Sequencing Kit Research Articles

Genome stability assessment of PRRS vaccine strain with new ARTIC-style sequencing protocol.

A tiling amplicon sequencing protocol was developed to analyse the genome sequence stability of the modified live PRRSV vaccine strain, Porcilis MLV. The backbone of the ARTIC-style protocol was formed by 34 individual primer pairs, which were divided into two primer pools. Primer pairs were designed to amplify 532 to 588 bp fragments of the corresponding genomic region. The amplicons are suitable for sequencing on Illumina DNA sequencers with available 600-cycle sequencing kits. The concentration of primer pairs in the pools was optimized to obtain a balanced sequencing depth along the genome. Deep sequencing data of three vaccine batches were also analysed. All three vaccine batches were very similar to each other, although they also showed single nucleotide variations (SNVs) affecting less than 1 % of the genome. In the three vaccine strains, 113 to 122 SNV sites were identified; at these sites, the minority variants represented a frequency range of 1 to 48.7 percent. Additionally, the strains within the batches contained well-known length polymorphisms; the genomes of these minority deletion mutants were 135 to 222 bp shorter than the variant with the complete genome. Our results show the usefulness of ARTIC-style protocols in the evaluation of the genomic stability of PRRS MLV strains.

Combining a prioritization strategy and functional studies nominates 5’UTR variants underlying inherited retinal disease

Background5’ untranslated regions (5’UTRs) are essential modulators of protein translation. Predicting the impact of 5’UTR variants is challenging and rarely performed in routine diagnostics. Here, we present a combined approach of a comprehensive prioritization strategy and functional assays to evaluate 5’UTR variation in two large cohorts of patients with inherited retinal diseases (IRDs).MethodsWe performed an isoform-level re-analysis of retinal RNA-seq data to identify the protein-coding transcripts of 378 IRD genes with highest expression in retina. We evaluated the coverage of their 5’UTRs by different whole exome sequencing (WES) kits. The selected 5’UTRs were analyzed in whole genome sequencing (WGS) and WES data from IRD sub-cohorts from the 100,000 Genomes Project (n = 2397 WGS) and an in-house database (n = 1682 WES), respectively. Identified variants were annotated for 5’UTR-relevant features and classified into seven categories based on their predicted functional consequence. We developed a variant prioritization strategy by integrating population frequency, specific criteria for each category, and family and phenotypic data. A selection of candidate variants underwent functional validation using diverse approaches.ResultsIsoform-level re-quantification of retinal gene expression revealed 76 IRD genes with a non-canonical retina-enriched isoform, of which 20 display a fully distinct 5’UTR compared to that of their canonical isoform. Depending on the probe design, 3–20% of IRD genes have 5’UTRs fully captured by WES. After analyzing these regions in both cohorts, we prioritized 11 (likely) pathogenic variants in 10 genes (ARL3, MERTK, NDP, NMNAT1, NPHP4, PAX6, PRPF31, PRPF4, RDH12, RD3), of which 7 were novel. Functional analyses further supported the pathogenicity of three variants. Mis-splicing was demonstrated for the PRPF31:c.-9+1G>T variant. The MERTK:c.-125G>A variant, overlapping a transcriptional start site, was shown to significantly reduce both luciferase mRNA levels and activity. The RDH12:c.-123C>T variant was found in cis with the hypomorphic RDH12:c.701G>A (p.Arg234His) variant in 11 patients. This 5’UTR variant, predicted to introduce an upstream open reading frame, was shown to result in reduced RDH12 protein but unaltered mRNA levels.ConclusionsThis study demonstrates the importance of 5’UTR variants implicated in IRDs and provides a systematic approach for 5’UTR annotation and validation that is applicable to other inherited diseases.

Glioblastoma epigenomics discloses a complex biology and potential therapeutic targets.

<p>Glioblastoma (GBM), a highly aggressive form of brain tumors, has been extensively studied using OMICS methods, and the most characteristic molecular determinants have been incorporated into the histopathological diagnosis. Research data, nevertheless, only partially have been adopted in clinical practice. Here we aimed to present results of our epige&shy;no&shy;mic GBM profiling to better understand early and late determinants of these tumors, and to share main elements of our findings with practicing professionals.</p>. <p>GBM specimens were surgically obtained after first diagnosis (GBM1) and at recurrence (GBM2). DNA was extracted from 24 sequential pairs of formalin-fixed, paraffin-embedded tumor tissues. The Reduced Representation Bisulfite Sequencing kit was used for library preparation. Pooled libraries were sequenced on an Illumina NextSeq 550 instrument. Methylation controls (MC) were obtained from a publicly available database. Bioinformatic analyses were performed to identify differentially methylated pathways and their elements in cohorts of MC, GBM1 and GBM2.</p>. <p>Several differentially methylated pathways involved in basic intracellular and brain tissue developmental processes were identified in the GBM1 vs. MC and GBM2 vs. MC comparisons. Among differentially me&shy;thylated pathways, those involved in immune regulation, neurotransmitter (particularly dopaminergic, noradrenergic and glutaminergic) responses and regulation of stem cell differentiation and proliferation stood out in the GBM2 vs. GBM1 comparisons.</p>. <p>Our study revealed biological complexity of early and late gliomagenesis encompassing mechanisms from basic intracellular through distorted neurodevelopmental processes to more specific immune and highjacked neurotransmitter pathways in the tumor microenvironment. These findings may offer considerations for therapeutic approaches.</p>.

The Oxford Nanopore MinION as a Versatile Technology for the Diagnosis and Characterization of Emerging Plant Viruses.

The emergence of novel viral epidemics that could affect major crops represents a serious threat to global food security. The early and accurate identification of the causative viral agent is the most important step for a rapid and effective response to disease outbreaks. Over the last years, the Oxford Nanopore Technologies (ONT) MinION sequencer has been proposed as an effective diagnostic tool for the early detection and identification of emerging viruses in plants, providing many advantages compared with different high-throughput sequencing (HTS) technologies. Here, we provide a step-by-step protocol that we optimized to obtain the virome of "Lamon bean" plants (Phaseolus vulgaris L.), an agricultural product with Protected Geographical Indication (PGI) in North-East of Italy, which is frequently subjected to multiple infections caused by different RNA viruses. The conversion of viral RNA in ds-cDNA enabled the use of Genomic DNA Ligation Sequencing Kit and Native Barcoding DNA Kit, which have been originally developed for DNA sequencing. This allowed the simultaneous diagnosis of both DNA- and RNA-based pathogens, providing a more versatile alternative to the use of direct RNA and/or direct cDNA sequencing kits.

Next-Generation Sequencing for the Detection of Microbial Agents in Avian Clinical Samples.

Direct-targeted next-generation sequencing (tNGS), with its undoubtedly superior diagnostic capacity over real-time PCR (RT-PCR), and direct-non-targeted NGS (ntNGS), with its higher capacity to identify and characterize multiple agents, are both likely to become diagnostic methods of choice in the future. tNGS is a rapid and sensitive method for precise characterization of suspected agents. ntNGS, also known as agnostic diagnosis, does not require a hypothesis and has been used to identify unsuspected infections in clinical samples. Implemented in the form of multiplexed total DNA metagenomics or as total RNA sequencing, the approach produces comprehensive and actionable reports that allow semi-quantitative identification of most of the agents present in respiratory, cloacal, and tissue samples. The diagnostic benefits of the use of direct tNGS and ntNGS are high specificity, compatibility with different types of clinical samples (fresh, frozen, FTA cards, and paraffin-embedded), production of nearly complete infection profiles (viruses, bacteria, fungus, and parasites), production of "semi-quantitative" information, direct agent genotyping, and infectious agent mutational information. The achievements of NGS in terms of diagnosing poultry problems are described here, along with future applications. Multiplexing, development of standard operating procedures, robotics, sequencing kits, automated bioinformatics, cloud computing, and artificial intelligence (AI) are disciplines converging toward the use of this technology for active surveillance in poultry farms. Other advances in human and veterinary NGS sequencing are likely to be adaptable to avian species in the future.

Correcting modification-mediated errors in nanopore sequencing by nucleotide demodification and reference-based correction

The accuracy of Oxford Nanopore Technology (ONT) sequencing has significantly improved thanks to new flowcells, sequencing kits, and basecalling algorithms. However, novel modification types untrained in the basecalling models can seriously reduce the quality. Here we reports a set of ONT-sequenced genomes with unexpected low quality due to novel modification types. Demodification by whole-genome amplification significantly improved the quality but lost the epigenome. We also developed a reference-based method, Modpolish, for correcting modification-mediated errors while retaining the epigenome when a sufficient number of closely-related genomes is publicly available (default: top 20 genomes with at least 95% identity). Modpolish not only significantly improved the quality of in-house sequenced genomes but also public datasets sequenced by R9.4 and R10.4 (simplex). Our results suggested that novel modifications are prone to ONT systematic errors. Nevertheless, these errors are correctable by nucleotide demodification or Modpolish without prior knowledge of modifications.

Identification of plasmids in avian-associated Escherichia coli using nanopore and illumina sequencing

BackgroundAvian pathogenic Escherichia coli (APEC) are the causative agents of colibacillosis in chickens, a disease which has significant economic impact on the poultry industry. Large plasmids detected in APEC are known to contribute to strain diversity for pathogenicity and antimicrobial resistance, but there could be other plasmids that are missed in standard analysis. In this study, we determined the impact of sequencing and assembly factors for the detection of plasmids in an E. coli whole genome sequencing project.ResultsHybrid assembly (Illumina and Nanopore) combined with plasmid DNA extractions allowed for detection of the greatest number of plasmids in E. coli, as detected by MOB-suite software. In total, 79 plasmids were identified in 19 E. coli isolates. Hybrid assemblies were robust and consistent in quality regardless of sequencing kit used or if long reads were filtered or not. In contrast, long read only assemblies were more variable and influenced by sequencing and assembly parameters. Plasmid DNA extractions allowed for the detection of physically smaller plasmids, but when averaged over 19 isolates did not significantly change the overall number of plasmids detected.ConclusionsHybrid assembly can be reliably used to detect plasmids in E. coli, especially if researchers are focused on large plasmids containing antimicrobial resistance genes and virulence factors. If the goal is comprehensive detection of all plasmids, particularly if smaller sized vectors are desired for biotechnology applications, the addition of plasmid DNA extractions to hybrid assemblies is prudent. Long read sequencing is sufficient to detect many plasmids in E. coli, however, it is more prone to errors when expanded to analyze a large number of isolates.

Draft genome sequencing of Tilletia caries inciting common bunt of wheat provides pathogenicity-related genes.

Common bunt of wheat caused by Tilletia caries is an important disease worldwide. The T. caries TC1_MSG genome was sequenced using the Illumina HiSeq 2500 and Nanopore ONT platforms. The Nanopore library was prepared using the ligation sequencing kit SQK-LSK110 to generate approximately 24 GB for sequencing. The assembly size of 38.18 Mb was generated with a GC content of 56.10%. The whole genome shotgun project was deposited at DDBJ/ENA/GenBank under the accession number JALUTQ000000000. Forty-six contigs were obtained with N50 of 1,798,756 bp. In total, 10,698 genes were predicted in the assembled genome. Out of 10,698 genes, 10,255 genes were predicted significantly in the genome. The repeat sequences made up approximately 1.57% of the genome. Molecular function, cellular components, and biological processes for predicted genes were mapped into the genome. In addition, repeat elements in the genome were assessed. In all, 0.89% of retroelements were observed, followed by long terminal repeat elements (0.86%) in the genome. In simple sequence repeat (SSR) analysis, 8,582 SSRs were found in the genome assembly. The trinucleotide SSR type (3,703) was the most abundant. Few putative secretory signal peptides and pathogenicity-related genes were predicted. The genomic information of T. caries will be valuable in understanding the pathogenesis mechanism as well as developing new methods for the management of the common bunt disease of wheat.

First report of stem rot of Adenium obesum and leaf spot of Persea americana caused by Aspergillus niger in Kazakhstan.

Adenium (Adenium obesum) and avocado (Persea americana) are commonly grown as exotic houseplants in city apartments of Kazakhstan. In April-May 2020, the wilting symptom was observed on the young stems of five 2-year-old A. obesum plants in a city apartment in Saryarqa District, Astana, Kazakhstan (71°25'E, 51°11'N). Leaves turned yellow and then dried up. Plants were completely wilted within 10 days (Fig. 1A). Similar symptoms were observed in newly grown A. obesum plants in November, 2021. At the same time, lesions were found on the leaves of three 3-month-old P. americana plants. Infected leaves displayed dry, dark-brown lesions and fell off easily (Fig. 2A). Both plants were cultivated side by side. The incidence of affected A. obesum was 80% out of 5 plants and P. americana was 100% out of 3 plants. To isolate the causal agent, the infected tissues from different leaves and stems of A. obesum and P. americana plants were cut into small pieces (5 × 5 mm), washed in 70% ethanol for 5 min, and then rinsed three times with sterile distilled water. Cut pieces were placed on potato dextrose agar (PDA) (Laboratorios Conda S.A., Spain) and incubated at 28°C for 7 days. Ten isolates were obtained from leaves and stems of the A. obesum and P. americana symptomatic samples. All fungal colonies were white initially, turned black gradually, reverse side light yellow (Fig. 1B and Fig. 2B), conidiophores biseriate with globose vesicles, conidia were spherical vesicles, light tan to black color, smooth-walled to roughened, and sizes ranged from 3.0 to 3.5 μm (n = 15) (Fig. 1C and Fig. 2C). These observations indicated that all the isolates resembled Aspergillus spp. (Bryan and Fennell 1965). DNA was extracted using the liquid nitrogen and phenol-chloroform extraction method (Butler 2012). A 526 bp product of the ITS region on rDNA and 568 bp product of the calmodulin protein-coding gene was amplified using following primer pairs ITS4/ITS5 (Abliz et al. 2003) and cmd5/cmd6, respectively (Hong et al. 2005). The PCR reaction was done under the following conditions: initial denaturation at 94°C for 5 min, 35 cycles at 95°C for 30 s to denature, 52°C for 40 s for annealing, and 72°C for 50 s for extension. A final extension step at 72°C for 7 min was also included. The sequencing was done using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and the sequence was deposited in GenBank with accession nos. ON519078 (A. obesum ITS), ON519079 (P. americana ITS), OQ358173 (A. obesum calmodulin) and OQ358174 (P. americana calmodulin). These sequences were compared with other sequences of A. niger in GenBank using BLAST analysis (MG569619.1, MT588793.1, MH478660.1, MZ787576.1 and MW086485.1). The results showed that the sequences of ten isolates were identical and had 98-100% identity with those of Aspergillus niger (Fig. 3). The phylogenetic analysis was carried out with MEGA 11 (Tamura et al. 2021). To confirm the pathogenicity, three asymptomatic plants of each were inoculated with a suspension of conidia via pin-prick inoculation (1.0×106 conidia/ml; obtained from 2-week-old cultures). Control plants were inoculated with sterile distilled water. The inoculated plants were placed in climate chamber (BINDER, Germany) and incubated for 10 days at 28°C. Symptoms were developed in leaves of inoculated plants after 2 days in P. americana and after 5 days in A. obesum. Affected leaves turned yellow and their stems started drying. Symptoms of leaves were similar to those observed on naturally infected plants, while control plants remained asymptomatic. Re-isolation of the pathogen confirmed the presence of the A. niger pathogen. To our knowledge, this is the first report of A. niger causing stem rot of A. obesum and leaf spot of P. americana in Kazakhstan. Since different ornamentals are often planted together in gardens and nurseries, growers should be aware of potential transmission of A. niger among them. This finding provides a foundation to further investigate the biology and epidemiology of this disease so the developmentf diagnostic tools and management measures against it.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

First report of Klebsiella Leaf Streak on Sorghum Caused by Klebsiella variicola in Haryana, India.

Sorghum (Sorghum bicolor [L.] Moench) is one of the top ten cereal crops in the world and is grown for fodder and seed purposes. During the fall of 2019 to 2022, a disease causing small to long streaks on leaves was observed in sorghum fields of Hisar (29° 9' 6.6996'' N, 75° 43' 16.0428'' E), Rohtak (28° 53' 43.8540'' N, 76° 36' 23.8068'' E) and Mohindergarh (28° 16' 6.0492'' N, 76° 9' 3.3552'' E) regions of Haryana between July and October. The reddish brown streaks were observed in the interveinal spaces of upper and lower leaves. The disease incidence reached 20-30% of plants in affected fields. The diseased leaf tissues were disinfected with 70% alcohol and placed in a tube with sterile water. After 30 minutes, 100 µl of the suspension was inoculated onto nutrient agar medium, incubated at 28 ± 2°C for three days, and a pure culture was obtained by restreaking on nutrient agar (Janse, 2005). The rod-shaped gram-negative bacterium with round, cream to white colonies was positive for methyl red, citrate utilization, urease activity, and glucose, lactose, sorbitol, rhamnose and sucrose fermentation tests. The genomic DNA of the bacterial suspension was extracted and 16S rDNA was amplified using universal 27F/1492R primers (Marchesi et al. 1998), resulting in tentative identification as Klebsiella sp. It was further confirmed with PCR amplification of Klebsiella specific primers (F:5'-CGCGTACTATACGCCATGAACGTA-3'; R:5'-ACCGTTGATCACTTCGGTCAGG-3') for gyrA gene (Brisse and Verhoef 2001). Discrete PCR amplicons of 1,500 (16S rDNA) and 300 bp (gyrA) were observed in a 1% (w/v) agarose gel. Forward and reverse DNA sequencing of both amplicons of the Hisar isolate (VMKV101) was carried out using a BDT v3.1 Cycle sequencing kit and consensus sequences were generated by using the program SeqMan Ultra (DNASTAR Lasergene). Sequences of the PCR products were deposited in GenBank with accession numbers MZ569433 (16S rDNA) and OP390080 (gyrA). The 16S rDNA sequence was 97.32% similar to K. variicola strain 13450 (CP026013; 1,450/1,490 bp) and the gyrA sequence had 99.66% similarity to K. variicola strain FH-1 (CP054254; 297/298 bp). A 16S RNA-based phylogenetic tree done by MEGA11 (Tamura et al. 2021) using the Maximum Likelihood method showed that strain VMKV101 clustered with K. variicola type strain F2R9. The complete bacterial genome (GCA025629215), sequenced by the Ion GeneStudio S5 system using Ion 530 chips (Thermo Fisher Scientific), was 99.03% identical by average nucleotide identity (ANI) to the type genome (CP045783) of Klebsiella variicola, with 87.8% genome coverage. For pathogenicity testing, a bacterial suspension (10 ml, 1×107 colony forming units/ml) was injected into the whole whorl after mechanical injury on 15-20 days old seedlings of the susceptible genotype HC-171, then plants were incubated at 35 ± 2°C, >80% relative humidity. Control plants were injected with sterile distilled water. Initial symptoms were observed on leaves of inoculated plants after 5 to 7 days as narrow, small longitudinal reddish brown streaks. As the disease progressed, the streaks on the leaf blade increased in number and size maintaining the reddish brown color. These streaks had slightly wavy margins and were surrounded by bright yellow halos. After 15 to 20 days, the streaks were 0.5 to 2.0 mm wide and 1.0 to 5.0 cm long, occasionally up to 10.0 cm long on both side of the leaves. Over time, neighboring streaks coalesced to form large necrotic areas. All inoculated plants exhibited identical symptoms. No symptoms were observed on control leaves. The reisolated bacterium from diseased sorghum leaves showed exactly the same morphological, biochemical and 16S RNA and gyrA molecular characteristics. To our knowledge, this is the first report of K. variicola causing a leaf streak disease on sorghum. Klebsiella species primarily cause diseases in humans and animals, but K. variicola has been found to incite banana soft rot (Fan et al. 2015) and K. aerogenes to cause stem rot in pearl millet (Malik et al. 2022). Differences of prevalence, spread and control between K. variicola and two other bacteria (Xanthomonas vasicola pv. holcicola causing Bacterial leaf streak; Paraburkholderia andropogonis causing Bacterial leaf stripe) causing leaf streak diseases on sorghum need to be determined. The identification of Klebsiella leaf streak disease lays the groundwork for future investigations into epidemiology and management of K. variicola on sorghum.

Ultrarapid and high-resolution HLA class I typing using transposase-based nanopore sequencing applied in pharmacogenetic testing.

Nanopore sequencing has been examined as a method for rapid and high-resolution human leukocyte antigen (HLA) typing in recent years. We aimed to apply ultrarapid nanopore-based HLA typing for HLA class I alleles associated with drug hypersensitivity, including HLA-A*31:01, HLA-B*15:02, and HLA-C*08:01. Most studies have used the Oxford Nanopore Ligation Sequencing kit for HLA typing, which requires several enzymatic reactions and remains relatively expensive, even when the samples are multiplexed. Here, we used the Oxford Nanopore Rapid Barcoding kit, which is transposase-based, with library preparation taking less than 1h of hands-on time and requiring minimal reagents. Twenty DNA samples were genotyped for HLA-A, -B, and -C; 11 samples were from individuals of different ethnicity and nine were from Thai individuals. Two primer sets, a commercial set and a published set, were used to amplify the HLA-A, -B, and -C genes. HLA-typing tools that used different algorithms were applied and compared. We found that without using several third-party reagents, the transposase-based method reduced the hands-on time from approximately 9h to 4h, making this a viable approach for obtaining same-day results from 2 to 24 samples. However, an imbalance in the PCR amplification of different haplotypes could affect the accuracy of typing results. This work demonstrates the ability of transposase-based sequencing to report 3-field HLA alleles and its potential for race- and population-independent testing at considerably decreased time and cost.

Culture-Independent Workflow for Nanopore MinION-Based Sequencing of Influenza A Virus.

Whole-genome sequencing (WGS) of influenza A virus (IAV) is crucial for identifying diverse subtypes and newly evolved variants and for selecting vaccine strains. In developing countries, where facilities are often inadequate, WGS is challenging to perform using conventional next-generation sequencers. In this study, we established a culture-independent, high-throughput native barcode amplicon sequencing workflow that can sequence all influenza subtypes directly from a clinical specimen. All segments of IAV in 19 clinical specimens, irrespective of their subtypes, were amplified simultaneously using a two-step reverse transcriptase PCR (RT-PCR) system. First, the library was prepared using the ligation sequencing kit, barcoded individually using the native barcodes, and sequenced on the MinION MK 1C platform with real-time base-calling. Then, subsequent data analyses were performed with the appropriate tools. WGS of 19 IAV-positive clinical samples was carried out successfully with 100% coverage and 3,975-fold mean coverage for all segments. This easy-to-install and low-cost capacity-building protocol took only 24 h complete from extracting RNA to obtaining finished sequences. Overall, we developed a high-throughput portable sequencing workflow ideal for resource-limited clinical settings, aiding in real-time surveillance, outbreak investigation, and the detection of emerging viruses and genetic reassortment events. However, further evaluation is required to compare its accuracy with other high-throughput sequencing technologies to validate the widespread application of these findings, including WGS from environmental samples. IMPORTANCE The Nanopore MinION-based influenza sequencing approach we are proposing makes it possible to sequence the influenza A virus, irrespective of its diverse serotypes, directly from clinical and environmental swab samples, so that we are not limited to virus culture. This third-generation, portable, multiplexing, and real-time sequencing strategy is highly convenient for local sequencing, particularly in low- and middle-income countries like Bangladesh. Furthermore, the cost-efficient sequencing method could provide new opportunities to respond to the early phase of an influenza pandemic and enable the timely detection of the emerging subtypes in clinical samples. Here, we meticulously described the entire process that might help the researcher who will follow this methodology in the future. Our findings suggest that this proposed method is ideal for clinical and academic settings and will aid in real-time surveillance and in the detection of potential outbreak agents and newly evolved viruses.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Occurrence of Tomato leaf curl New Delhi virus in tomato (Lycopersicon esculentum) in China.

Tomato leaf curl New Delhi virus (ToLCNDV), a member of the genus Begomovirus in the family Geminiviridae is naturally transmitted by the whitefly Bemisia tabaci (order Hemiptera, family Aleyrodidae) in a circulative and persistent manner (Moriones et al. 2017). ToLCNDV has occurred in Bangladesh, India, Indonesia, Iran, Italy, Malaysia, Pakistan, Sri Lanka, Spain, Thailand and Tunisia (Moriones et al. 2017). To date, The primary cultivated host of ToLCNDV has been identified as tomato (Lycopersicon esculentum), but the virus is also known to infect 43 other plant species from a range of families including Cucurbitaceae, Euphorbiaceae, Solanaceae, Malvaceae and Fabaceae (Zaidi et al. 2017). In August 2021, virus-like symptoms including leaf deformation and curing were observed on tomato (Lycopersicon esculentum) in a greenhouse of about 0.5 hectares in Zhejiang Province, China. To identify viral agents potentially associated with this disease, an Oxford Nanopore cDNA library from a symptomatic sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan). Libraries were constructed using Oxford Nanopore PCR-cDNA Sequencing Kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK), as recommended. Approximately 8.7 million reads were obtained from the Oxford MinION platform. After removing the adapters and low-quality reads, the clean reads were subjected to BLASTn analysis against the nt database. Approximately 797 and 168 reads produced high nt identities to the genome of ToLCNDV DNA-A (GeneBank Accession No. U15015.2) and ToLCNDV DNA-B (GeneBank Accession No. U15017.2) respectively. We designed 6 primer pairs (Table S1) to obtain the sequence of ToLCNDV Zhejiang (ToLCNDV-ZJ) isolate DNA-A and DNA-B. Briefly, total DNA from ToLCNDV-infected tomato was extracted using standard cetyl trimethylammonium bromide method. Segments of ToLCNDV DNA-A and DNA-B were amplified using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced. The obtained sequences were assembled into complete sequences of ToLCNDV-ZJ DNA-A (2,739 nt, GeneBank Accession No. OP356207) and DNA-B (2,693 nt, GeneBank Accession No. OP356208). Pairwise sequence comparison revealed that the ToLCNDV -ZJ shared the highest nt sequence identities of 98.7% and 98.4% with the genome segments of New Delhi isolate (genome A: HM159454) and India:Delhi:Cucumis:2012 isolate (genome B: KC545813) respectively. Furthermore, we performed PCR detection on 10 collected samples using the primer pair P1F and P1R. All eight symptomatic plants showing upward leaf curling and leaf distortion tested positive for ToLCNDV infection, whereas two asymptomatic plants were ToLCNDV free. To our knowledge, this is the first report of ToLCNDV infecting tomato in China, and with the widespread presence of B. tabaci in green houses, ToLCNDV may be a potential threat to the cultivation of tomato in China. In addition, ToLCNDV is an exceptional Old World bipartite begomovirus. In China, monopartite DNA satellite-associated begomoviruses with mostly narrow geographical ranges predominate, and are widespread (Li et al., 2022). The occurrence of ToLCNDV in China, which indicates that the success of this virus would become an emerging threat to vegetable and fiber crops.

Evaluation of miniaturized Illumina DNA preparation protocols for SARS-CoV-2 whole genome sequencing.

The global pandemic caused by SARS-CoV-2 has increased the demand for scalable sequencing and diagnostic methods, especially for genomic surveillance. Although next-generation sequencing has enabled large-scale genomic surveillance, the ability to sequence SARS-CoV-2 in some settings has been limited by the cost of sequencing kits and the time-consuming preparations of sequencing libraries. We compared the sequencing outcomes, cost and turn-around times obtained using the standard Illumina DNA Prep kit protocol to three modified protocols with fewer clean-up steps and different reagent volumes (full volume, half volume, one-tenth volume). We processed a single run of 47 samples under each protocol and compared the yield and mean sequence coverage. The sequencing success rate and quality for the four different reactions were as follows: the full reaction was 98.2%, the one-tenth reaction was 98.0%, the full rapid reaction was 97.5% and the half-reaction, was 97.1%. As a result, uniformity of sequence quality indicated that libraries were not affected by the change in protocol. The cost of sequencing was reduced approximately seven-fold and the time taken to prepare the library was reduced from 6.5 hours to 3 hours. The sequencing results obtained using the miniaturised volumes showed comparability to the results obtained using full volumes as described by the manufacturer. The adaptation of the protocol represents a lower-cost, streamlined approach for SARS-CoV-2 sequencing, which can be used to produce genomic data quickly and more affordably, especially in resource-constrained settings.

Exploring rare differences in mitochondrial genome between MZ twins using Ion Torrent semiconductor sequencing

Monozygotic (MZ) twins are considered to be genetically identical in that they have the same genomic DNA sequences in theory, and thus cannot be differentiated using forensic standard STR-based DNA profiling. However, a recent study employed deep sequencing to explore extremely rare mutations in the nuclear genome and reported that the mutation analysis could be applied to differentiate between MZ twins. Compared with the nuclear genome, the mitochondrial DNA (mtDNA) exhibits higher mutation rates due to fewer DNA repair mechanisms in the mitochondrial genome (mtGenome) and the lack of proofreading capability of the mtDNA polymerase. In a previous study, we used Illumina ultra-deep sequencing to describe point heteroplasmy (PHP) and nucleotide variant of the mtGenomes in venous blood samples of MZ twins. In the present study, we characterized minor differences of the mtGenomes in three tissue samples from seven sets of MZ twins using Ion Torrent semiconductor sequencing (Thermo Fisher Ion S5 XL system) and commercialized mtGenome sequencing kit (Precision ID mtDNA Whole Genome Panel). PHP was observed in blood samples from one set of MZ twins and in saliva samples from two sets of twins, but it presented in hair shaft samples from all seven sets of MZ twins. Overall, the coding region of the mtGenome exhibits more PHPs than the control region. The results of this study have further attested the competence of mtGenome sequencing in differentiating between MZ twins, and that among the three kinds of samples tested, hair shaft is more likely to accumulate minor differences in the mtGenomes of MZ twins.

Molecular Genetic Analysis of the Autosomal Recessive Non-Syndromic Inherited Retinitis Pigmentosa.

90% of visually impaired people live in developing countries. There are various types of vision impairment, but the focus of the current study is retinitis pigmentosa (RP). Up to now, 150 mutations have been reported that are linked with RP. Healthy and affected members from two Pakistani families (RP01 and RP02) segregating autosomal recessive RP were selected for DNA extraction. PCR was conducted, and the amplified PCR products were analyzed using Polyacrylamide Gel Electrophoresis (PAGE) andvisualized in the Gel Doc systemfor linkage analysis.The Gene Hunter 2.1r5 tool in the Simple Linkage v5.052 beta software suite was used to conduct multipoint parametric linkage analysis on the two consanguineous families examined on the 6K Illumina array. Exons and intron-exon borders of all known arRP genes found in homozygous areas were sequenced in the matching probands using a 3130 automated sequencer and the Big Dye Terminator Cycle Sequencing Kit v3.1. The mutation study was carried out using the AlaMut 1.5 program. In both families, linkage analysis was performed using microsatellite marker DIS422 for genecrumbs homolog 1 (CRB1)and microsatellite marker D8S2332 for geneRetinitis Pigmentosa 1 (RP1). Multipoint linkage analysis identifies genomic regions that could potentially contain the genetic defect. In family RP01, only a single peak with a maximal multipoint LOD score of 3.00 was identified on chromosome 1, whereas in family RP02, multiple peaks with multipoint LOD scores of 1.80 were identified on chromosome 8. Analysis of theCRB1gene revealed a homozygous substitution of glycine for valine (c.1152T>G; p.V243G), whereas theRP1gene demonstrated that leucine was substituted for proline as a result of cytosine to thymine transfer (c.3419C>T; p. P1035L). Conclusion: Homozygosity mapping is a powerful method for finding genetic abnormalities that are both precise and comprehensive for identifying harmful variations in consanguineous families. This method is invaluable for providing accurate clinical diagnostic and genetic advice in remote regions of Pakistanwhile also increasing knowledge about autosomal recessive diseases and the dangers of mixing.

Evaluating the Transition from Targeted to Exome Sequencing: A Guide for Clinical Laboratories.

The transition from targeted to exome or genome sequencing in clinical contexts requires quality standards, such as targeted sequencing, in order to be fully adopted. However, no clear recommendations or methodology have emerged for evaluating this technological evolution. We developed a structured method based on four run-specific sequencing metrics and seven sample-specific sequencing metrics for evaluating the performance of exome sequencing strategies to replace targeted strategies. The indicators include quality metrics and coverage performance on gene panels and OMIM morbid genes. We applied this general strategy to three different exome kits and compared them with a myopathy-targeted sequencing method. After having achieved 80 million reads, all-tested exome kits generated data suitable for clinical diagnosis. However, significant differences in the coverage and PCR duplicates were observed between the kits. These are two main criteria to consider for the initial implementation with high-quality assurance. This study aims to assist molecular diagnostic laboratories in adopting and evaluating exome sequencing kits in a diagnostic context compared to the strategy used previously. A similar strategy could be used to implement whole-genome sequencing for diagnostic purposes.

Abstract 259: Fully automated targeted sequencing sample prep on open platform liquid handlers

Abstract To accommodate the growing demands of sample throughput, reliability, and reduced hands-on time of targeted sequencing, automation is critical. The implementation of sample preparation automation is limited by several factors — complicated protocols and long incubation times. As an industry first, Avida’s Point-n-Seq™ hybridization-based targeted sequencing kit solution features 1 hr hybridization time and PCR free capture which enables full automation on a broad range of open platform liquid handlers, from the economical Opentrons (OT-2) to the high throughput Hamilton (Microlab Star). We report a walk-away targeted sequencing sample-prep solution based on the highly efficient chemistry of our Point-n-Seq technology. This strategy supports PCR-free capture for variant detection. A sequencing-ready captured library is prepared in 6 hours, with just 25 minutes of hands-on time. More importantly, a PCR-free protocol increases sequence uniformity, decreases amplicon bias as well as GC-bias, and eliminates the need for purification and quantification before capture. We have demonstrated the feasibility of automated workflows using 40 ng of genomic DNA with panel sizes ranging from 20 Kb to 2 Mb. Using a comprehensive oncology panel containing 500 genes to analyze Horizon oncology cfDNA (30 ng) or FFPE gDNA (40 ng) reference standards, we demonstrated reliable detection of SNV and structural variations with allele frequency matching the expected values. The Point-n-Seq technology enables fully automated targeted sequencing sample prep on open platform liquid handlers, enhancing accuracy and reliability while reducing hands-on time. The one hour hybridization time makes hybridization more economical on the liquid handler when compared to off-instrument for overnight/longer hybridization. This automated solution greatly accelerates the development of fast, simple, and accurate genomic profiling assays. Furthermore, Point-n-Seq targeted methylation sequencing and targeted RNA assays can also be easily adapted to the same automation platforms for research and clinical applications. Citation Format: Ashraf Wahba, Yun Bao, Heng Wang, Kinnari Watson, Grace Q. Zhao, Shengrong Lin. Fully automated targeted sequencing sample prep on open platform liquid handlers [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 1 (Regular and Invited Abstracts); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(7_Suppl):Abstract nr 259.