. Urine samples of 18 donors and 18 PCa patients, obtained before radical prostatectomy, 1 week and 3 months after surgery, were examined. Extracellular vesicles were isolated by aggregation-precipitation protocol; extracellular vesicles miRNAs were isolated using fiberglass sorbents and octane acid. Data on threshold detection cycles of 14 miRNAs were obtained using reverse transcription – loop polymerase chain reaction (TaqMan).Results. It was found that prostatectomy causes a significant change in the relative expression of 44 miRNA ratios in the urine of PCa patients. Four groups of miRNA ratios can be distinguished: 1) miRNA ratios, which expression level significantly differed between donors and PCa patients before surgery and significantly changed in PCa patients 3 months after prostatectomy in the direction of the level of donors (6 pairs); 2) miRNA ratios, which expression did not significantly differ between donors and PCa patients before surgery, but significantly differed from the baseline in PCa patients and donors 3 months after prostatectomy (5 pairs); 3) miRNA ratios, based on expression ratios of which PCa patients can be divided into two or three significantly different subgroups 3 months after prostatectomy (19 pairs); 4) miRNA ratios that did not significantly change their expression after prostatectomy (30 pairs).Conclusion. Prostatectomy causes a significant change in the level of expression of miRNA in urine. 6 pairs of miRNAs, the relative expression of which after surgery significantly changed towards that of healthy donors and 19 pairs of miRNAs, according to the level of relative expression of which patients with prostate cancer were divided into two significantly different subgroups 3 months after prostatectomy, were identified based on the analysis of the dynamics of miRNA expression after prostatectomy.

Dysregulated AEBP1 and COLEC12 Genes in Late-Onset Alzheimer's Disease: Insights from Brain Cortex and Peripheral Blood Analysis.

Alzheimer's disease (AD) is a progressive neurodegenerative disorder characterized by memory and cognitive impairment, often accompanied by alterations in mood, confusion, and, ultimately, a state of acute mental disturbance. The cerebral cortex is considered a promising area for investigating the underlying causes of AD by analyzing transcriptional patterns, which could be complemented by investigating blood samples obtained from patients. We analyzed the RNA expression profiles of three distinct areas of the brain cortex, including the frontal cortex (FC), temporal cortex (TC), and entorhinal cortex (EC) in patients with AD. Functional enrichment analysis was performed on the differentially expressed genes (DEGs) across the three regions. The two genes with the most significant expression changes in the EC region were selected for assessing mRNA expression levels in the peripheral blood of late-onset AD patients using quantitative PCR (qPCR). We identified eight shared DEGs in these regions, including AEBP1 and COLEC12, which exhibited prominent changes in expression. Functional enrichment analysis uncovered a significant association of these DEGs with the transforming growth factor-β (TGF-β) signaling pathway and processes related to angiogenesis. Importantly, we established a robust connection between the up-regulation of AEBP1 and COLEC12 in both the brain and peripheral blood. Furthermore, we have demonstrated the potential of AEBP1 and COLEC12 genes as effective diagnostic tools for distinguishing between late-onset AD patients and healthy controls. This study unveils the intricate interplay between AEBP1 and COLEC12 in AD and underscores their potential as markers for disease detection and monitoring.

Evolution of Phenotypic Variance Provides Insights into the Genetic Basis of Adaptation.

Most traits are polygenic, and the contributing loci can be identified by genome-wide association studies. The genetic basis of adaptation (adaptive architecture) is, however, difficult to characterize. Here, we propose to study the adaptive architecture of traits by monitoring the evolution of their phenotypic variance during adaptation to a new environment in well-defined laboratory conditions. Extensive computer simulations show that the evolution of phenotypic variance in a replicated experimental evolution setting can distinguish between oligogenic and polygenic adaptive architectures. We compared gene expression variance in male Drosophila simulans before and after 100 generations of adaptation to a novel hot environment. The variance change in gene expression was indistinguishable for genes with and without a significant change in mean expression after 100 generations of evolution. We suggest that the majority of adaptive gene expression evolution can be explained by a polygenic architecture. We propose that tracking the evolution of phenotypic variance across generations can provide an approach to characterize the adaptive architecture.

Local age-dependent neuromodulation in Rhodnius prolixus antennae.

Kissing bugs do not respond to host cues when recently molted and only exhibit robust host-seeking several days after ecdysis. Behavioral plasticity has peripheral correlates in antennal gene expression changes through the week after ecdysis. The mechanisms regulating these peripheral changes are still unknown, but neuropeptide, G-protein coupled receptor, nuclear receptor, and takeout genes likely modulate peripheral sensory physiology. We evaluated their expression in antennal transcriptomes along the first week postecdysis of Rhodnius prolixus 5th instar larvae. Besides, we performed clustering and co-expression analyses to reveal relationships between neuromodulatory (NM) and sensory genes. Significant changes in transcript abundance were detected for 50 NM genes. We identified 73 sensory-related and NM genes that were assigned to nine clusters. According to their expression patterns, clusters were classified into four groups: two including genes up or downregulated immediately after ecdysis; and two with genes with expression altered at day 2. Several NM genes together with sensory genes belong to the first group, suggesting functional interactions. Co-expression network analysis revealed a set of genes that seem to connect with sensory system maturation. Significant expression changes in NM components were described in the antennae of R. prolixus after ecdysis, suggesting that a local NM system acts on antennal physiology. These changes may modify the sensitivity of kissing bugs to host cues during this maturation interval.

Identification of PPAR-related differentially expressed genes liver hepatocellular carcinoma and construction of a prognostic model based on data analysis and molecular docking.

Liver hepatocellular carcinoma (LIHC) is a significant global health issue with limited treatment options. In this study, single-cell RNA sequencing (scRNA-seq) data were used to explore the molecular mechanisms of LIHC development and identify potential targets for therapy. The expression of peroxisome proliferator-activated receptors (PPAR)-related genes was analysed in LIHC samples, and primary cell populations, including natural killer cells, T cells, B cells, myeloid cells, endothelial cells, fibroblasts and hepatocytes, were identified. Analysis of the differentially expressed genes (DEGs) between normal and tumour tissues revealed significant changes in gene expression in various cell populations. PPAR activity was evaluated using the 'AUCell' R software, which indicated higher scores in the normal versus the malignant hepatocytes. Furthermore, the DEGs showed significant enrichment of pathways related to lipid and glucose metabolism, cell development, differentiation and inflammation. A prognostic model was then constructed using 8 PPARs-related genes, including FABP5, LPL, ACAA1, PPARD, FABP4, PLIN1, HMGCS2 and CYP7A1, identified using least absolute shrinkage and selection operator-Cox regression analysis, and validated in the TCGA-LIHC, ICGI-LIRI and GSE14520 datasets. Patients with low-risk scores had better prognosis in all cohorts. Based on the expression of the eight model genes, two clusters of patients were identified by ConsensusCluster analysis. We also predicted small-molecule drugs targeting the model genes, and identified perfluorohexanesulfonic acid, triflumizole and perfluorononanoic acid as potential candidates. Finally, wound healing assay confirmed that PPARD can promote the migration of liver cancer cells. Overall, our study offers novel perspectives on the molecular mechanisms of LIHC and potential areas for therapeutic intervention, which may facilitate the development of more effective treatment regimens.

Age-related changes after intracerebral hemorrhage: a comparative proteomics analysis of perihematomal tissue.

The risk factors and causes of intracerebral hemorrhage (ICH) and the degree of functional recovery after ICH are distinct between young and elderly patients. The increasing incidence of ICH in young adults has become a concern; however, research on the molecules and pathways involved ICH in subjects of different ages is lacking. In this study, tandem mass tag (TMT)-based proteomics was utilized to examine the protein expression profiles of perihematomal tissue from young and aged mice 24h after collagenase-induced ICH. Among the 5,129 quantified proteins, ICH induced 108 and 143 differentially expressed proteins (DEPs) in young and aged mice, respectively; specifically, there were 54 common DEPs, 54 unique DEPs in young mice and 89 unique DEPs in aged mice. In contrast, aging altered the expression of 58 proteins in the brain, resulting in 39 upregulated DEPs and 19 downregulated DEPs. Bioinformatics analysis indicated that ICH activated different proteins in complement pathways, coagulation cascades, the acute phase response, and the iron homeostasis signaling pathway in mice of both age groups. Protein-protein interaction (PPI) analysis and ingenuity pathway analysis (IPA) demonstrated that the unique DEPs in the young and aged mice were related to lipid metabolism and carbohydrate metabolism, respectively. Deeper paired-comparison analysis demonstrated that apolipoprotein M exhibited the most significant change in expression as a result of both aging and ICH. These results help illustrate age-related protein expression changes in the acute phase of ICH.

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.

Abstract 995: Preservation of patient whole blood preserves cancer immune cell biology at single cell resolution

Abstract Blood is an easily accessible clinical sample type that helps inform treatments, investigate disease mechanisms, and monitor outcomes. Logistical challenges in the transportation and processing of blood samples impact data output from single cell RNA sequencing (scRNA-seq). Recent scRNA-seq studies have shown that significant changes in gene expression and immune cell populations occur in as little as a few hours post collection. Thus, there is a need for rapid preservation of blood upon collection before biological changes can occur. Existing preservation approaches compromise the cell membrane, making samples incompatible with single cell transcriptomic analyses. Here, we describe a novel workflow for fixation and long-term storage of whole blood, and isolation of peripheral blood mononuclear cells (PBMCs) from the fixed blood using a readily available, low-cost, high-throughput procedure. We then profile the gene expression of these cells using the fixation-compatible Single Cell Gene Expression Flex workflow. Importantly, this novel blood collection and preparation workflow eases blood transportation logistical constraints, allowing distributed sample collection and batched shipping of blood samples for scRNA-seq and potentially enabling large-scale translational research studies. We compared whole blood fixed immediately after collection using our workflow with clinical blood samples stored at ambient temperature. This revealed that immune cell populations and biological pathways shift significantly as early as five hours following sample collection, if not immediately stabilized. Across a time course of ambient temperature storage of whole blood without immediate stabilization, we observe significant upregulation of stress-related genes (FOS, JUN, CIRBP) in samples using Single Cell Gene Expression Flex profiling. Additionally, expression of a proto-oncogene TNFAIP3 was upregulated in whole blood stored at 20°C compared to samples stored at 4°C for the same lengths of time, unless samples were stabilized using the novel workflow shown here. This novel whole blood fixation method, coupled with automatable cell isolation methods and Single Cell Gene Expression Flex-enabled multiplexed single cell sequencing, will usher in a new age of economical, large-scale translational research studies that result in valuable clinical insights. Citation Format: Kelly Martin, Connor Kunihiro, Jawad Abousoud, Tingsheng Drennon, Yina Li, Sean Marrache, Nandhini Raman, Veronica Rodriguez, Paul Lund, Jens Durruthy Durruthy, Sarah Taylor, Andrew Kohlway, Peter Smibert, Dagmar Walter, Jill Herschleb. Preservation of patient whole blood preserves cancer immune cell biology at single cell resolution [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 995.

Abstract 1112: Modulated dNTP pools and their influence on DNA repair mechanisms and apoptosis in therapy resistant cancers

Abstract Glioblastoma (GBM) is a deadly primary tumor of the brain, accounting for almost half of all diagnosed malignant gliomas. Ionizing radiation (IR) and some chemotherapeutics strategically target cancer cells by causing DNA double-strand breaks (DSBs). However, cancers like GBM often develop resistance to DSB-inducing therapeutics due to dysregulated DNA repair. Homologous Recombination (HR) is an error-free DSB-repair process consisting of proteins that are often dysregulated in GBM, causing overactive DNA-repair, therapy resistance, and poor patient outcomes. Proteins involved in the HR-repair process have been extensively investigated; however, therapeutic resistance remains common. Here, we provide an alternative approach to target DSB-resistant GBM by modulating the dNTP pool instead of solely targeting DNA-repair proteins. Our goal is to understand the interplay between dNTP pools and DSB- repair. dNTPs are a necessary constituent to repair DSBs; however, the role of the dNTP pool in DNA damage repair is not fully understood. Previous research shows that the dNTP pool remains unchanged after inducing DSBs, highlighting the importance of a tightly regulated dNTP pool. Using a neutral comet assay, we quantified accumulated double-stranded breaks in different treatment groups. We then analyzed these groups using immunofluorescent microscopy to examine distinct proteins involved in HR-mediated repair. We carried out RNA sequencing analysis to determine differential gene expression. We quantified cell viability and apoptotic cell populations via flow cytometry and Alamar blue assays. We determined protein interactions using immunoblotting and immunoprecipitation assays. We found that increasing the dNTP pool prior to IR treatment led to impaired DNA DSB repair in GBM cells as determined by a neutral comet assay. When analyzing key proteins involved in HR via immunofluorescence, we observed a significant decrease in RPA70 localization to the DNA damage site, indicating a disruption in end resection, a necessary phase of HR. Our RNA sequencing results show that increasing the dNTP pool in LN229 GBM cells prior to IR treatment caused significant changes in gene expression when compared to IR treatment alone. The most impacted pathways most were apoptosis, p53 cell cycle arrest, and DNA repair. The pathway analysis has identified genes of interest in the synergistic dNTP + IR treatment model. Significant increases in apoptosis and decreases in viability were observed 48 hours after inducing DSBs in LN229 cells with elevated dNTP pools. Not only do these data suggest that HR efficiency is reduced due to end resection impairment, but they also show that as a result, cell viability is destabilized due to prolonged DNA damage, resulting in apoptosis. The identification of this impairment may be essential in finding novel therapeutic approaches to sensitize therapy resistant GBM. Citation Format: Dominique Monroe, Mercy Kehinde-Ige, Edidiong Usoro, Arilyn Williams, Emily Steinbeck, Shelby Aycox, Huidong Shi, Waaqo Daddacha. Modulated dNTP pools and their influence on DNA repair mechanisms and apoptosis in therapy resistant cancers [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1112.

Abstract 7007: 5hmc-sequencing identifies candidate genes in Puerto Rican Hispanic/Latino men with aggressive prostate cancer

Abstract Introduction: Puerto Rican (PR) Hispanic/Latino (H/L) men are an understudied population which has the highest prostate cancer (PCa) specific mortality when compared with other Hispanic populations. According to the recent PR Cancer Registry data, PCa is the leading cancer type in terms of incidence (38% of all cancer cases) and mortality (16% of all cancer deaths) in PR H/L men. PR H/L men also have significantly higher PCa-specific mortality than non-Hispanic Whites (NHW) and non-Hispanic Blacks (NHB). So far, little is known about higher mortality in PR H/L men. It is believed that epigenetic changes of key genes play a critical role in aggressive tumors. Therefore, our study was aimed to identify key 5-hydroxymethylcytosine (5hmC) changes in PR H/L men with aggressive PCa. Methods: We prepared sequencing libraries using the enriched 5hmC DNA from 42 prostate tumor and 44 adjacent normal FFPE samples. We performed sequencing on an Illumina NextSeq 500 with 75bp single end. We used DESeq2 package to identify differentially methylated genes (DMGs). We also downloaded additional 5hmC data (Database: EGAS00001004942) of 51 localized PCa and 7 adjacent normal for confirmation analysis. We used Gleason score (GS) as a cut-off to identify DMGs in aggressive PCa patients (GS- 7 (3+4) or less, Non-aggressive; GS- 7 (4+3) and above, Aggressive). Results: We identified 808 DMGs in tumors compared to adjacent normal tissues (FDR<0.05, log2FC>|0.4|). Pathway analysis of DMGs demonstrated that cell-cycle, cell division, and DNA repair related pathways were most upregulated in tumors. Since 5hmC abundance is highly correlated with gene expression levels, we further investigated 808 DMGs with TCGA prostate cancer gene expression data. This analysis identified 59/73 DMGs (80.1%, (FDR<0.05, delta>|1|) with significant 5hmC and gene expression changes in the same direction. We also performed differential methylation analysis in another dataset and observed that 129 DMGs were common with our results. Finally, we demonstrated 111 DMGs (p<0.05) in aggressive tumors (n=7) compared to non-aggressive tumors (n=15). These 111 DMGs include important 5hmC hypomethylated genes (BCCIP and KLK10) and hypermethylated genes (COX6C, ARMC2, PVT1) in aggressive PCa patients. Conclusions: Our study identifies 59 genes having coordinated epigenetic and transcriptomic changes in PR H/L men and 111 DMGs in aggressive tumors. The coordinated 59 genes include tumor suppressor genes such as DKK3 and PRDM8 with downregulated 5hmC and gene expression levels. Also, previous studies reported downregulation of BCCIP and KLK10 and upregulation of COX6C, ARMC2, PVT1 expression in PCa. The coordinated changes in 5hmC could be critical in aggressive PCa biology, hence in future, these genes will be validated as candidate biomarkers and targets for aggressive PCa among PR H/L men. Citation Format: Manishkumar S. Patel, Muosa Almubarak, Jaime Matta, Carmen Ortiz-Sánchez, Jarline Encarnacion, Gilberto Ruiz-Deya, Julie Dutil, Jasreman Dhillon, Kosj Yamoah, Anders Berglund, Hyun Park, Liang Wang, Jong Y. Park. 5hmc-sequencing identifies candidate genes in Puerto Rican Hispanic/Latino men with aggressive prostate cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7007.

Interferon Regulatory Factor 4 (IRF4) Plays a Key Role in Osteoblast Differentiation of Postmenopausal Osteoporosis.

Postmenopausal osteoporosis (PMOP) is a prevalent disease, which features decreased bone mass, bone weakness and deteriorated bone microstructure in postmenopausal women. Although many factors have been revealed to contribute to the occurrence of PMOP, its mechanism remains undefined. This work aimed to identify significant changes in gene expression during PMOP formation and to examine the most valuable differential genes in postmenopausal osteoporosis versus the control group. The GSE68303 dataset that contains 12 ovariectomize (OVX) experimental and 11 sham groups was downloaded and analyzed. The results indicated that interferon regulatory factor 4 (IRF4) might be a hub gene in the development of postmenopausal osteoporosis. Western blot and immunohistochemistry were carried out to evaluate IRF4 levels in thoracic vertebra extracts from OVX and Sham mice. To assess IRF4's impact on osteogenic differentiation in postmenopausal bone marrow mesenchymal stem cells (BM-MSCs), IRF4 overexpression (OV-IRF4) and knockdown (Sh-IRF4) plasmids were constructed. The results showed that comparing with the sham group, bone samples from the OVX group showed higher IRF4 expression. Alkaline phosphatase (ALP) staining revealed that IRF4 overexpression significantly inhibited ALP activity, while IRF4 knockdown promoted ALP activity in BM-MSCs. Simvastatin-treated OVX mice showed increased total bone volume/total tissue volume (BV/TV) and elevated Runx2 expression by immunohistochemical staining compared with the OVX group. This study demonstrated that IRF4 is associated with OVX induced osteoporosis, it can regulate bone stability by inhibiting the osteogenic differentiation BM-MSCs. This study may help enhance our understanding of the molecular mechanism of PMOP formation, providing new insights into estrogen defiance induced osteoporosis.

Genome-Wide Identification of the 14-3-3 Gene Family and Its Involvement in Salt Stress Response through Interaction with NsVP1 in Nitraria sibirica Pall.

14-3-3 proteins are widely distributed in eukaryotic cells and play an important role in plant growth, development, and stress tolerance. This study revealed nine 14-3-3 genes from the genome of Nitraria sibirica Pall., a halophyte with strong salt tolerance. The physicochemical properties, multiple sequence alignment, gene structure and motif analysis, and chromosomal distributions were analyzed, and phylogenetic analysis, cis-regulatory elements analysis, and gene transcription and expression analysis of Ns14-3-3s were conducted. The results revealed that the Ns14-3-3 gene family consists of nine members, which are divided into two groups: ε (four members) and non-ε (five members). These members are acidic hydrophilic proteins. The genes are distributed randomly on chromosomes, and the number of introns varies widely among the two groups. However, all genes have similar conserved domains and three-dimensional protein structures. The main differences are found at the N-terminus and C-terminus. The promoter region of Ns14-3-3s contains multiple cis-acting elements related to light, plant hormones, and abiotic stress responses. Transcriptional profiling and gene expression pattern analysis revealed that Ns14-3-3s were expressed in all tissues, although with varying patterns. Under salt stress conditions, Ns14-3-3 1a, Ns14-3-3 1b, Ns14-3-3 5a, and Ns14-3-3 7a showed significant changes in gene expression. Ns14-3-3 1a expression decreased in all tissues, Ns14-3-3 7a expression decreased by 60% to 71% in roots, and Ns14-3-3 1b expression increased by 209% to 251% in stems. The most significant change was observed in Ns14-3-3 5a, with its expression in stems increasing by 213% to 681%. The yeast two-hybrid experiments demonstrated that Ns14-3-3 5a interacts with NsVP1 (vacuolar H+-pyrophosphatase). This result indicates that Ns14-3-3 5a may respond to salt stress by promoting ionic vacuole compartmentalization in stems and leaves through interactions with NsVP1. In addition, N. sibirica has a high number of stems, allowing it to compartmentalize more ions through its stem and leaf. This may be a contributing factor to its superior salt tolerance compared to other plants.

Effect of transporting Oreochromis niloticus in water with and without sodium chloride on skin morphology and some immunity-related genes expression.

The aim of this study was to examine the effects of salt addition on the skin gene expression of Mucin, Antimicrobial peptides, cortisol, and glucose in Oreochromis niloticus after 5-hour transportation in water. Three groups were compared: Control, post-transport without salt (PT-S), and post-transport with 5g salt-1(PT + S), with a stocking density of 28.6 gL-1, 20 fish for each experimental group. The results showed that the PT-S group had more significant changes in gene expression than the PT + S group, suggesting that salt alleviated the stress and immune responses of O. niloticus. The PT-S group had higher expression of mucin- 2(MUC + 2) (7.58 folds) and mucin-5AC (MUC5-AC) (6.29 folds) than the PT + S group (3.30 folds and 4.16 folds, respectively). The PT-S group also had lower expression of β-defensin-1 (Dβ1) (0.42 folds), β-defensin-2 (Dβ2) (0.29 folds), and Cath1 (0.16 folds) than the PT + S group (0.82 folds, 0.69 folds, and 0.75 folds, respectively). The skin morphology of the PT-S group revealed some white patches with no goblet cell openings, while the PT + S group had better preservation of skin features with some goblet cell openings and slight white patches. This study indicates that O. niloticus can benefit from sodium chloride during transportation, as it helps to reduce stress and inflammation, balance mineral levels, enhance health and immunity, and regulate mucous secretion.

Single cell analysis of short-term dry eye induced changes in cornea immune cell populations.

Dry eye causes corneal inflammation, epitheliopathy and sensorineural changes. This study evaluates the hypothesis that dry eye alters the percentages and transcriptional profiles of immune cell populations in the cornea. Desiccating stress (DS) induced dry eye was created by pharmacologic suppression of tear secretion and exposure to drafty low humidity environment. Expression profiling of corneal immune cells was performed by single-cell RNA sequencing (scRNA-seq). Cell differentiation trajectories and cell fate were modeled through RNA velocity analysis. Confocal microscopy was used to immunodetect corneal immune cells. Irritation response to topical neurostimulants was assessed. Twelve corneal immune cell populations based on their transcriptional profiles were identified at baseline and consist of monocytes, resident (rMP) and MMP12/13 high macrophages, dendritic cells (cDC2), neutrophils, mast cells, pre T/B cells, and innate (γDT, ILC2, NK) and conventional T and B lymphocytes. T cells and resident macrophages (rMP) were the largest populations in the normal cornea comprising 18.6 and 18.2 percent, respectively. rMP increased to 55.2% of cells after 5 days of DS. Significant changes in expression of 1,365 genes (adj p < 0.0001) were noted in rMP with increases in cytokines and chemokines (Tnf, Cxcl1, Ccl12, Il1rn), inflammatory markers (Vcam, Adam17, Junb), the TAM receptor (Mertk), and decreases in complement and MHCII genes. A differentiation trajectory from monocytes to terminal state rMP was found. Phagocytosis, C-type lectin receptor signaling, NF-kappa B signaling and Toll-like receptor signaling were among the pathways with enhanced activity in these cells. The percentage of MRC1+ rMPs increased in the cornea and they were observed in the basal epithelium adjacent to epithelial nerve plexus. Concentration of the chemokine CXCL1 increased in the cornea and it heightened irritation/pain responses to topically applied hypertonic saline. These findings indicate that DS recruits monocytes that differentiate to macrophages with increased expression of inflammation associated genes. The proximity of these macrophages to cornea nerves and their expression of neurosensitizers suggests they contribute to the corneal sensorineural changes in dry eye.

Genome-wide identification of the TIFY gene family in tobacco and expression analysis in response to Ralstonia solanacearum infection

The TIFY gene family plays an essential role in plant development and abiotic and biotic stress responses. In this study, genome-wide identification of TIFY members in tobacco and their expression pattern analysis in response to Ralstonia solanacearum infection were performed. A total of 33 TIFY genes were identified, including the TIFY, PPD, ZIM&ZML and JAZ subfamilies. Promoter analysis results indicated that a quantity of light-response, drought-response, SA-response and JA-response cis-elements exist in promoter regions. The TIFY gene family exhibited expansion and possessed gene redundancy resulting from tobacco ploidy change. In addition, most NtTIFYs equivalently expressed in roots, stems and leaves, while NtTIFY1, NtTIFY4, NtTIFY18 and NtTIFY30 preferentially expressed in roots. The JAZ III clade showed significant expression changes after inoculation with R. solanacearum, and the expression of NtTIFY7 in resistant varieties, compared with susceptible varieties, was more stably induced. Furthermore, NtTIFY7-silenced plants, compared with the control plants, were more susceptible to bacterial wilt. These results lay a foundation for exploring the evolutionary history of TIFY gene family and revealing gene function of NtTIFYs in tobacco bacterial wilt resistance.