Protein-coding Gene Sequences Research Articles

Mitochondrial genome sequences of Artemia tibetiana and Artemia urmiana: assessing molecular changes for high plateau adaptation

Brine shrimps, Artemia (Crustacea, Anostraca), inhabit hypersaline environments and have a broad geographical distribution from sea level to high plateaus. Artemia therefore possess significant genetic diversity, which gives them their outstanding adaptability. To understand this remarkable plasticity, we sequenced the mitochondrial genomes of two Artemia tibetiana isolates from the Tibetan Plateau in China and one Artemia urmiana isolate from Lake Urmia in Iran and compared them with the genome of a low-altitude Artemia, A. franciscana. We compared the ratio of the rate of nonsynonymous (Ka) and synonymous (Ks) substitutions (Ka/Ks ratio) in the mitochondrial protein-coding gene sequences and found that atp8 had the highest Ka/Ks ratios in comparisons of A. franciscana with either A. tibetiana or A. urmiana and that atp6 had the highest Ka/Ks ratio between A. tibetiana and A. urmiana. Atp6 may have experienced strong selective pressure for high-altitude adaptation because although A. tibetiana and A. urmiana are closely related they live at different altitudes. We identified two extended termination-associated sequences and three conserved sequence blocks in the D-loop region of the mitochondrial genomes. We propose that sequence variations in the D-loop region and in the subunits of the respiratory chain complexes independently or collectively contribute to the adaptation of Artemia to different altitudes.

Proposal of Zygosaccharomyces parabailii sp. nov. and Zygosaccharomyces pseudobailii sp. nov., novel species closely related to Zygosaccharomyces bailii

Twenty-three yeast strains traditionally identified as Zygosaccharomyces bailii were studied in order to clarify their taxonomy and phylogenetic relationships. The molecular phylogeny from rRNA gene sequences showed that these yeasts were well divided into three major groups, and two of the groups could be clearly distinguished from the type strain of Z. bailii at the species level. Therefore, we propose Zygosaccharomyces parabailii sp. nov. (type strain ATCC 56075(T) = NBRC 1047(T) = NCYC 128(T) = CBS 12809(T)) and Zygosaccharomyces pseudobailii sp. nov. (type strain ATCC 56074(T) = NBRC 0488(T) = CBS 2856(T)) to accommodate the yeasts belonging to the two groups. By conventional physiological tests, Z. bailii and the two novel species are not clearly distinguished from one another, as variations exist more frequently between individual strains and are not species-specific. However, the conclusions from rRNA gene sequence analyses are well supported by genome fingerprinting patterns as well as other protein-coding gene sequence comparisons.

Trichoderma eijii and T. pseudolacteum, two new species from Japan

Trichoderma eijii and T. pseudolacteum, are described here as new species from Japan. These species were isolated from decaying wood in the Tomakomai Experimental Forest in Hokkaido Prefecture and from bedlogs on shiitake mushroom (Lentinula edodes) farms, respectively. The species were characterized using a combined approach that included cultural studies, holomorph morphology, and phylogenetic analyses of internal transcribed spacer and protein coding gene sequences (RNA polymerase subunit II, translation elongation factor 1-α, endochitinase, and actin). The results of phylogenetic analyses of these gene sequences indicate that T. eijii belongs to the Hamatum clade and is closely related to Hypocrea pezizoides, H. flaviconidia, and H. atroviridis/T. atroviride, from which it differs mainly in part-ascospore size and anamorphic characteristics. Trichoderma pseudolacteum, which was previously recognized as H. lactea sensu Doi, is morphologically distinct from H. lactea (= Hypocrea citrina) and is strongly supported as a separate lineage based on our phylogenetic analyses.

MiR156- and miR171-Binding Sites in the Protein-Coding Sequences of Several Plant Genes

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a–j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a–d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a–c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a–c families should be in one family.

Rare, Low-Frequency, and Common Variants in the Protein-Coding Sequence of Biological Candidate Genes from GWASs Contribute to Risk of Rheumatoid Arthritis

The extent to which variants in the protein-coding sequence of genes contribute to risk of rheumatoid arthritis (RA) is unknown. In this study, we addressed this issue by deep exon sequencing and large-scale genotyping of 25 biological candidate genes located within RA risk loci discovered by genome-wide association studies (GWASs). First, we assessed the contribution of rare coding variants in the 25 genes to the risk of RA in a pooled sequencing study of 500 RA cases and 650 controls of European ancestry. We observed an accumulation of rare nonsynonymous variants exclusive to RA cases in IL2RA and IL2RB (burden test: p = 0.007 and p = 0.018, respectively). Next, we assessed the aggregate contribution of low-frequency and common coding variants to the risk of RA by dense genotyping of the 25 gene loci in 10,609 RA cases and 35,605 controls. We observed a strong enrichment of coding variants with a nominal signal of association with RA (p < 0.05) after adjusting for the best signal of association at the loci (p(enrichment) = 6.4 × 10(-4)). For one locus containing CD2, we found that a missense variant, rs699738 (c.798C>A [p.His266Gln]), and a noncoding variant, rs624988, reside on distinct haplotypes and independently contribute to the risk of RA (p = 4.6 × 10(-6)). Overall, our results indicate that variants (distributed across the allele-frequency spectrum) within the protein-coding portion of a subset of biological candidate genes identified by GWASs contribute to the risk of RA. Further, we have demonstrated that very large sample sizes will be required for comprehensively identifying the independent alleles contributing to the missing heritability of RA.

Diversity analysis of dairy and non-dairy strains of Lactococcus lactis ssp. lactis by multilocus sequence analysis (MLSA)

The genetic diversity of 31 identified strains of Lactococcus lactis ssp. lactis isolated from different dairy and non-dairy sources were investigated at gene level using multilocus sequence analysis (MLSA) and PCR-RFLP based on the differences in four selected partial protein coding gene sequences: araT, encoding aromatic amino acid-specific aminotransferase; dtpT, encoding di/tri peptide transporter; yueF, encoding non-proteolytic protein, peptidase, M16 family; and pdhA, encoding pyruvate dehydrogenase E1 component α-subunit. A set of seven test strains from different isolation sources and one reference strain, L. lactis ssp. lactis NCDC 094, were analyzed by MLSA. The strains showed distinct diversity among themselves and exhibited a greater percent similarity with reference strains L. lactis ssp. lactis CV56 (CP002365.1), IL1403 (AE005176.1), and KF147 (CP001834.1) in comparison with L. lactis ssp. cremoris NZ9000 (CP002094.1), MG1363 (AM406671.1), and SK11 (CP00425.1). The MLSA revealed one distinct genomic lineage within strains exclusively of L. lactis ssp. lactis. This analysis also revealed no source-wise genetic relationship in the test strains analyzed. Further, PCR-RFLP of araT, dtpT, yueF and pdhA also characterized the single genomic lineage exclusively of L. lactis ssp. lactis within a total of 24 test strains.

Mitogenomic Phylogenetic Analysis Supports Continental-Scale Vicariance in Subterranean Thalassoid Crustaceans

Many continental subterranean water crustaceans ("stygobionts") display extreme disjunct distributions, where different species in the same genus are isolated on continents or islands separated by broad oceanic expanses. Despite their freshwater habitat, most of these taxa appear to be most closely related to typical marine groups ("thalassoid" origin). Among the hadzioids-thalassoid amphipods including the stygobiont families Hadziidae, Pseudoniphargidae, and Metacrangonyctidae-several genera are restricted to inland groundwaters ranging from the Caribbean region to the Mediterranean and Middle East, including interspersed oceanic islands. This distribution might have arisen from Tethyan vicariance triggered by the sequential occlusion of the former Tethys Sea, a vast circumtropical ocean existing from the Middle Jurassic up to 20 million years ago (mya). Previous studies have been based on morphological analyses or limited DNA sequence data, making it difficult to test this hypothesis. We used complete mitochondrial protein-coding gene sequences, mainly obtained by next-generation sequencing methods and a nuclear ribosomal gene to resolve the phylogeny and to establish a time frame for diversification of the family Metacrangonyctidae (Amphipoda). The results were consistent with the plate tectonics vicariance hypothesis, with major diversifications occurring between 96 and 83 mya.

Next-generation phylogenomics using a Target Restricted Assembly Method

Next-generation sequencing technologies are revolutionizing the field of phylogenetics by making available genome scale data for a fraction of the cost of traditional targeted sequencing. One challenge will be to make use of these genomic level data without necessarily resorting to full-scale genome assembly and annotation, which is often time and labor intensive. Here we describe a technique, the Target Restricted Assembly Method (TRAM), in which the typical process of genome assembly and annotation is in essence reversed. Protein sequences of phylogenetically useful genes from a species within the group of interest are used as targets in tblastn searches of a data set from a lane of Illumina reads for a related species. Resulting blast hits are then assembled locally into contigs and these contigs are then aligned against the reference “cDNA” sequence to remove portions of the sequences that include introns. We illustrate the Target Restricted Assembly Method using genomic scale datasets for 20 species of lice (Insecta: Psocodea) to produce a test phylogenetic data set of 10 nuclear protein coding gene sequences. Given the advantages of using DNA instead of RNA, this technique is very cost effective and feasible given current technologies.

Mitochondrial genome of the Chinese gizzard shad Clupanodon thrissa (Clupeiformes: Clupeidae) and related phylogenetic analyses

The complete mitochondrial genome sequence of the single species from the Genus Clupanodon, the Chinese gizzard shad, Clupanodon thrissa, was determined. The entire sequence is 16,692 bp in length, including the typical structure of 13 protein-coding genes, 22 transfer RNA (tRNA) genes, 2 rRNA genes, and 2 noncoding regions (control region and L-strand replication origin). With the exception of ND6 and eight tRNA genes, all other genes are encoded on the heavy strand and the organization of genes is similar to that observed in most other vertebrates. Phylogenetic analyses using the protein coding gene sequences reveal that C. thrissa is most closely related to Konosirus punctatus within the family Clupeidae and subfamily Dorosomatinae is not a monophyletic group.

Xenorhabdus ishibashii sp. nov., isolated from the entomopathogenic nematode Steinernema aciari

Gram-negative bacteria of the genus Xenorhabdus exhibit a mutualistic association with steinernematid entomopathogenic nematodes and a pathogenic relationship with insects. Here we describe two isolates of the entomopathogenic nematode Steinernema aciari collected from China and Japan. 16S rRNA gene sequence similarity and phylogenetic analysis indicated that the isolates obtained from S. aciari belonged to the genus Xenorhabdus. Multilocus sequence analysis based on five universal protein-coding gene sequences revealed that the isolates were closely related to Xenorhabdus ehlersii DSM 16337(T) and Xenorhabdus griffiniae ID10(T) but that they exhibited <97 % sequence similarity with these reference strains, which indicated that the isolates were distinct from previously described species. Based on these genetic differences and several differential phenotypic traits, we propose that the isolates represent a novel species of the genus Xenorhabdus, for which we propose the name Xenorhabdus ishibashii sp. nov. The type strain is GDh7(T) ( = DSM 22670(T) = CGMCC 1.9166(T)).

Characterization of the complete mitochondrial genomes of two whipworms Trichuris ovis and Trichuris discolor (Nematoda: Trichuridae)

For many years, whipworms (Trichuris spp.) have been described with a relatively narrow range of both morphological and biometrical features. Moreover, there has been insufficient discrimination between congeners (or closely related species). In the present study, we determined the complete mitochondrial (mt) genomes of two whipworms Trichuris ovis and Trichuris discolor, compared them and then tested the hypothesis that T. ovis and T. discolor are distinct species by phylogenetic analyses using Bayesian inference, maximum likelihood and maximum parsimony) based on the deduced amino acid sequences of the mt protein-coding genes. The complete mt genomes of T. ovis and T. discolor were 13,946bp and 13,904bp in size, respectively. Both mt genomes are circular, and consist of 37 genes, including 13 genes coding for proteins, 2 genes for rRNA, and 22 genes for tRNA. The gene content and arrangement are identical to that of human and pig whipworms Trichuris trichiura and Trichuris suis. Taken together, these analyses showed genetic distinctiveness and strongly supported the recent proposal that T. ovis and T. discolor are distinct species using nuclear ribosomal DNA and a portion of the mtDNA sequence dataset. The availability of the complete mtDNA sequences of T. ovis and T. discolor provides novel genetic markers for studying the population genetics, diagnostics and molecular epidemiology of T. ovis and T. discolor.

Comprehensive analysis of RNA-Seq data reveals extensive RNA editing in a human transcriptome

RNA editing is a post-transcriptional event that recodes hereditary information. Here we describe a comprehensive profile of the RNA editome of a male Han Chinese individual based on analysis of ∼767 million sequencing reads from poly(A)(+), poly(A)(-) and small RNA samples. We developed a computational pipeline that carefully controls for false positives while calling RNA editing events from genome and whole-transcriptome data of the same individual. We identified 22,688 RNA editing events in noncoding genes and introns, untranslated regions and coding sequences of protein-coding genes. Most changes (∼93%) converted A to I(G), consistent with known editing mechanisms based on adenosine deaminase acting on RNA (ADAR). We also found evidence of other types of nucleotide changes; however, these were validated at lower rates. We found 44 editing sites in microRNAs (miRNAs), suggesting a potential link between RNA editing and miRNA-mediated regulation. Our approach facilitates large-scale studies to profile and compare editomes across a wide range of samples.

Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias.

BackgroundPseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes.ResultsWe sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis.The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13 mitochondrial protein-coding gene sequences consistently yield trees that place pseudoscorpions as sister to acariform mites.ConclusionThe well-supported phylogenetic placement of pseudoscorpions as sister to Acariformes differs from some previous analyses based on morphology. However, these two lineages share multiple molecular evolutionary traits, including substantial mitochondrial genome rearrangements, extensive nucleotide substitution, and loss of helices in their inferred tRNA and rRNA structures.

Complete mitochondrial genome of Nanorana pleskei (Amphibia: Anura: Dicroglossidae) and evolutionary characteristics

Abstract The complete mitochondrial genome of Nanorana pleskei from the Qinghai-Tibet Plateau was sequenced. It includes 17,660 base pairs, containing 13 protein-coding genes, two rRNAs and 23 tRNAs. A tandem duplication of tRNAMet gene was found in this mitochondrial genome, and the similarity between the two tRNAMet genes is 85.8%, being the highest in amphibian mitochondrial genomes sequenced thus far. Based on gene organization, 24 types were found from 145 amphibian mitochondrial genomes. Type 1 was present in 108 species, type 11 in 11 species, types 5, 16, 17, and 20 each in two species, and the others each present in one species. Fifteen types were found in Anura, being the most diversity in three orders of the Lissamphibia. Our phylogenetic results using 11 protein-coding gene sequences of 145 amphibian mitochondrial genomes strongly support the monophyly of the Lissamphibia, as well as its three orders, the Gymnophiona, Caudata, and Anura, among which the relationships were ((Gymnophiona (Caudata, Anura)). Based on the phylogenetic trees, type 1 was recognized as the ancestral type for amphibians, and type 11 was the synapomorphic type for the Neobatrachia. Gene rearrangements among lineages provide meaningful phylogenetic information. The rearrangement of the LTPF tRNA gene cluster and the translocation of the ND5 gene only found in the Neobatrachia support the monophyly of this group; similarly, the tandem duplication of the tRNAMet genes only found in the Dicroglossidae support the monophyly of this family.

The Complete Mitochondrial Genome of the Damsel Bug Alloeorhynchus bakeri (Hemiptera: Nabidae)

The complete sequence of the mitochondrial DNA (mtDNA) of the damsel bug, Alloeorhynchus bakeri, has been completed and annotated in this study. It represents the first sequenced mitochondrial genome of heteropteran family Nabidae. The circular genome is 15, 851 bp in length with an A+T content of 73.5%, contains the typical 37 genes that are arranged in the same order as that of the putative ancestor of hexapods. Nucleotide composition and codon usage are similar to other known heteropteran mitochondrial genomes. All protein-coding genes (PCGs) use standard initiation codons (methionine and isoleucine), except COI, which started with TTG. Canonical TAA and TAG termination codons are found in eight protein-coding genes, the remaining five (COI, COII, COIII, ND5, ND1) have incomplete termination codons (T or TA). PCGs of two strands present opposite CG skew which is also reflected by the nucleotide composition and codon usage. All tRNAs have the typical clover-leaf structure, except the dihydrouridine (DHU) arm of tRNA(Ser (AGN))which forms a simple loop as known in many other metazoa. Secondary structure models of the ribosomal RNA genes of A. bakeri are presented, similar to those proposed for other insect orders. There are six domains and 45 helices and three domains and 27 helices in the secondary structures of rrnL and rrnS, respectively. The major non-coding region (also called control region) between the small ribosomal subunit and the tRNA(Ile )gene includes two special regions. The first region includes four 133 bp tandem repeat units plus a partial copy of the repeat (28 bp of the beginning), and the second region at the end of control region contains 4 potential stem-loop structures. Finally, PCGs sequences were used to perform a phylogenetic study. Both maximum likelihood and Bayesian inference analyses highly support Nabidae as the sister group to Anthocoridae and Miridae.

PrimerBank: a PCR primer database for quantitative gene expression analysis, 2012 update

Optimization of primer sequences for polymerase chain reaction (PCR) and quantitative PCR (qPCR) and reaction conditions remains an experimental challenge. We have developed a resource, PrimerBank, which contains primers that can be used for PCR and qPCR under stringent and allele-invariant amplification conditions. A distinguishing feature of PrimerBank is the experimental validation of primer pairs covering most known mouse genes. Here, we describe a major update of PrimerBank that includes the design of new primers covering 17 076 and 18 086 genes for the human and mouse species, respectively. As a result of this update, PrimerBank contains 497 156 primers (an increase of 62% from the previous version) that cover 36 928 human and mouse genes, corresponding to around 94% of all known protein-coding gene sequences. An updated algorithm based on our previous approach was used to design new primers using current genomic information available from the National Center for Biotechnology Information (NCBI). PrimerBank primers work under uniform PCR conditions, and can be used for high-throughput or genome-wide qPCR. Because of their broader linear dynamic range and greater sensitivity, qPCR approaches are used to reanalyze changes in expression suggested by exploratory technologies such as microarrays and RNA-Seq. The primers and all experimental validation data can be freely accessed from the PrimerBank website, http://pga.mgh.harvard.edu/primerbank/.

The Genetics of Hybrid Incompatibilities

Incompatibilities in interspecific hybrids, such as sterility and lethality, are widely observed causes of reproductive isolation and thus contribute to speciation. Because hybrid incompatibilities are caused by divergence in each of the hybridizing species, they also reveal genomic changes occurring on short evolutionary time scales that have functional consequences. These changes include divergence in protein-coding gene sequence, structure, and location, as well as divergence in noncoding DNAs. The most important unresolved issue is understanding the evolutionary causes of the divergence within species that in turn leads to incompatibility between species. Surprisingly, much of this divergence does not appear to be driven by ecological adaptation but may instead result from responses to purely mutational mechanisms or to internal genetic conflicts.

Human polymorphisms at long non-coding RNAs (lncRNAs) and association with prostate cancer risk

Long non-coding RNAs (lncRNAs), representing a large proportion of non-coding transcripts across the human genome, are evolutionally conserved and biologically functional. At least one-third of the phenotype-related loci identified by genome-wide association studies (GWAS) are mapped to non-coding intervals. However, the relationships between phenotype-related loci and lncRNAs are largely unknown. Utilizing the 1000 Genomes data, we compared single-nucleotide polymorphisms (SNPs) within the sequences of lncRNA and protein-coding genes as defined in the Ensembl database. We further annotated the phenotype-related SNPs reported by GWAS at lncRNA intervals. Because prostate cancer (PCa) risk-related loci were enriched in lncRNAs, we then performed meta-analysis of two existing GWAS for discovery and an additional sample set for replication, revealing PCa risk-related loci at lncRNA regions. The SNP density in regions of lncRNA was similar to that in protein-coding regions, but they were less polymorphic than surrounding regions. Among the 1998 phenotype-related SNPs identified by GWAS, 52 loci were located directly in lncRNA intervals with a 1.5-fold enrichment compared with the entire genome. More than a 5-fold enrichment was observed for eight PCa risk-related loci in lncRNA genes. We also identified a new PCa risk-related SNP rs3787016 in an lncRNA region at 19q13 (per allele odds ratio = 1.19; 95% confidence interval: 1.11-1.27) with P value of 7.22 × 10(-7). lncRNAs may be important for interpreting and mining GWAS data. However, the catalog of lncRNAs needs to be better characterized in order to fully evaluate the relationship of phenotype-related loci with lncRNAs.

Hermit to King, or Hermit to All: Multiple Transitions to Crab-like Forms from Hermit Crab Ancestors

The Anomura presents the greatest degree of morphological disparity in the decapod Crustacea, with body forms ranging from the symmetrical and asymmetrical hermit crabs to squat lobsters and king crabs. The phylogeny of the anomurans has been fraught with controversy. Recent debate has focused primarily on the phenomenon of carcinization, the evolution of crab-like form from a non-crab-like ancestor, focused chiefly on derivation of king crabs from asymmetrical hermit crabs--the "hermit to king" hypothesis. We show by phylogenetic analysis of five nuclear protein-coding gene sequences that hermit crabs have a single origin, but surprisingly, that almost all other major clades and body forms within the Anomura, are derived from within the hermit crabs. The crab-like form and squat lobster form have each evolved at least twice from separate symmetrical hermit crab ancestors. In each case, a carcinization trend can be posited via a transition series from the initial symmetrical long-tailed hermit crab form, through the intermediate squat lobster or asymmetrical hermit crab form, to the final crab-like form. Adaptation to dextral shell habitation evolved at least twice, once in an exclusively deep-water clade and once in the common ancestor of all other asymmetrical hermit crabs (from which king crabs are derived). These remarkable cases of parallelism suggest considerable phenotypic flexibility within the hermit crab ground plan, with a general tendency toward carcinization. Rather than having a separate origin from other major clades, hermit crabs have given rise to most other major anomuran body types.

Synaptic Signaling and Aberrant RNA Splicing in Autism Spectrum Disorders

Interactions between presynaptic and postsynaptic cellular adhesion molecules (CAMs) drive synapse maturation during development. These trans-synaptic interactions are regulated by alternative splicing of CAM RNAs, which ultimately determines neurotransmitter phenotype. The diverse assortment of RNAs produced by alternative splicing generates countless protein isoforms necessary for guiding specialized cell-to-cell connectivity. Failure to generate the appropriate synaptic adhesion proteins is associated with disrupted glutamatergic and gamma-aminobutyric acid signaling, resulting in loss of activity-dependent neuronal plasticity, and risk for developmental disorders, including autism. While the majority of genetic mutations currently linked to autism are rare variants that change the protein-coding sequence of synaptic candidate genes, regulatory polymorphisms affecting constitutive and alternative splicing have emerged as risk factors in numerous other diseases, accounting for an estimated 40–60% of general disease risk. Here, we review the relationship between aberrant RNA splicing of synapse-related genes and autism spectrum disorders.