Serum miR-122 Levels Research Articles

Serum microRNA‐21 is a novel biomarker in patients with esophageal squamous cell carcinoma

It was recently revealed that microRNAs (miRNAs) can stably exist in serum and may affect the pathogenesis of several diseases. However, there are few reports that have demonstrated the significance of miRNAs in the serum of patients with esophageal squamous cell carcinoma (ESCC). Thus, the aims of this study were to clarify the status of miRNA-21 in serum of ESCC patients and to reveal the usefulness of this molecule as a biomarker. We measured the miRNA-21 levels in serum samples from 71 ESCC patients and 39 healthy controls by using real-time RT-PCR. We also evaluated the changes in the miRNA-21 level during operation and chemotherapy. We found that serum concentration of miRNA-21 in ESCC patients was significantly higher than that in healthy controls (P < 0.001). A significant reduction in the serum miR-21 levels was observed in the postoperative samples versus the preoperative samples (P = 0.003). Furthermore, miRNA-21 levels were significantly reduced in ESCC patients who responded to chemotherapy (P = 0.003), whereas no significant change was observed in the non-responders. Serum miRNA-21 is considered to be a novel biomarker for diagnosing ESCC, and it can also be used as a response marker during chemotherapy for ESCC patients.

Diagnostic potential of PTEN-targeting miR-214 in the blood of breast cancer patients

MicroRNAs play a role in breast cancer development and progression by post-transcriptional repression of the expression of important genes, such as the tumor suppressor gene phosphatase and tensin homolog (PTEN). The focus of the current study was to examine the diagnostic potential of circulating cell-free microRNAs targeting PTEN in breast cancer. Our analyses were performed on preoperative serum samples of 102 patients with early breast cancer and a subset of 34 postoperative samples, as well as of 32 patients with benign breast disease and 53 healthy women. The relative concentrations of four circulating microRNAs (miR-19a, miR-20a, miR-21, and miR-214) in blood serum were measured by TaqMan MicroRNA assays. Levels of preoperative serum miR-20a and miR-21 were significantly higher in patients with breast cancer and benign disease than in healthy women (p = 0.0001), but only serum miR-214 could discriminate malignant from benign tumors and healthy controls (p = 0.0001) with an area under the curve of 0.878 and 0.883 in ROC analysis, respectively. Moreover, miR-214 levels significantly decreased in the postoperative serum samples (p = 0.0001) as compared to the preoperative samples. The comparison with the clinicopathologic data of the breast cancer patients showed that increased miR-214 levels were associated with a positive lymph node status (p = 0.039). Our data show that circulating, cell-free miR-214 has diagnostic potential in breast cancer as indicator of malignant disease and metastatic spread to regional lymph nodes. Since PTEN is an important target gene of miR-214, this finding could also have potential implications for therapeutic approaches.

Identification of Suitable Reference Genes for qPCR Analysis of Serum microRNA in Gastric Cancer Patients

Circulating microRNA expression profiles may be promising biomarkers for diagnosis and assessment of the prognosis of cancer patients. Quantitative polymerase chain reaction (qPCR) is a sensitive technique for estimating expression levels of circulating microRNAs. However, there is no current consensus on the reference genes for qPCR analysis of circulating microRNAs. In this study we tried to identify suitable reference genes for qPCR analysis of serum microRNA in gastric cancer patients and healthy individuals. Six microRNAs (let-7a, miR-16, miR-93, miR-103, miR-192, and miR-451) and RNU6B were chosen as candidate reference genes on the basis of the literature. Expression levels of these candidates were analyzed by qPCR in serum samples from 40 gastric cancer patients and 20 healthy volunteers. The geNorm, Normfinder, bestkeeper, and comparative delta-Ct method algorithms were used to select the most suitable reference gene from the seven candidates. This was then validated by normalizing the expression levels of serum miR-21 across all gastric cancer patients and healthy volunteers. The algorithms revealed miR-16 and miR-93 were the most stably expressed reference genes, with stability values of 1.778 and 2.213, respectively, for serum microRNA analysis across all the patients and healthy controls. The effect of different normalization strategies was compared; when normalized to the serum volume there were no significant differences between patients and controls. However, when the data were normalized to miR-93, miR-16, or miR-93 and miR-16 combined, significant differences were detected. Our results demonstrated that reference gene choice for qPCR data analysis has a great effect on the study outcome, and that it is necessary to choose a suitable reference for reliable expression data. We recommend miR-16 and miR-93 as suitable reference genes for serum miRNA analysis for gastric cancer patients and healthy controls.

P3-03-02: Higher Expression Levels of Circulating miR-21, miR-19a and miR-10b Are Associated with High Risk Features in Breast Cancer.

Abstract Background: MicroRNAs (miRs) have oncogenic and tumor-suppressor functions. MiR-21, miR-19a and miR-10b are overexpressed in breast cancer and regulate tumor cell migration, invasion and angiogenesis. We assessed the levels of miR-21, -19a, and -10b in sera of breast cancer patients and their association with the stage, histological type, hormonal receptor (HR) status and HER2 amplification in the primary tumor. Since circulating tumor cells (CTC) detected by CellSearch® are an independent and strong predictor of overall survival in metastatic breast cancer (MBC), we assessed the relationship between circulating miRs and CTCs. Methods: The study consisted of 30 healthy donors (HD) and 95 breast cancer (BC) patients. Patients’ sera were collected before starting a new line of treatment. Total RNA was isolated, reverse transcribed to cDNA and then subjected to qRT-PCR for the detection of miR-21, -19a, -10b and -192 using the TaqMan MicroRNA Assay (Applied Biosystems, Foster City, CA). Mir-192 was used to normalize the expression levels of the other miRs. Fold-changes in expression of miRs were calculated using the 2−DCt method, where DCt= mean CTtarget-miRNA -mean CTmiR-192. CTCs were enumerated using CellSearch™ (Veridex LLC, Warren, NJ). Mann-Whitney U test was used to determine differences in serum miR expression levels between patients and HD. Results: Of the 95 BC patients, 39 were non-MBC and 56 MBC. Patients grouped according to the receptor expression by immunohistochemical staining consisted of 27 HR+HER2−, 30 HR+HER2+, 20 HRHER2+, and 18 HRHER2− triple negative BC (TNBC). MiR-21 and miR-19a were higher in non-MBC patients than in HD (p=.001, p&amp;lt;.001, respectively). MiR-21, miR-19a and miR-10b levels were higher in metastatic patients than in HD (p&amp;lt;.001, p&amp;lt;.001, p=.038, respectively). MBC patients had a higher median level of miR-21 than that of non-MBC patients (p=.02). Patients with (HR+HER2+, HR−HER2+, TNBC) had significantly higher median levels of both miR-21 (p=.018; p=.009; p=.045) and miR-10b (p=.011; p=.014; p=.03) compared with HR+HER2− BC. HER2+ patients had higher median levels of both miR-21 and miR-10b than those of HER2− BC (p=.033; p=.01) and HD (p&amp;lt;.001; p=.009). Further, median miR-19a expression was higher in IBC patients than in non-IBC patients (p=.025). Finally, patients with &amp;lt;5 CTCs had a higher median expression level of miR-10b than that of patients with ≥5 CTCs (p=.042). Discussion: High expression levels of miR-21, miR-19a and miR-10b in sera are observed in breast cancer patients, especially with advanced disease. HER2+ BC patients had higher serum levels of miR-21 and miR-10b than HER2−. IBC patients had a higher serum level of miR-19a than non-IBC patients. Moreover, patients with &amp;lt;5 CTCs had high serum levels of miR-10b that can be induced by Twist1 during the epithelial-mesenchymal transition (EMT) and, in part, explain the inability of CellSearch® to detect CTCs undergoing EMT. Citation Information: Cancer Res 2011;71(24 Suppl):Abstract nr P3-03-02.

Circulating Exosomal MicroRNA-21 As a Potential Biomarker That May Predict Response to Azacitidine Treatment in Myelodysplastic Syndromes,

Abstract 3804Prognostic factors for response and survival in patients with myelodysplastic syndromes (MDS) treated with azacitidine (AZA) remain largely unknown. Identification of molecular biomarkers in MDS is needed to predict clinical outcomes and help stratify MDS patients for epigenetic therapy. MicroRNA(miR)-21 has been recognized to be implicated in carcinogenesis, resistance to chemotherapy, and regulation of DNA methylation. A several prognostic studies found that a higher miR-21 expression was significantly associated with advanced diseases and worse outcomes in a variety of cancers. MicroRNA profiling of circulating tumor exosomes could potentially be used as surrogate diagnostic markers. Therefore, we evaluated the expression level of miR-21 in exosomes isolated from sera of patients with MDS and analyzed the association between exosomal miR-21 level and the response to AZA treatment and prognosis. Among 63 MDS cases enrolled in this study, WHO classification was RA/RARS in 19.1%, RCMD in 31.7%, RAEB-1 in 19.1%, RAEB-2 in 19.1%, and MDS-U in 11.0%. IPSS risk group was low in 7.5%, intermediate-1 in 60.3%, intermediate-2 in 28.6%, and high in 3.2%. AZA was administered subcutaneously with an initial dose of 75 mg/m2/day for 7 days every 28 days. Patients received AZA for a median of 6 cycles (range, 1–12). Response was evaluated after 4 cycles of AZA by blood count, marrow study, and cytogenetic analysis. CR, PR, marrow CR, stable disease (SD), hematologic improvement (HI), and progression were defined according to IWG 2006 criteria. Total RNA was isolated from exosomes, which were obtained from patients’ serum using the Exoquick exosome precipitation solution. Serum was obtained at initial diagnosis, and after 4th, 8th cycles of AZA treatment. Quantitative RT-PCR was performed using SYBRRRT-PCR method. miR-21 primer was: forward GCCCGCTAGCTTATCAGACTGATG, reverse GTGCAGGGTCCGAGGT. RNU6B was taken as reference gene for exosomal miR normalization. Relative level of the circulating miR-21 was determined using the comparative CT (2−ΔΔCT) formula. With AZA treatment, the overall response rate was 58.7% (CR in 9.5%, PR in 3.2%, and HI in 46.0%). Baseline level of serum exosomal miR-21 was significantly higher in MDS patients compared with healthy volunteers (p <0.001). Serum miR-21 level was independent of age, sex, and IPSS risk group. Circulating miR-21 level prior-AZA therapy was significantly higher in the non-responder group compared to the AZA responder group (CR/PR/HI) (466.1±127.3 vs 31.8±14.3, p <0.001). The cut-off level of higher miR-21 was determined by ROC analysis. The response rate (including HI) was significantly lower in the higher miR-21 patients group (p< 0.005). We found that patients with higher level of circulating exosomal miR-21, compared with patients with lower level, had a significantly shorter median overall survival (10.7 vs 22.8 month, respectively, p =0.001) and significantly shorter median progression-free survival (14.0 vs 20.0 months, respectively, p =0.003). In multivariate analysis, high miR-21 level prior to AZA treatment was an independent risk factor for lower overall survival (hazard ratio 16.12, 95% CI 1.64–159.2, p< 0.01). We demonstrated for the first time that the circulating exosomal miR-21 is upregulated in MDS and its levels can be considered as a potential biomarker that may predict response to AZA treatment. Although the clinical potentiality of circulating exosomal miR-21 as biomarker in MDS will be prospectively validated in a large cohort of patients, these findings may be useful for directing AZA treatment, leading to improving treatment response and outcomes. Disclosures:No relevant conflicts of interest to declare.

Serum MicroRNA-21 as Marker for Necroinflammation in Hepatitis C Patients with and without Hepatocellular Carcinoma

BackgroundMicroRNA-21 (miR-21) is up-regulated in tumor tissue of patients with malignant diseases, including hepatocellular carcinoma (HCC). Elevated concentrations of miR-21 have also been found in sera or plasma from patients with malignancies, rendering it an interesting candidate as serum/plasma marker for malignancies. Here we correlated serum miR-21 levels with clinical parameters in patients with different stages of chronic hepatitis C virus infection (CHC) and CHC-associated HCC.Methodology/Principal Findings62 CHC patients, 29 patients with CHC and HCC and 19 healthy controls were prospectively enrolled. RNA was extracted from the sera and miR-21 as well as miR-16 levels were analyzed by quantitative real-time PCR; miR-21 levels (normalized by miR-16) were correlated with standard liver parameters, histological grading and staging of CHC. The data show that serum levels of miR-21 were elevated in patients with CHC compared to healthy controls (P<0.001); there was no difference between serum miR-21 in patients with CHC and CHC-associated HCC. Serum miR-21 levels correlated with histological activity index (HAI) in the liver (r = −0.494, P = 0.00002), alanine aminotransferase (ALT) (r = −0.309, P = 0.007), aspartate aminotransferase (r = −0.495, P = 0.000007), bilirubin (r = −0.362, P = 0.002), international normalized ratio (r = −0.338, P = 0.034) and γ-glutamyltransferase (r = −0.244, P = 0.034). Multivariate analysis revealed that ALT and miR-21 serum levels were independently associated with HAI. At a cut-off dCT of 1.96, miR-21 discriminated between minimal and mild-severe necroinflammation (AUC = 0.758) with a sensitivity of 53.3% and a specificity of 95.2%.Conclusions/SignificanceThe serum miR-21 level is a marker for necroinflammatory activity, but does not differ between patients with HCV and HCV-induced HCC.

Circulating microRNAs as potential markers of human drug-induced liver injury

New biomarkers of liver injury are required in the clinic and in preclinical pharmaceutical evaluation. Previous studies demonstrate that two liver-enriched microRNAs (miR-122 and miR-192) are promising biomarkers of acetaminophen-induced acute liver injury (APAP-ALI) in mice. We have examined these molecules, for the first time, in humans with APAP poisoning. Serum miR-122 and miR-192 were substantially higher in APAP-ALI patients, compared to healthy controls (median ΔΔCt [25th, 75th percentile]) (miR-122: 1,265 [491, 4,270] versus 12.1 [7.0, 26.9], P < 0.0001; miR-192: 6.9 [2.0, 29.2] versus 0.44 [0.30, 0.69], P < 0.0001). A heart-enriched miR-1 showed no difference between APAP-ALI patients and controls, whereas miR-218 (brain-enriched) was slightly higher in the APAP-ALI cohort (0.17 [0.07, 0.50] versus 0.07 [0.04, 0.12]; P = 0.01). In chronic kidney disease (CKD) patients, miR-122 and -192 were modestly higher, compared to controls (miR-122: 32.0 [21.1, 40.9] versus 12.1 [7.0, 26.9], P = 0.006; miR-192: 1.2 [0.74, 1.9] versus 0.44 [0.30, 0.69], P = 0.005), but miR-122 and -192 were substantially higher in APAP-ALI patients than CKD patients (miR-122: P < 0.0001; miR-192: P < 0.0004). miR-122 correlated with peak ALT levels in the APAP-ALI cohort (Pearson R = 0.46, P = 0.0005), but not with prothrombin time. miR-122 was also raised alongside peak ALT levels in a group of patients with non-APAP ALI. Day 1 serum miR-122 levels were almost 2-fold higher in APAP-ALI patients who satisfied King's College Criteria (KCC), compared to those who did not satisfy KCC, although this did not reach statistical significance (P = 0.15). This work provides the first evidence for the potential use of miRNAs as biomarkers of human drug-induced liver injury.

Serum microRNA‐122 levels in different groups of patients with chronic hepatitis B virus infection

miR-122 is a liver-specific microRNA, which also circulates in the blood. The levels of miR-122 in serum and plasma correlate with hepatic necroinflammation in patients with hepatitis B virus (HBV) infection. Here, we investigated whether miR-122 levels correlate with surrogate markers for viral replication and translation. Furthermore, we examined whether miR-122 levels differ in the different groups of HBV-infected patients and whether miR-122 levels may be useful to identify patients with higher or lower risk for liver disease progression. Therefore, RNA was extracted from sera of therapy-naïve patients with HBV infection (n = 89) and from healthy volunteers (n = 19). The concentration of miR-122 was assessed by quantitative real-time reverse-transcription PCR. HBs antigen and HBV DNA levels were quantified as surrogate parameters for HBV replication and translation. Liver biopsies were examined according to the histological activity index and the degree of fibrosis was assessed. We found that the miR-122 serum concentration correlated with the level of ALT, HBV DNA and HBs antigen (r = 0.259, P < 0.05; r = 0.225, P < 0.05; r = 0.508, P < 0.001, respectively). The miR-122 serum levels discriminated the different patient groups infected with HBV from healthy subjects (P < 0.001), and inactive carrier patients with high (>3500 IU/mL) or low (<3500 IU/mL) levels of HBs antigen could be differentiated by the miR-122 serum concentration (P < 0.05). As serum miR-122 levels strongly correlated with HBs antigen, it might be an indicator for viral translation. Furthermore, serum miR-122 levels discriminated HBV carrier patients with high or low risk for disease progression and may, thus, be an additional marker for risk stratification.

Circulating MicroRNAs in Patients with Chronic Hepatitis C and Non-Alcoholic Fatty Liver Disease

MicroRNAs miR-122, miR-34a, miR-16 and miR-21 are commonly deregulated in liver fibrosis and hepatocellular carcinoma. This study examined whether circulating levels of these miRNAs correlate with hepatic histological disease severity in patients with chronic hepatitis C infection (CHC) or non-alcoholic fatty-liver disease (NAFLD) and can potentially serve as circulating markers for disease stage assessment. We first used an in vitro model of hepatitis C virus (HCV) infection to measure the extracellular levels of these four miRNAs. Whereas miR-21 extracellular levels were unchanged, extracellular levels of miR-122, miR-34a and to a lesser extent miR-16, steadily increased during the course of HCV infection, independently of viral replication and production. Similarly, in CHC patients, serum levels of miR-122, miR-34a and miR-16 were significantly higher than in control individuals, while miR-21 levels were unchanged. There was no correlation between the serum levels of any of these microRNAs and HCV viral loads. In contrast, miR-122 and miR-34a levels positively correlated with disease severity. Identical results were obtained in an independent cohort of CHC patients. We extended the study to patients with NAFLD. As observed in CHC patients, serum levels of miR-122, miR-34a and miR-16 were significantly higher in NAFLD patients than in controls, while miR-21 levels were unchanged. Again, miR-122 and miR-34a levels positively correlated with disease severity from simple steatosis to steatohepatitis. In both CHC and NAFLD patient groups, serum levels of miR-122 and miR-34a correlated with liver enzymes levels, fibrosis stage and inflammation activity. miR-122 levels also correlated with serum lipids in NAFLD patients. Conclusion: Serum levels of miR-34a and miR-122 may represent novel, noninvasive biomarkers of diagnosis and histological disease severity in patients with CHC or NAFLD.

Serum miR-122 as a Biomarker of Necroinflammation in Patients With Chronic Hepatitis C Virus Infection

The liver contains large amounts of microRNA-122 (miR-122), whereas other tissues contain only marginal amounts of this miRNA. MicroRNAs have also been found to circulate in the blood in a cell-free form; their potential as readily accessible disease markers is currently evaluated. Here, we investigated if the serum levels of miR-122 might be useful as disease parameter in patients with chronic hepatitis C virus (HCV) infection. RNA was extracted from sera of patients with chronic HCV infection (CHC) and healthy controls and was analyzed for miR-22 content by quantitative real-time reverse-transcription polymerase chain reaction. miR-122 serum levels were correlated with standard parameters of liver function. Liver biopsies from the same patients were examined for the histologic activity index (HAI) and the degree of fibrosis. Sera from patients with CHC contained higher levels of miR-122 than sera from healthy controls. Serum miR-122 levels correlated well with markers of liver inflammatory activity, that is, the serum levels of alanine leucine transaminase (ALT) and aspartate transaminase, and the HAI score. In patients with persistently normal ALT levels, serum miR-122 levels did not differ from healthy controls. There was no correlation of serum miR-122 levels with serum albumin, international normalized ratio, liver fibrosis, or serum HCV RNA. The serum level of miR-122 strongly correlates with serum ALT activity and with necroinflammatory activity in patients with CHC and elevated ALT levels, but not with fibrosis stage and functional capacity of the liver.

Abstract 1155: Serum microRNA-21 is a novel biomarker in patients with esophageal squamous cell carcinoma

Abstract Backgrounds and objective: Esophageal squamous cell carcinoma (ESCC) is one of the most difficult malignancies to be cured among gastrointestinal tract cancers. Recently, it was revealed that microRNAs stably exist in serum and may affect pathogenesis of several diseases. However, there are only a few reports that have demonstrated the significance of microRNA (mir) in the serum of patients with ESCC. Accordingly, the aims of this study were to clarify the status of mir-21 in the serum of ESCC patients and to reveal the usefulness of this molecule as a biomarker. Patients and methods: Serum samples were obtained from 52 patients diagnosed with ESCC, as well as from 17 “control” patients diagnosed with gallstones, without active inflammation, in Kumamoto University Hospital from 2008 to 2010. Pre-treatment serum samples were collected during diagnostic studies. Thirty-two ESCC patients received induction chemotherapy using the Docetaxel/ cisplatin /5-Fluorouracil (DCF) regimen (60 mg/m2 Docetaxel on day 1; 350 mg/m2 5-Fluorouracil and 6 mg/m2 cisplatin on days 1-5; 2 courses) after being diagnosed with node-positive ESCC. Twenty-four pairs of serum samples before and after chemotherapy were collected. The expression of miR-21 was determined by qRT-PCR using TaqMan microRNA assay Kits® (Applied Biosystems, USA). Results: The results of qRT-PCR analysis indicated that the ESCC patients had significantly higher levels of serum miR-21 than the control patients (P = 0.007). The value of area under the receiver operating characteristic curve was 0.885 for microRNA-21. When the patients were divided into two groups according to tumor size (≥40mm vs. &amp;lt;40mm), we found that the patient group with the larger tumors exhibited significantly higher levels of miR-21 than the patients with small-sized tumors. We examined the expression levels of miR-21 in the paired (pre- and post-therapy) serum samples of 24 patients who were treated with chemotherapy. The miR-21 expression levels in the patients’ post-chemotherapy samples were significantly reduced compared to the corresponding levels in the pre-chemotherapy samples (P=0.009). When the patient response to cancer chemotherapy was evaluated by RECIST v. 1.0, we found a significant decrease in the miR-21 expression levels in the Complete Response /Partial Response patients, whereas no significant decrease occurred in the levels in Stable Disease/ Progressive Disease patients (P = 0.003 versus N.S). Conclusion:Serum microRNA-21 is considered to be a novel biomarker for diagnosing ESCC, and it can also be used as a response marker during chemotherapy for ESCC patients. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 102nd Annual Meeting of the American Association for Cancer Research; 2011 Apr 2-6; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2011;71(8 Suppl):Abstract nr 1155. doi:10.1158/1538-7445.AM2011-1155

The circulating microRNA-221 level in patients with malignant melanoma as a new tumor marker

MicroRNA-221 (miR-221) is known to be abnormally expressed in malignant melanoma (MM) cells, and it favors the induction of the malignant phenotype through down-modulation of p27Kip1/CDKN1B and the c-KIT receptor. This suggests that the serum level of miR-221 might increase in patients with MM and thus could be used as a new tumor marker. To evaluate the possibility that the serum miR-221 level can be a marker of MM. Serum samples were obtained from 94 MM patients and 20 healthy controls. MicroRNAs were purified from serum, and miR-221 levels were measured by quantitative real-time polymerase chain reaction. Circulating miR-221 was detectable and could be quantified in serum samples. MM patients had significantly higher miR-221 levels than healthy controls. Among the MM patients, the miR-221 levels were significantly increased in patients with stage I-IV MM compared to those with MM in situ, and the levels were correlated with tumor thickness. Moreover, a longitudinal study revealed a tendency for the miR-221 levels to decrease after surgical removal of the primary tumor, and to increase again at recurrence. Serum levels of miR-221 were significantly increased in MM patients and may be useful not only for the diagnosis of MM, but also for the differentiating MM in situ from stage I-IV MM, and for evaluating tumor progression and monitoring patients during the follow-up period. In addition, considering that the serum levels of miR-221 were correlated with tumor thickness, miR-221 might also be useful as a prognostic marker for patients with MM.

LNA Anti-Microrna-155: a Novel Therapeutic Strategy In Waldenstrom Macroglobulinemia and Chronic Lymphocytic Leukemia

AbstractAbstract 4914 Background.We and others have previously demonstrated that microRNA-155 (miR-155) is overexpressed in patients with Waldenstrom's Macroglobulinemia (WM) and Chronic lymphocytic leukemia (CLL) compared to healthy subjects; indicating that miR-155 may play a crucial role in regulating the pathogenesis of these diseases. We therefore evaluated the role of the novel locked nucleic acid (LNA) antimiR against miR-155 in WM and CLL-derived cell lines. Methods.WM and CLL-derived cell lines (BCWM.1, MEC1) have been treated with 20μM antisense LNA antimiR-155 or scramble probe (Santaris Pharma, Hørsholm, Denmark). Efficiency of delivered LNA oligos into cells was determined by using FAM-labeled LNA, followed by Flow cytometry (FACS). Survival and cell proliferation were assessed by MTT assay and thymidine uptake, respectively. Serum levels of miR-155 from peripheral blood of WM patients or healthy subjects and the level of miR-155-targeted genes were detected by quantitative RT-PCR (qPCR). Results.Efficiency of delivered LNA oligos into both WM and CLL-derived cell lines was higher than 90%. LNA antimiR-155 reduced proliferation of WM and CLL-derived cell lines, as compared to LNA scramble probe used as a control. In contrast, LNA antimiR-155 did not exert any effect on survival of them. We demonstrated increased expression of miR-155-targeted genes, such as CEBPβ, SOCS1, and TP53DINP1 in WM cells upon LNA antimiR-155 treatment. Moreover, we found miR-155 could be detected in peripheral blood serum of WM patients, but not the serum of healthy subjects. Summary.These data provide preclinical evidence for using the novel antisense LNA antimiR-155 in WM and CLL. Moreover, serum levels of miR-155 could potentially be used as a biomarker in patients with WM. Disclosures:No relevant conflicts of interest to declare.

Serum miRNA‐21: Elevated levels in patients with metastatic hormone‐refractory prostate cancer and potential predictive factor for the efficacy of docetaxel‐based chemotherapy

miR-21 has been recognized as an "onco-microRNA" with the activity of negatively modulating the expression of tumor-suppressor genes. However, its role in prostate cancer (CaP) has not been well-documented. We designed this study to assess the potential function of serum miR-21 in the progression of CaP. Serum samples of 56 patients, including 20 patients with localized CaP, 20 with androgen-dependent prostate cancer (ADPC), 10 with hormone-refractory prostate cancer (HRPC), and 6 with benign prostatic hyperplasia (BPH), were collected for the measurement of miR-21. The 10 HRPC patients were administered docetaxel-based chemotherapy. Quantification of miR-21 was assayed by specific TaqMan qRT-PCR. Serum miR-21 level was found to correlate to serum PSA level in patients with ADPC and HRPC, P = 0.012 and 0.049, respectively. There was no significant difference in serum miR-21 level between BPH, localized CaP and ADPC with PSA level <4 ng/ml. Higher levels of miR-21 were detected in patients with HRPC and ADPC with PSA level >4 ng/ml. Six of the 10 HRPC patients reached partial remission with a decreased PSA level of >50% after chemotherapy. Serum miR-21 levels were higher in patients who were resistant to docetaxel-based chemotherapy when compared to those sensitive to chemotherapy, P = 0.032. Serum miR-21 levels are elevated in HRPC patients, especially in those resistant to docetaxel-based chemotherapy. It may be applicable as a marker to indicate the transformation to hormone refractory disease, and a potential predictor for the efficacy of docetaxel-based chemotherapy.