ITS rDNA Sequences Research Articles

Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd (Luffa cylindrica) in Yunnan Province, China.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 μm (352.8 to 436.7 μm), stylet = 18.6 ± 0.5 μm (17.6 to 19.4 μm), tail length= 25.9 ± 2.2 μm (20.1 to 29.9 μm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 μm (368.1 to 463.9 μm), stylet = 12.8 ± 0.8 μm (11.2 to 14.1 μm), tail length= 26.3 ± 1.8 μm (24.3 to 29.4 μm), spicule = 20.6 ± 0.9 μm (19.6 to 22.7 μm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.

Molecular characterization of anopheline mosquitoes from the goat malaria-endemic areas of Thailand.

Despite the fact that over a 100 anopheline mosquito species have been identified as human malaria vectors, little is known about ungulate malaria vectors. Consequently, we focused on investigating the bionomics and genetic characterizations of anopheline mosquitoes in goat malaria-endemic regions. We also attempted to screen for ungulate malaria potential vectors. A total of 1019 female anopheline mosquitoes were collected from six goat farms in four provinces of Thailand from 2020 to 2021. Mosquitoes were morphologically identified and subsequently confirmed using the mitochondrial DNA barcoding region-cytochrome oxidase c subunit I (MtDNA-COI), mitochondrial DNA-cytochrome c oxidase subunit II (MtDNA-COII), and ribosomal DNA internal transcribed spacer 2 (rDNA-ITS2) sequences. The current study reveals the genetic characteristics and distribution of nine mosquito species within the Anopheles and Cellia subgenera. Four dominant species, including Anopheles peditaeniatus, Anopheles subpictus, Anopheles vagus, and Anopheles aconitus exhibited significant intraspecific gene flow within their corresponding species. Although malaria parasites were not found in 126 mosquito pools, meaning more investigation is necessary, the current study adds to the existing DNA barcoding data collection and improves the current understanding of the genetic structure and distribution of anopheline mosquito species, which could be useful for effective control of mosquito-borne diseases.

First Detection of Wilsonomyces carpophilus Causing Leaf Spot and Shot Hole Disease on Vitis vinifera

Grapevines ( Vitis spp.) are cultivated all over the world and viticulture is a horticultural industry. During the spring of 2020, leaf samples with leaf spot and shot-hole symptoms were collected from the vineyards of Urmia county, West Azerbaijan province, Iran. One fungal isolate was recovered from infected tissues. Based on cultural and morphological features, ITS rDNA sequence data, and a generated phylogenetic tree, the obtained fungal isolate was identified as Wilsonomyces carpophilus. Under in vitro conditions, the colony was white to cream colored, sporulation occurred only in a minor proportion of the colony, and the diameter of the colony on potato dextrose agar reached 44 mm after 14 days. To evaluate Koch's postulates, isolate NSS18 was inoculated on leaves of the Chafteh cultivar of grapevine and the same fungus was reisolated from developed symptoms. This is the first report of leaf spot and shot-hole disease on grapevine caused by W. carpophilus, and also Vitis vinifera is a new host for this species in the world.

The parasites of a successful invader: monogeneans of the Asian topmouth gudgeon Pseudorasbora parva, with description of a new species of Gyrodactylus.

Monogenean parasites are often co-introduced with their fish hosts into novel areas. This study confirmed co-introduction of two dactylogyrids, Dactylogyrus squameus Gusev, 1955 and Bivaginogyrus obscurus (Gusev, 1955), and a newly described gyrodactylid species, Gyrodactylus pseudorasborae n. sp. into Europe along with their fish host, the invasive topmouth gudgeon Pseudorasbora parva (Temminck & Schlegel) from East Asia. All three species were observed in the lower Dnieper and middle Danube basin regions and had slightly larger haptoral hard parts than the same parasites in their native range. While dactylogyrids occurred sporadically, we recorded regular infection by G. pseudorasborae n. sp. at relatively high prevalence and abundance. This latter species was observed in both the native and non-native range of topmouth gudgeon, and resembles Gyrodactylus parvae You et al., 2008 recently described from P. parva in China. Both species were distinguished based on genetic analysis of their ITS rDNA sequence (6.6% difference), and morphometric differences in the marginal hooks and male copulatory organ. Phylogenetic analysis of dactylogyrid monogeneans showed that B. obscurus clustered with Dactylogyrus species parasitising Gobionidae and Xenocyprididae, including D. squameus, supporting recent suggestions of a paraphyletic origin of the Dactylogyrus genus. In addition to co-introduced parasites, topmouth gudgeon was infected with a local generalist, G. prostae Ergens, 1964, increasing the number of monogeneans acquired in Europe to three species. Nevertheless, monogenean infections were generally lower in non-native host populations, potentially giving an advantage to invading topmouth gudgeon.

MORPHOLOGICAL AND MOLECULAR IDENTIFICATION OF AN EDIBLE RUSSULA MUSHROOM IN NORTHEAST VIETNAM

Wild mushrooms are extensively gathered by rural communities throughout the uplands of northern Vietnam and nearby countries for food and medicine. These non-wood forest products are important for the livelihood of numerous rural communities. Many of these fungi form symbiotic relationships with the roots of certain species of forest trees, and the fruiting bodies can not be produced in artificial media. In the northeast region of the country, an edible red Russula (Nấm chẹo or Nấm hồng cô) has been harvested from under wild Castanopsis, Engelhardia and Lithocarpus trees by local people for a long time. However, the identity of this Russula is unknown. We collected basidiomes of this edible Russula in Cao Bang, Bac Giang and Quang Ninh provinces and described its morphological features. We used ITS rDNA and LSU rDNA sequence analysis to compare with other similar taxa in GenBank. Morphological and molecular analysis identified the taxon as Russula griseocarnosa, previously described from southern Yunnan, China. There is strong interest by local governments to commercialize R. griseocarnosa in Vietnam. However, over-harvesting could have detrimental effects on the population of this edible species. Therefore, further studies are needed to quantify the ecological requirements and to develop sustainable harvesting protocols of this edible species in Vietnam.

First report of Lasiodiplodia theobromae associated with panicle blight of grapes (Vitis vinifera L.) in India.

Grape (Vitis vinefera L.) is a popular horticulture crop in Karnataka, India. A fungal pathogen caused panicle blight on panicles with immature fruit and severity increased subsequently in the grape growing regions of Devanahalli and Doddaballapur, Karnataka, between August and September 2019. The disease incidence varied from 15 to 18 percent in around 45 hectares of grape vineyards surveyed. The associated fungal pathogen was isolated on Potato Dextrose Agar (PDA) medium (HiMedia Laboratory, Mumbai, India) amended with Chloramphenicol. A total of 12 fungal isolates were obtained and identified based on morphology. Fungal cultures obtained from all the panicle blight affected samples were fluffy grayish to black with profuse, dense mycelium. Microscopic examinations revealed that the conidia ellipsoidal, two celled and hyaline when young, and developed dark brown pigments at maturity. Mature conidia measured 18.24±2.35 to 26.62±3.11 μm long and 10.32±1.08 to 12.57±1.82 μm width (n=30). The fungal pathogen was identified as a Lasiodiplodia sp. based on colony morphology and microscopic features. A total of three representative isolates L. theobromae (Vv12, Vv15, and Vv19) were selected for molecular identification based on ITS-rDNA, tub2 and EF-1α gene sequences and phylogenetic analysis. Genomic DNA was isolated from 12 day old cultures and ITS-rDNA, tub2 and EF-1α genes were amplified using ITS1/ITS4; Bt2a/Bt2b and EF1-728F/986R primer pairs, respectively (White et al., 1990; Glass and Donaldson, 1995, Carbone and Kohn, 1999). PCR amplicons were sequenced and the sequences were deposited in GenBank with the accession number ITS: MZ855866.1; MZ855867.1; MZ855868.1; tub2: MZ868708.1; MZ868709.1; MZ868710.1 and EF-1α: OM604750; OM604751; OM604752 respectively. The phylogeny was constructed based on combined ITS, EF-1α and the tub2 regions. Maximum Likelihood (ML) analysis was conducted and an ML tree was constructed with the substitution models (branch support was evaluated by 1,000 bootstrap replications). Combined phylogeny confirmed that the sequences shared a common clade with L. theobromae. Based on micro-morphological features and multi-locus sequence phylogeny, the associated fungal pathogen was identified as L. theobromae. There are no reports on the occurrence of L. theobromae causing panicle blight on grapes from India. Further, the pathogens association was confirmed through pathogenicity assay conducted on field harvested healthy bunches of grapes maintained under humid chamber. A total of 10 grape bunches were inoculated with a mycelial disc on the rachis of the panicle and incubated in a moist chamber for 5 days and control sets were inoculated with only agar plugs. The experiments were conducted in three replicates and repeated twice. A total of 21 panicle bunches developed typical rot symptoms 12-days post inoculation. The identity of the pathogen was confirmed based on micromorphology and cultural features after re-isolation (n=5), thus proving the Koch postulates and confirming the association of L. theobromae with panicle blight of grapes. Lasiodiplodia species are known to cause dieback, stem blight, leaf blights and spots on various crop plants. Mathur (1979) mentioned the occurrence of L. theobromae on grapes, however, no further details are available on the part associated, as well as morphological and molecular confirmation of L. theobromae. This is the first report of the L. theobromae causing panicle blight disease of grapes in India. Further, understanding the host range for L. theobromae and its variation will help to draw suitable disease management strategies.

Павлодар аймағындағы Anopheles maculipennis кешені безгек масаларын (Diptera, Culicidae: Anopheles) PCR-RFLP негізінде түрге дейін анықтау

This article discusses methods for determining the genetic polymorphism of malaria mosquitoes of the Anopheles maculipennis complex. AN identification of similar species of the maculipennis complex was carried out by the PCR-RFLP method using the second internal transcribed spacer of the ITS2 ribosomal gene cluster. Based on the analysis of the ITS2 rDNA sequence, new Palearctic species were discovered in this collection: An. persiensis (Sedaghatetal., 2003), An. daciae (Nicolescu et al., 2004) and An. artemievi (Gordeev et al., 2004). Previously, a cytogenetic method was used on the territory of Kazakhstan, which included chromosomal polymorphism. It is found in the south of the range of this species (Stegny, 1991; Gordeev and Sibataev, 1996). In populations of malarial mosquitoes of An. messeae of Kazakhstan, new chromosomal inversions have been identified that are not characteristic of this region (Abylkasymova et al., 2019). There is also provided some information about the bioecology and harmful nature of Anopheles messeae mosquitoes. Bloodsucking mosquitoes of the Anopheles maculipennis complex are of great scientific and practical interest since they are known as active bloodsuckers and carriers of pathogens of a number of dangerous human and animal diseases. Based on their own research and literature data, were collected materials on the biology and ecology of Anopheles messeae mosquitoes of the Irtysh River basin. Data on the prevalence and landscape location of mosquitoes in the Maculipennis complex, there are presented seasonal dynamics and daily rhythm of abundance, and harmful value.

Phenotypic and Molecular Identification of Green Pea Powdery Mildew Pathogen from Alborz, Iran

Green pea (Pisum sativum.) is an important consumable vegetable crop worldwide rich in protein, vitamins, and nutrition. It is cultivated in many parts of Iran, particularly during the summer season, and recently under protected greenhouse. Powdery mildew is an important disease of green pea, especially during the pod fill and maturation stage and decreases the photosynthetic area of leaves which causes crop loss. This experiment was conducted in order to identify fungi associated with powdery mildews on some accessions under regeneration of green pea collection at the genetic department and national plant gene bank of Iran, seed, and plant improvement institute during the year 2021. Powdery mildew became epidemic on the plants at the pod stage from the end of July to August. The formation of white, floury patches initially on the leaf progressing towards tendrils, pods, and stems observed that on susceptible accessions covered the most aerial part of the plants. The Erysiphe pisi, Erysiphe trifolii and Erysiphe baeumleri were reported causing disease on pea. The infected plant samples were collected and transferred to the lab for morphological studies, then, the genomic DNA was isolated and used for amplification and sequencing using the internal transcribed spacers (ITS) regions. Based on morphological characteristics of asexual and sexual stages as well as rDNA-ITS sequence analyses, the fungus was identified as Erysiphe pisi. Due to the presence of accessions with high levels of resistance to this disease, further investigation is recommended to breed resistant cultivars for cultivation in this province.

Identification of Panax spp. in the Northern Vietnam based on ITS-rDNA sequence analysis

In order to accurately identify ginseng species (Panax spp.) that grow naturally in some Northern provinces of Vietnam, we collected 30 natural ginseng samples and used nuclear genetic region (ITS-rDNA) for current analysis. The success rate for nuclear genomic region PCR (ITS-rDNA) amplification is 100%. The bidirectional sequence read success rate obtained from the PCR product was 100%, with a nucleotide sequence length of 588 bp. Based on the analysis of ITS-rDNA region results, the samples of ginseng species from Tuyen Quang and Cao Bang provinces have a close relationship with Panax notoginseng (MLBS = 100%), while the samples of ginseng species from Ha Giang and Yen Bai provinces have a close relationship with P. stipuleanatus (MLBS = 99%). As the results, the ginseng samples from Tuyen Quang and Cao Bang provinces were identified as Panax notoginseng and the ginseng samples from Ha Giang and Yen Bai provinces were identified as Panax stipuleanatus. The obtained result also recorded new distribution areas of P. notoginseng in Tuyen Quang and Cao Bang provinces. Furthermore, we successfully registered the nuclear nucleotide sequences of these two Panax species on GenBank with 24 codes (from OM190408 to OM190410, from OM213014 to OM213030, and from OK376138 to OK376141).

Population Genetics and Anastomosis Group's Geographical Distribution of Rhizoctonia solani Associated with Soybean.

Rhizoctonia solani is a species complex composed of many genetically diverse anastomosis groups (AG) and their subgroups. It causes economically important diseases of soybean worldwide. However, the global genetic diversity and distribution of R. solani AG associated with soybean are unknown to date. In this study, the global genetic diversity and distribution of AG associated with soybean were investigated based on rDNA-ITS sequences deposited in GenBank and published literature. The most prevalent AG, was AG-1 (40%), followed by AG-2 (19.13%), AG-4 (11.30%), AG-7 (10.43%), AG-11 (8.70%), AG-3 (5.22%) and AG-5 (3.48%). Most of the AG were reported from the USA and Brazil. Sequence analysis of internal transcribed spacers of ribosomal DNA separated AG associated with soybean into two distinct clades. Clade I corresponded to distinct subclades containing AG-2, AG-3, AG-5, AG-7 and AG-11. Clade II corresponded to subclades of AG-1 subgroups. Furthermore, AG and/or AG subgroups were in close proximity without corresponding to their geographical origin. Moreover, AG or AG subgroups within clade or subclades shared higher percentages of sequence similarities. The principal coordinate analysis also supported the phylogenetic and genetic diversity analyses. In conclusion, AG-1, AG-2, and AG-4 were the most prevalent AG in soybean. The clade or subclades corresponded to AG or AG subgroups and did not correspond to the AG's geographical origin. The information on global genetic diversity and distribution will be helpful if novel management measures are to be developed against soybean diseases caused by R. solani.

Rhizopogon pumilionum (Ade) Bataille; a new false truffle (Basidiomycota) record for Turkish mycota

In this study, Rhizopogon pumilionum (Ade) Bataille is recorded from Turkey for the first time. The new record is described and illustrated. New record was proved by utilizing from its rDNA ITS data. Also, phylogenetic position of R. pumilionum was detected in the phylogenetic tree constructed using the sequences of rDNA ITS.

Identification of Sugarcane S. spontaneum (Poaceae) Germplasm: Evidence from rDNA-ITS and rDNA Locus Analyses

Sugarcane is a major crop for sugar production around the world. The complexity of the sugarcane genome creates challenges for the use of both conventional and molecular breeding methods to improve sugarcane at a genetic level. DNA sequencing is an important tool to assess how the genus Saccharum and the genera of the Saccharum complex are interrelated. Here, we identify the kinship of Nepal2013-6 (Saccharum spontaneum, x = 10) using a tetra-primer amplification refractory mutation system (ARMS) PCR. Based on rDNA-ITS sequence analysis, the accession Nepal2013-6 falls within a single cluster with S. spontaneum (Yunnan82-114 and SES208), which is consistent with the previous results. Moreover, fluorescence in situ hybridization (FISH) results indicate that the 5S rDNA spots are consistent with the chromosomal ploidy in the analytical Saccharum materials, whereas 35S rDNA has similar or fewer sites than the ploidy. Therefore, 5S rDNA FISH patterns would be more suitable than 35S rDNA for chromosomal ploidy analysis in S. spontaneum with varied basic chromosome number x = 8, 9, 10. Altogether, these results indicate that the rDNA sequences will be a useful marker for further rapidly identifying the relationship and ploidy of S. spontaneum in sugarcane breeding.

First Report of Colletotrichum liriopes Causing Leaf Spot of Rohdea japonica in China.

Rohdea japonica, known as Japanese sacred lily, a perennial herb in the family Asparagaceae, is an important ornamental plant in China (Hinkley 2006). In May 2022, at the campus of Jiangxi Agricultural University (28o45'50″N, 115o50'2″E), Nanchang, China, leaf spots occurred on R. japonica with a disease incidence of 95% (285/300 plants). Disease severity ranged from 40-60% of the leaf area on each plant. Symptoms initially appeared as small water-soaked spots, usually at the edges of the leaves. Then, the spots enlarged rapidly and became yellow brown, circular or semicircular. Finally, the dead tissues fell out of the leaf, leaving ragged leaf edges. Small pieces (3×3 mm) cut from the margin of necrotic leaf tissue were surface disinfested in 75% ethanol for 10 s and 0.1% HgCl2 for 20 s. After being rinsed three times with sterile distilled water, tissue was placed on potato dextrose agar (PDA) plates and incubated at 28℃ with a 12 h light-dark cycle. The growing fungal colonies were purified by subculturing hyphal tips, and 12 fungal isolates with similar morphology were obtained. Colonies were flat, smoke-grey with olivaceous green fan-shaped stripes. Conidia were single-celled, hyaline, slightly curved, both ends gradually tapering, measuring 14.9 - 25.3 μm long × 3.9 - 6.2 μm wide (n = 100). Appressoria were solitary, irregular, sometimes ellipsoidal, dark brown, measuring 6.5 - 17.6 μm long × 3.9 - 8.7 μm wide (n = 50). Morphological and cultural characteristics of the isolates matched the descriptions of Colletotrichum liriopes (Damm et al. 2009; Yang et al. 2020). To confirm the pathogens identity, genomic DNA of a representative isolate (WNQ1) was extracted, and the rDNA-ITS, TUB2 and CAL gene were amplified and sequenced using the primers ITS1/ITS4, T1/Bt2b, and CL1C/CL2C (White et al. 1990; Weir et al. 2012), respectively. The sequences were deposited in GenBank under accession number: ON514224 (rDNA-ITS), ON552548 (TUB2) and ON552549 (CAL). BLAST analyses showed 100%, 99.73% and 100% identity with 100% query coverage to the rDNA-ITS, TUB2 and CAL sequence of C. liriopes (MK644098, HM585414 and MN803417, respectively). Phylogenetic analysis using concatenated sequences of rDNA-ITS, TUB2 and CAL placed the isolate WNQ1 in a single clade with the reference strain of C. liriopes CORCK2. To confirm pathogenicity, a conidial suspension (1×106 conidia/ml) of isolate WNQ1 was sprayed on three leaves each of three healthy R. japonica plants wounded with a sterile needle, whereas control plants were wounded in the same way and sprayed with sterile distilled water. All treated plants were placed in a moist incubator at 28℃ with a 12 h photoperiod. Three days later symptoms, similar to those described above appeared. Symptoms did not develop on the control leaves. C. liriopes was recovered from the inoculated leaves, fulfilling Koch's postulates. Anthracnose caused by C. liriopes in R. japonica plants has been reported in the United States and Korea. To our knowledge, this is the first report of anthracnose on R. japonica caused by C. liriopes in China. The disease seriously affected the ornamental value of R. japonica. The result provides the foundation to study the occurrence patterns and control measures of R. japonica anthracnose.

Morphology and phylogeny of Prorocentrum porosum sp. nov. (Dinophyceae): A new benthic toxic dinoflagellate from the Atlantic and Pacific Oceans

A new marine benthic toxic Prorocentrum species is described from the tropical/subtropical regions of the Atlantic (Colombian Caribbean Sea and Northeast Brazil) and Pacific (Southern Japan) oceans. Morphological cell structures were examined using light (LM) and scanning electron (SEM) microscopy. Prorocentrum porosum sp. nov. was characterized by 35.9–50.2 μm long and 25.4–45.7 μm deep cells, covered by broadly ovoid symmetric thecal plates. The surface of both thecal plates is smooth and covered by randomly scattered kidney-shaped pores (n = 102–149), rounder towards the center, absent in the central part, and surrounded by a conspicuous marginal ring of about 69–92 evenly spaced pores. Broad V-shaped periflagellar area exhibiting flagellar and accessory pores. The molecular phylogenetic position of P. porosum sp. nov. was inferred using partial LSU rRNA gene (rDNA) and rDNA ITS sequences. This new species branched with high support in a Prorocentrum clade including P. caipirignum, P. hoffmannianum and P. cf. lima (P. lima morphotype 5 sensuZhang et al., 2015). Pairwise comparison of ITS1 and ITS2 transcripts with these closest relatives revealed the presence of compensatory base changes (CBCs), with the exception of P. cf. lima (P. lima morphotype 5), which only showed in ITS2 a hemi-CBC (HCBC) and two base changes that possibly induce a structural modification. Toxin analyses performed in two Colombian and Brazilian strains in the present study detected the presence of low amounts of okadaic acid.

A New Cryptic Species of the Genus Mychonastes (Chlorophyceae, Sphaeropleales).

A new species of green coccoid algae, Mychonastes hindakii sp. nov., was isolated from the River Moscow (Russia, Moscow). The taxon is described using morphological and molecular methods. Mychonastes hindakii sp. nov. belongs to the group of species of the genus Mychonastes with spherical single cells joined with mucilaginous, irregularly shaped stalks. A comparison of ITS2 rDNA sequences and its secondary structures combined with the compensatory base changes approach confirms the separation between Mychonastes hindakii and other species of the genus. Mychonastes hindakii sp. nov. represents a cryptic species that can only be reliably identified using molecular data.

First Report of Alternaria alternata causing leaf spot on fig (Ficus carica L.) in Karbala Province, Iraq

Fig is an important tree that is cultivated worldwide including Iraq. During a survey held in 2018 in orchards of Alhusaynia territory, Karbala Province, Iraq, an epidemic leaf spot disease affecting fig trees was observed. Based on morphological appearances and rDNA-ITS sequence analyses, the fungi caused this disease was recognized as Alternaria alternata. To our knowledge, this is the first record of A. alternata causing leaf spot disease on fig trees in Karbala, Iraq.

A new record of Scedosporium dehoogii isolated from paddy field soil in Iran: Phylogeny and antifungal susceptibility profiles.

Scedosporium species are ubiquitous environmental fungi, which are considered emerging agents that trigger disease in humans and animals. The present study aimed to determine Scedosporium dehoogii strain isolated from paddy field soil samples using semi-selective media and evaluate its antifungal susceptibility profile. Three paddy field soil samples were collected during an investigation for the isolation of Scedosporium species in Mazandaran province, Iran. Morphological and molecular analyses based on ITS-rDNA sequencing were performed. Furthermore, in vitro antifungal susceptibility testing for conventional drugs and novel imidazole (luliconazole) was performed based on Clinical and Laboratory Standards Institute M38-A3 guidelines. In this study, S. dehoogii was isolated from the soil in paddy fields. Based on the results, itraconazole and luliconazole showed the least and most antifungal activity against this isolate, respectively. Based on the findings, molecular identification was essential for distinguishing the species of S. dehoogii. Remarkably, luliconazole showed potent activity against this strain.

Antagonist activities of native rhizosphere micro-flora against groundnut stem rot pathogen, Sclerotium rolfsii Sacc.

BackgroundStem rot caused by Sclerotium rolfsii Sacc. is a major nuisance in groundnut production, causing substantial yield losses in almost all groundnut-growing areas around the world. Biological control is regarded as a sustainable choice over the currently popular management strategy i.e., chemical control, as later has a negative influence on the environment. The present study evaluated the antagonistic effect of native rhizosphere micro-flora against groundnut stem rot pathogen S. rolfsii.ResultsA total of 111 bacterial isolates and 9 Trichoderma isolates isolated from groundnut rhizosphere soil were evaluated for their antagonist activity against S. rolfsii in vitro. Eight isolates (seven bacterial and one Trichoderma) were chosen as prospective biocontrol candidates based on the findings of the dual culture assay. Molecular characterization of these isolates by 16S rDNA and ITS rDNA sequencing confirmed the identity of bacterial isolates as Bacillus spp. (six B. subtilis and one B. amyloliquefaciens) and fungal isolate as Trichoderma asperellum. Also, the selected seven bacterial isolates recorded favourable results for antagonism-promoting biochemical traits.ConclusionThe results of the current study suggested that the native groundnut rhizosphere micro-flora can be exploited for biological control of groundnut stem rot pathogen S. rolfsii. Further research may enable the use of the isolated rhizosphere biocontrol agents as single organisms or in a consortium for sustainable management of the groundnut stem rot pathogen.

Ulosarcina terrestrica gen. nov., sp. nov., a New Ulvophycean Sarcinoid Alga from the Russian Far East

Many filamentous and sarcinoid terrestrial or freshwater green algae that were previously assigned to the Chlorophyceae are members of lineages belonging to the class Ulvophyceae. One of these lineages is the Planophila-clade (Ulotrichales). Some genera in this clade share similar morphology: cell packages forming branched pseudofilaments, uniseriate or sometimes biseriate filaments, often embedded in common mucilage. During a study on soil algal diversity in the temperate monsoon climate zone in Russia (Primorsky Territory, Vladivostok), we isolated a strain of sarcinoid green alga and examined it using an integrative approach. SSU and ITS rDNA sequence data, morphological characteristics, and life cycle features differentiated this strain from closely related genera of the order Ulotrichales and led us to describe it as Ulosarcina terrestrica gen. et sp. nov.

"Metabolomic diversity of local strains of Beauveria bassiana (Balsamo) Vuillemin and their efficacy against the cassava mite, Tetranychus truncatus Ehara (Acari: Tetranychidae)".

A desirable substitute for chemical pesticides is mycopesticides. In the current investigation, rDNA-ITS (Internal transcribed spacer) and TEF (Transcriptional Elongation Factor) sequencing were used for molecular identification of six Beauveria bassiana strains. Both, leaf discs and potted plant bioassaye were carried out to study their pathogenicity against the cassava mite, Tetranychus truncatus. LC50 and LC90 values of potential B. bassiana strains were estimated. We also discovered a correlation between intraspecific B. bassiana strains pathogenicity and comprehensive metabolome profiles. Bb5, Bb6, Bb8, Bb12, Bb15, and Bb21 strains were identified as B. bassiana by sequencing of rDNA-ITS and TEF segments and sequence comparison to NCBI (National Center for Biotechnology Information) GenBank. Out of the six strains tested for pathogenicity, Bb6, Bb12, and Bb15 strains outperformed against T. truncatus with LC50 values 1.4×106, 1.7×106, and 1.4×106 and with a LC90 values 7.3×107, 1.4×108, and 4.2×108 conidia/ml, respectively, at 3 days after inoculation and were considered as potential strains for effective mite control. Later, Gas Chromatography-Mass Spectrometry (GC-MS) analysis of the above six B. bassiana strains was done on secondary metabolites extracted with ethyl acetate revealed that the potential B. bassiana strains (Bb6, Bb12, and Bb15) have higher levels of acaricidal such as Bis(dimethylethyl)-phenol: Bb6 (5.79%), Bb12 (6.15%), and Bb15 (4.69%). Besides, insecticidal (n-Hexadecanoic acid), and insect innate immunity overcoming compound (Nonadecene) were also identified; therefore, the synergistic effect of these compounds might lead toa higher pathogenicity of B. bassiana against T. truncatus. Further, these compounds also exhibited two clusters, which separate the potential and non-potential strains in the dendrogram of Thin Layer Chromatography. These results clearly demonstrated the potentiality of the B. bassiana strains against T. truncatus due to the occurrence of their bioactive volatile metabolome.