DNA Sequence Research Articles

Enhancing metabarcoding efficiency and ecological insights through integrated taxonomy and DNA reference barcoding: Acase study on beach meiofauna.

Molecular techniques like metabarcoding, while promising for exploring diversity of communities, are often impeded by the lack of reference DNA sequences available for taxonomic annotation. Our study explores the benefits of combining targeted DNA barcoding and morphological taxonomy to improve metabarcoding efficiency, using beach meiofauna as a case study. Beaches are globally important ecosystems and are inhabited by meiofauna, microscopic animals living in the interstitial space between the sand grains, which play a key role in coastal biodiversity and ecosystem dynamics. However, research on meiofauna faces challenges due to limited taxonomic expertise and sparse sampling. We generated 775 new cytochrome c oxidase I DNA barcodes from meiofauna specimens collected along the Netherlands' west coast and combined them with the NCBI GenBank database. We analysed alpha and beta diversity in 561 metabarcoding samples from 24 North Sea beaches, a region extensively studied for meiofauna, using both the enriched reference database and the NCBI database without the additional reference barcodes. Our results show a 2.5-fold increase in sequence annotation and a doubling of species-level Operational Taxonomic Units (OTUs) identification when annotating the metabarcoding data with the enhanced database. Additionally, our analyses revealed a bell-shaped curve of OTU richness across the intertidal zone, aligning more closely with morphological analysis patterns, and more defined community dissimilarity patterns between supralittoral and intertidal sites. Our research highlights the importance of expanding molecular reference databases and combining morphological taxonomy with molecular techniques for biodiversity assessments, ultimately improving our understanding of coastal ecosystems.

Phylogenetic and morphological re-evaluation of Camptophora.

The genetic variety and habitats of Camptophora species, generally known as black yeast, have not been clarified. In this study, we re-evaluated Camptophora based on morphological observations and phylogenetic analyses. Because prior investigations on Camptophora only included a few strains/specimens, 24 Camptophora-related strains were newly obtained from 13 leaf samples of various plant species to redefine the genetic and species concepts of Camptophora. Their molecular phylogenetic relationships were examined using small subunit nuclear ribosomal DNA (nSSU, 18S rDNA), the internal transcribed spacer (ITS) rDNA operon, the large subunit nuclear ribosomal DNA (LSU, 28S rDNA), β-tubulin, the second largest subunit of RNA polymerase II (rpb2), and mitochondrial small subunit DNA (mtSSU). Single- and multi-locus analyses using nSSU-ITS-LSU-rpb2-mtSSU revealed a robust phylogenetic relationship among Camptophora species within Chaetothyriaceae. Camptophora species could be distinguished from other chaetothyriaceous genera by their snake-shaped conidia with microcyclic conidiation and loosely interwoven mycelial masses. Based on the results of phylogenetic analyses, two undescribed lineages were recognized, and Ca. schimae was excluded from the genus. ITS sequence comparison with environmental DNA sequences revealed that the distribution of the genus is restricted to the Asia-Pacific region. Camptophora has been isolated or detected from abrupt sources, and this was attributed to its microcycle. The mechanisms driving genetic diversity within species are discussed with respect to their phyllosphere habitats.

Evolutionarily conserved enhancer-associated features within the MYEOV locus suggest a regulatory role for this non-coding DNA region in cancer

The myeloma overexpressed gene (MYEOV) has been proposed to be a proto-oncogene due to high RNA transcript levels found in multiple cancers, including myeloma, breast, lung, pancreas and esophageal cancer. The presence of an open reading frame (ORF) in humans and other primates suggests protein-coding potential. Yet, we still lack evidence of a functional MYEOV protein. It remains undetermined how MYEOV overexpression affects cancerous tissues. In this work, we show that MYEOV has likely originated and may still function as an enhancer, regulating CCND1 and LTO1. Firstly, MYEOV 3′ enhancer activity was confirmed in humans using publicly available ATAC-STARR-seq data, performed on B-cell-derived GM12878 cells. We detected enhancer histone marks H3K4me1 and H3K27ac overlapping MYEOV in multiple healthy human tissues, which include B cells, liver and lung tissue. The analysis of 3D genome datasets revealed chromatin interactions between a MYEOV-3′-putative enhancer and the proto-oncogene CCND1. BLAST searches and multi-sequence alignment results showed that DNA sequence from this human enhancer element is conserved from the amphibians/amniotes divergence, with a 273 bp conserved region also found in all mammals, and even in chickens, where it is consistently located near the corresponding CCND1 orthologues. Furthermore, we observed conservation of an active enhancer state in the MYEOV orthologues of four non-human primates, dogs, rats, and mice. When studying this homologous region in mice, where the ORF of MYEOV is absent, we not only observed an enhancer chromatin state but also found interactions between the mouse enhancer homolog and Ccnd1 using 3D-genome interaction data. This is similar to the interaction observed in humans and, interestingly, coincides with CTCF binding sites in both species. Taken together, this suggests that MYEOV is a primate-specific gene with a de novo ORF that originated at an evolutionarily older enhancer region. This deeply conserved putative enhancer element could regulate CCND1 in both humans and mice, opening the possibility of studying MYEOV regulatory functions in cancer using non-primate animal models.

Associations of ACE I/D and AGTR1 rs5182 polymorphisms with diabetes and their effects on lipids in an elderly Chinese population

BackgroundDiabetes mellitus is generally accompanied by dyslipidaemia, but inconsistent relationships between lipid profiles and diabetes are noted. Moreover, genetic variations in insertion/deletion (I/D) polymorphisms at angiotensin-converting enzyme gene (ACE) and T/C polymorphisms in the angiotensin type 1 receptor gene (AGTR1) are related to diabetes and lipid levels, but the associations are controversial. Thus, the current research aimed to explore the effects of ACE I/D, AGTR1 rs5182 and diabetes mellitus on serum lipid profiles in 385 Chinese participants with an average age of 75.01 years.MethodsThe ACE I/D variant was identified using the polymerase chain reaction (PCR) method, whereas the AGTR1 rs5182 polymorphism was identified using the PCR-based restriction fragment length polymorphism (PCR-RFLP) method and verified with DNA sequencing. Total cholesterol (TC), triglyceride (TG), apolipoprotein A (ApoA), apolipoprotein B (ApoB), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) levels were measured using routine methods, and the lipid ratios were calculated.ResultsACE I/D, but not AGTR1 rs5182, was a predictor of TG/HDL-C for the whole study population. Both ACE I/D and AGTR1 rs5182 were predictors of HDL-C and LDL-C levels in females but not in males. Moreover, in females, diabetes mellitus and ACE I/D were identified as predictors of TG and TG/HDL-C, whereas AGTR1 rs5182 and diabetes mellitus were predictors of TG/HDL-C. Moreover, diabetes mellitus and the combination of ACE I/D and AGTR1 rs5182 variations were predictors of TG and TG/HDL-C exclusively in females.ConclusionsThe results demonstrated the potential for gender-dependent interactions of ACE I/D, AGTR1 rs5182, and diabetes on lipid profiles. These findings may serve as an additional explanation for the inconsistent changes of blood lipids in individuals with diabetes mellitus, thereby offering a novel perspective for the clinical management of blood lipid levels in diabetic patients.

Quantifying genome-wide transcription factor binding affinities for chromatin using BANC-seq.

Transcription factors (TFs) bind specific DNA sequences to regulate transcription. Apart from DNA sequences, local factors such as DNA accessibility and chromatin structure determine the affinity of a TF for any given locus. Including these factors when measuring TF-DNA affinities has proven difficult. To address this challenge, we recently developed a method called binding affinities in native chromatin by sequencing (BANC-seq). In BANC-seq, intact mammalian nuclei are incubated with a concentration range of epitope-tagged TF, followed by either chromatin immunoprecipitation or cleavage under target and release using nuclease with spike-in DNA. This allows determination of apparent dissociation constant (KdApp) values, defined by the concentration of TF at which half-maximum binding occurs, across the genome. Here we present a detailed stepwise protocol for BANC-seq, including downstream data analysis. In principle, any molecular biologist should be able to perform a BANC-seq experiment in as little as 1.5 d (excluding analysis). However, preprocessing and analysis of the sequencing data does require some experience in command-line shell and R programming.

Cross-Species Prediction of Transcription Factor Binding by Adversarial Training of a Novel Nucleotide-Level Deep Neural Network.

Cross-species prediction of TF binding remains a major challenge due to the rapid evolutionary turnover of individual TF binding sites, resulting in cross-species predictive performance being consistently worse than within-species performance. In this study, a novel Nucleotide-Level Deep Neural Network (NLDNN) is first proposed to predict TF binding within or across species. NLDNN regards the task of TF binding prediction as a nucleotide-level regression task, which takes DNA sequences as input and directly predicts experimental coverage values. Beyond predictive performance, it also assesses model performance by locating potential TF binding regions, discriminating TF-specific single-nucleotide polymorphisms (SNPs), and identifying causal disease-associated SNPs. The experimental results show that NLDNN outperforms the competing methods in these tasks. Then, a dual-path framework is designed for adversarial training of NLDNN to further improve the cross-species prediction performance by pulling the domain space of human and mouse species closer. Through comparison and analysis, it finds that adversarial training not only can improve the cross-species prediction performance between humans and mice but also enhance the ability to locate TF binding regions and discriminate TF-specific SNPs. By visualizing the predictions, it is figured out that the framework corrects some mispredictions by amplifying the coverage values of incorrectly predicted peaks.

Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.

Genetic Variants in Vitamin-D Metabolism Genes (rs1155563, rs12785878 and rs10500804) among Females with Type-2 Diabetes Mellitus in Saudi Arabia

Background & Objective: Hypovitaminosis D has shown to be linked with T2DM development and control in numerous studies. The association of SNPs in genes related to VitD metabolism with T2DM has not been sufficiently studied. Consequently, our aim in the present study was to explore the association between genetic variants in genes connected with VitD, mainly a SNP in GC (rs1155563), a SNP in DHCR7 (rs12785878) and a SNP in CYP2R1 (rs10500804) with glycaemic parameters in females with T2DM in Saudi Arabia. Methods: The cross-sectional study included 149 females (age 38-52 years) with T2DM from Jeddah, Saudi Arabia (September 2022-March 2023). Blood was extracted from the participants for biochemical tests including measuring VitD [25(OH)D] concentration, parameters of glycaemia (HbA1c, insulin, fasting glucose and insulin sensitivity indices including HOMA2-IR and HOMA2-%β), and for genomic DNA isolation. Sanger DNA sequencing was used to screen for VitD genetic polymorphisms (rs1155563, rs12785878 and rs10500804). Results: Minor allele frequency for rs1155563C, rs12785878T and rs10500804G was 0.21, 0.23 and 0.37, respectively. Levels of 25(OH)D and glycaemic parameters as well did not show any significant difference between the genotypes of each SNP. Conclusion: This study showed lack of association of rs1155563 in GC, rs12785878 in DHCR7 and rs10500804 in CYP2R1 with VitD level primarily and with glycaemic parameters secondarily. Additional research is required to explore further other VitD genetic polymorphisms influencing T2DM which might lead consequently to genetically-based personalized management for T2DM. doi: https://doi.org/10.12669/pjms.40.8.9318 How to cite this: Alharazy S. Genetic Variants in Vitamin-D Metabolism Genes (rs1155563, rs12785878 and rs10500804) among Females with Type-2 Diabetes Mellitus in Saudi Arabia. Pak J Med Sci. 2024;40(8):---------. doi: https://doi.org/10.12669/pjms.40.8.9318 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Breaking the Cycle: A Yeast Mannan-Rich Fraction Beneficially Modulates Egg Quality and the Antimicrobial Resistome Associated with Layer Hen Caecal Microbiomes under Commercial Conditions

Antibiotics and antibiotic growth promoters have been extensively employed in poultry farming to enhance growth performance, maintain bird health, improve nutrient uptake efficiency, and mitigate enteric diseases at both sub-therapeutic and therapeutic doses. However, the extensive use of antimicrobials in poultry farming has led to the emergence of antimicrobial resistance (AMR) in microbial reservoirs, representing a significant global public health concern. In response, non-antibiotic dietary interventions, such as yeast mannan-rich fraction (MRF), have emerged as a promising alternative to modulate the gut microbiota and combat the AMR crisis. This study investigated whether a yeast mannan-rich fraction containing feed supplement impacted the performance of laying hens, their microbiomes, and the associated carriage of antimicrobial resistance genes under commercial conditions. High-throughput DNA sequencing was utilised to profile the bacterial community and assess changes in the antibiotic resistance genomes detected in the metagenome, the “resistome”, in response to MRF supplementation. It was found that supplementation favourably influenced laying hen performance and microbial composition. Notably, there was a compositional shift in the MRF supplemented group associated with a lower relative abundance of pathobionts, e.g., Escherichia, Brachyspira and Trueperella, and their AMR-encoded genes, relative to beneficial microbes. Overall, the findings further demonstrate the ability of prebiotics to improve laying hen performance through changes associated with their microbiome and resistome.

Integrative description of two new species of the genus Mesobiotus (Eutardigrada, Macrobiotoidea) from Russia, with an updated phylogeny of the genus

In this study, we describe two new species of Mesobiotus based on morphological data collected through light and scanning electron microscopy. Descriptions include DNA sequences of four commonly used molecular markers (18S rDNA, 28S rDNA, ITS-2, and COI). Mesobiotus efa sp. nov. was discovered in North-West Russia and belongs to the group of species with smooth cuticle, harmsworthi-type OCA, typical Mesobiotus claws IV with unindented lunules, and egg chorion with reticulated processes in form of ‘sharp wide cones’ or ‘cones with long slender endings’, egg process bases with well-developed crone of dark thickenings without finger-like projections, and egg shell surface between the processes with ridges without reticulation, areolation or semi-areolation. It can be distinguished from all know species of this group by a unique combination of morphological and morphometric characters. Mesobiotus vulpinus sp. nov. was found in the Russian Far East, and is similar to Mesobiotus mauccii by having an egg chorion with polygonal relief. The new species can be distinguished from M. mauccii by having a narrower buccal tube, by details of oral cavity armature, and by longer egg chorion processes. Furthermore, we provide results of the phylogenetic analyses of the genus Mesobiotus conducted in this study.

Bayesian Inference Under the Multispecies Coalescent with Ancient DNA Sequences.

Ancient DNA (aDNA) is increasingly being used to investigate questions such as the phylogenetic relationships and divergence times of extant and extinct species. If aDNA samples are sufficiently old, expected branch lengths (in units of nucleotide substitutions) are reduced relative to contemporary samples. This can be accounted for by incorporating sample ages into phylogenetic analyses. Existing methods that use tip (sample) dates infer gene trees rather than species trees, which can lead to incorrect or biased inferences of the species tree. Methods using a multispecies coalescent (MSC) model overcome these issues. We developed an MSC model with tip dates and implemented it in the program bpp. The method performed well for a range of biologically realistic scenarios, estimating calibrated divergence times and mutation rates precisely. Simulations suggest that estimation precision can be best improved by prioritizing sampling of many loci and more ancient samples. Incorrectly treating ancient samples as contemporary in analyzing simulated data, mimicking a common practice of empirical analyses, led to large systematic biases in model parameters, including divergence times. Two genomic datasets of mammoths and elephants were analyzed, demonstrating the method's empirical utility.

A Review of Probe-Based Enrichment Methods to Inform Plant Virus Diagnostics

Modern diagnostic techniques based on DNA sequence similarity are currently the gold standard for the detection of existing and emerging pathogens. Whilst individual assays are inexpensive to use, assay development is costly and carries risks of not being sensitive or specific enough to capture an increasingly diverse range of targets. Sequencing can provide the entire nucleic acid content of a sample and may be used to identify all pathogens present in the sample when the depth of coverage is sufficient. Targeted enrichment techniques have been used to increase sequence coverage and improve the sensitivity of detection within virus samples, specifically, to capture sequences for a range of different viruses or increase the number of reads from low-titre virus infections. Vertebrate viruses have been well characterised using in-solution hybridisation capture to target diverse virus families. The use of probes for genotyping and strain identification has been limited in plants, and uncertainty around sensitivity is an impediment to the development of a large-scale virus panel to use within regulatory settings and diagnostic pipelines. This review aims to compare significant studies that have used targeted enrichment of viruses to identify approaches to probe design and potential for use in plant virus detection and characterisation.

A Novel Bacitracin-like Peptide from Mangrove-Isolated Bacillus paralicheniformis NNS4-3 against MRSA and Its Genomic Insights

The global rise of antimicrobial resistance (AMR) presents a critical challenge necessitating the discovery of novel antimicrobial agents. Mangrove microbes are valuable sources of new antimicrobial compounds. This study reports the discovery of a potent antimicrobial peptide (AMP) from Bacillus paralicheniformis NNS4-3, isolated from mangrove sediment, exhibiting significant activity against methicillin-resistant Staphylococcus aureus (MRSA). The AMP demonstrated a minimum inhibitory concentration ranging from 1 to 16 µg/mL in the tested bacteria and exhibited bactericidal effects at higher concentrations. Structural analysis revealed a bacitracin-like configuration and the peptide acted by disrupting bacterial membranes in a time- and concentration-dependent manner. The AMP maintained stability under heat, proteolytic enzymes, surfactants, and varying pH treatments. The ten biosynthetic gene clusters (BGCs) of secondary metabolites were found in the genome. Detailed sequence comparison of the predicted bacitracin BGC indicated distinct DNA sequences compared to previously reported strains. Although the antibiotic resistance genes were found, this strain was susceptible to antibiotics. Our findings demonstrated the potential of Bacillus paralicheniformis NNS4-3 and its AMP as a promising agent in combating AMR. The genetic information could be pivotal for future applications in the healthcare industry, emphasizing the need for continued exploration of marine microbial diversity in drug discovery.

Exploring the roles of RNAs in chromatin architecture using deep learning

Recent studies have highlighted the impact of both transcription and transcripts on 3D genome organization, particularly its dynamics. Here, we propose a deep learning framework, called AkitaR, that leverages both genome sequences and genome-wide RNA-DNA interactions to investigate the roles of chromatin-associated RNAs (caRNAs) on genome folding in HFFc6 cells. In order to disentangle the cis- and trans-regulatory roles of caRNAs, we have compared models with nascent transcripts, trans-located caRNAs, open chromatin data, or DNA sequence alone. Both nascent transcripts and trans-located caRNAs improve the models’ predictions, especially at cell-type-specific genomic regions. Analyses of feature importance scores reveal the contribution of caRNAs at TAD boundaries, chromatin loops and nuclear sub-structures such as nuclear speckles and nucleoli to the models’ predictions. Furthermore, we identify non-coding RNAs (ncRNAs) known to regulate chromatin structures, such as MALAT1 and NEAT1, as well as several new RNAs, RNY5, RPPH1, POLG-DT and THBS1-IT1, that might modulate chromatin architecture through trans-interactions in HFFc6. Our modeling also suggests that transcripts from Alus and other repetitive elements may facilitate chromatin interactions through trans R-loop formation. Our findings provide insights and generate testable hypotheses about the roles of caRNAs in shaping chromatin organization.

Epigenetics Regulation in Responses to Abiotic Factors in Plant Species: A Systematic Review

Plants have several mechanisms to adapt or acclimate to environmental stress. Morphological, physiological, or genetic changes are examples of complex plant responses. In recent years, our understanding of the role of epigenetic regulation, which encompasses changes that do not alter the DNA sequence, as an adaptive mechanism in response to stressful conditions has advanced significantly. Some studies elucidated and synthesized epigenetic mechanisms and their relationships with environmental change, while others explored the interplay between epigenetic modifications and environmental shifts, aiming to deepen our understanding of these complex processes. In this study, we performed a systematic review of the literature to analyze the progression of epigenetics studies on plant species’ responses to abiotic factors. We also aimed to identify the most studied species, the type of abiotic factor studied, and the epigenetic technique most used in the scientific literature. For this, a search for articles in databases was carried out, and after analyzing them using pre-established inclusion criteria, a total of 401 studies were found. The most studied species were Arabidopsis thaliana and Oryza sativa, highlighting the gap in studies of non-economic and tropical plant species. Methylome DNA sequencing is the main technique used for the detection of epigenetic interactions in published studies. Furthermore, most studies sought to understand the plant responses to abiotic changes in temperature, water, and salinity. It is worth emphasizing further research is necessary to establish a correlation between epigenetic responses and abiotic factors, such as extreme temperatures and light, associated with climate change.

DNA sequences alignment method using sparse index on pan-genome graph

DNA sequences alignment method using sparse index on pan-genome graph

Replication fork barriers to study site-specific DNA replication perturbation

DNA replication ensures the complete and accurate duplication of the genome. The traditional approach to analysing perturbation of DNA replication is to use chemical inhibitors, such as hydroxyurea or aphidicolin, that slow or stall replication fork progression throughout the genome. An alternative approach is to perturb replication at a single site in the genome that permits a more forensic investigation of the cellular response to the stalling or disruption of a replication fork. This has been achieved in several organisms using different systems that share the common feature of utilizing the high affinity binding of a protein to a defined DNA sequence that is integrated into a specific locus in the host genome. Protein-mediated replication fork blocking systems of this sort have proven very valuable in defining how cells cope with encountering a barrier to fork progression. In this review, we compare protein-based replication fork barrier systems from different organisms that have been developed to generate site-specific replication fork perturbation.

AAV-aMTD-Parkin, a Therapeutic Gene Delivery Cargo, Enhances Motor and Cognitive Functions in Parkinson's and Alzheimer’s Diseases

Neurodegenerative disorders, such as Parkinson's disease (PD) and Alzheimer's disease (AD), have a global prevalence and profoundly impact both motor and cognitive functions. Although adeno-associated virus (AAV)-based gene therapy has shown promise, its application for treating central nervous system (CNS) diseases faces several challenges, including effective delivery of AAV vectors across the blood-brain barrier, determining optimal dosages, and achieving targeted distribution. To address these challenges, we have developed a fusion delivery therapeutic cargo called AAV-aMTD-Parkin, which combines a hydrophobic cell-penetrating peptide sequence with the DNA sequences of AAV and Parkin. By employing this fusion delivery platform at lower dosages compared to zolgensma, we have achieved significant enhancements in cell and tissue permeability, while reducing the occurrence of common pathological protein aggregates. Consequently, motor and cognitive functions were restored in animal models of PD and AD. With its dual functionality in addressing PD and AD, AAV-aMTD-Parkin holds immense potential as a novel class of therapeutic biologics for prevalent CNS diseases.

Fecal IgE Analyses Reveal a Role for Stratifying Peanut-Allergic Patients.

Peanut allergy (PA) is an IgE-mediated food allergy with variable clinical outcomes. Mild-to-severe symptoms affect various organs and, often, the gastrointestinal tract. The role of intestine-derived IgE antibodies in astrointestinal PA symptoms is poorly understood. This study aimed to examine fecal IgE responses in PA as a novel approach to patient endotyping. Feces and serum samples were collected from peanut-allergic and healthy children (n=26) to identify IgE and cytokines using multiplex assays. Shotgun metagenomics DNA sequencing and allergen database comparisons made it possible to identify microbial peptides with homology to known allergens. Compared to controls, fecal IgE signatures showed broad diversity and increased levels for 13 allergens, including food, venom, contact, and respiratory allergens (P<.01-.0001). Overall, fecal IgE patterns were negatively correlated compared to sera IgE patterns in PA patients, with the greatest differences recorded for peanut allergens (P<.0001). For 83% of the allergens recognized by fecal IgE, we found bacterial homologs from PA patients' gut microbiome (eg, thaumatin-like protein Acinetobacter baumannii vs Act d 2, 109/124 aa identical). Compared to controls, PA patients had higher levels of fecal IgA, IL-22, and auto-IgE binding to their own fecal proteins (P<.001). Finally, levels of fecal IgE correlated with abdominal pain scores (P<.0001), suggesting a link between local IgE production and clinical outcomes. Fecal IgE release from the intestinal mucosa could be an underlying mechanism of severe abdominal pain through the association between leaky gut epithelia and anticommensal TH2 responses in PA.

Molecular phylogeny and morphology reveal a new wood-inhabiting fungal species, Hyphoderma guangdongense (Polyporales, Basidiomycota), from China

Hyphoderma is one of the most important representative groups of wood-inhabiting fungi. These fungi secrete various enzymes capable of degrading cellulose, hemicellulose, and lignin into simple inorganic substances. The taxa within the genus cause the white rot of wood, play a key role in the carbon cycle, and are the most efficient wood decomposers in the forest ecosystem. This study proposes a new wood-inhabiting fungal taxon, Hyphoderma guangdongense, based on morphological features and molecular evidence. It is characterized by the white hymenial surface, a monomitic hyphal system having the generative hyphae with clamp connections, the presence of the septate and tubular cystidia, and cylindrical basidiospores (6–10 × 3–5 µm). The phylogenetic tree inferred from a combination of the internal transcribed spacers (ITS) and large subunit (nrLSU) of the nuclear ribosomal DNA (rDNA) sequences revealed that H. guangdongense placed into the genus Hyphoderma, in which it is closely related to a clade comprising two taxa, H. setigerum, and H. floccosum. A full description, illustrations, and results of the new species' phylogenetic analysis are provided.