gyrB Sequences Research Articles

First Report of Bacterial Brown Rot Disease Caused by Ewingella americana on Cultivated Naematelia aurantialba in China.

Naematelia aurantialba (synonym Tremella aurantialba) is one of the jelly fungi and highly valued edible and medicinal mushrooms. It has been cultivated industrially in recent years and consumed popularly in China. In September 2022, brown rot disease of fruiting bodies was observed at the N. aurantialba factory in Tongzhou district, Beijing with a disease incidence of ~10%. Symptoms initially appeared as color changing from orange to light brown. The infected area expanded gradually until covered fully the fruiting body. Meanwhile, the interior of the fruiting body became rotten and dark brown. Finally, the whole fruiting body became wrinkled and brown, resulting in significantly reduced yield and economic loss. Isolations were made from 12 infected mushroom samples. Infected tissue within the fruiting body was mashed in sterilized 1.5 mL tubes containing 1 mL of sterile distilled water. After standing for 5-10 min, the suspensions were streaked on the Luria-Bertani (LB) medium and cultured at 37°C for 24h. The physiological and biochemical reactions of isolated strains were determined using the API 20E system (Reyes et al. 2004) according to the manufacturer's instructions. All the strains showed the same reaction results. The bacterial colonies were streaked on fresh LB medium at 37°C for 24 h, and a single pure culture was obtained with round, smooth and semitransparent. The bacterial cells were gram-negative, short-rod, (0.3) 0.8-2.0 (2.5) × (0.1) 0.6-1.0 (1.5) μm, and peri-flagellate. The isolates were further confirmed by sequence analysis of the 16S rRNA and gyrB genes with primer 27F/1492R and gyrB-UP1s/gyrB-UP2sr (Liu et al. 2018). Using EzBioCloud data searches, the 16S rRNA sequence of four strains (GenBank accession OP727593, OP727595, OP727596, OP727601) matched the sequence of E. americana type strain ATCC 33852 (accession JMPJ01000013) with identity of 99.65%~99.93 and 100% completeness. The GyrB sequence matched the E. americana in GenBank (MK460250) and showed 98.71% identity and 100% completeness. Finally, the pathogen was identified as E. americana based on morphological, physiological, biochemical, and molecular characteristics. The pathogenicity test was conducted by spreading bacterial suspensions cultured 48h onto 12 healthy cultivated fruiting bodies of N. aurantialba, with sterile distilled water as a control, and then cultured in a chamber at 23°C with 85% relative humidity. Brown symptoms, similar to natural symptoms, were observed on all inoculated fruiting bodies after 48h, whereas the controls remained symptomless. Pathogenic bacteria were isolated from the inoculated fruiting body and confirmed to be E. americana based on morphological and 16S rRNA molecular characteristics, thus fulfilling Koch's postulates. E. americana caused stipe necrosis on Agaricus bisporus in Egypt (Madbouly et al. 2014), the oak tree in Thailand, and pneumonia in Humans (Doonan et al. 2016), and brown blotch on Flammulina velutipes (Liu et al. 2018). To our knowledge, this is the first worldwide report of E. americana infecting jelly fungus N. aurantialba causing brown rot disease. E. americana is an opportunistic cross-kingdom pathogen (Liu et al. 2018). That will provide a critical alert on the prevention, effective monitoring, and control of the disease.

Identification of Leptospira Species in Environmental Soil of Urban Settlements in Cambodia.

Background: Leptospirosis represents a major public health threat in Cambodia. To help establish preventive strategies for leptospirosis, we isolated and identified Leptospira from soil collected in Phnom Penh and its neighboring province during the dry and rainy seasons. Materials and Methods: Soil samples were collected from 15 sites in the Phnom Penh metropolitan area and Kandal Province in 2019 and 2020. A total of 120 soil samples were collected and analyzed after culturing. Cultured isolates were identified at the species level using 16S rRNA and gyrB gene sequencing analysis. Results: The positive culture rate for Leptospira was significantly higher for samples collected during the rainy season (31 out of 60 samples, 51.7%) than during the dry season (19 out of 60 samples; p < 0.05, chi-squared test). In terms of sampling area, 10 (35.7%) and 13 (46.9%) soil samples from Phnom Penh and 9 (28.1%) and 18 (56.3%) soil samples from Kandal Province were culture-positive when collected during the dry and rainy seasons, respectively. Three isolates from the Kandal samples collected during the dry season were categorized as pathogenic clade type P1 according to 16S rRNA and gyrB sequence analyses. In addition, samples collected during the rainy season from Phnom Penh and Kandal Province (three each) were categorized as clade type P1. The samples with isolates in clade type P1 were collected from riverbanks during both the dry and rainy seasons and from a hospital garden during the rainy season. Conclusions: This is the first report on the isolation of clade P1 Leptospira species in environmental soil samples from Cambodia. Environmental soil appears to be a reservoir for Leptospira in the capital city and surrounding areas of Cambodia. This study contributes to the understanding of Leptospira species distribution in Asian countries.

Taxonomic Positions and Secondary Metabolite-Biosynthetic Gene Clusters of Akazaoxime- and Levantilide-Producers

Micromonospora sp. AKA109 is a producer of akazaoxime and A-76356, whereas Micromonospora sp. AKA38 is that of levantilide C. We aimed to clarify their taxonomic positions and identify biosynthetic gene clusters (BGCs) of these compounds. In 16S rRNA gene and DNA gyrase subunit B gene (gyrB) sequence analyses, strains AKA109 and AKA38 were the most closely related to Micromonospora humidisoli MMS20-R2-29T and Micromonospora schwarzwaldensis HKI0641T, respectively. Although Micromonospora sp. AKA109 was identified as M. humidisoli by the gyrB sequence similarity and DNA-DNA relatedness based on whole genome sequences, Micromonospora sp. AKA38 was classified to a new genomospecies. M. humidisoli AKA109 harbored six type-I polyketide synthase (PKS), one type-II PKS, one type-III PKS, three non-ribosomal peptide synthetase (NRPS) and three hybrid PKS/NRPS gene clusters, among which the BGC of akazaoxime and A-76356 was identified. These gene clusters are conserved in M. humidisoli MMS20-R2-29T. Micromonospora sp. AKA38 harbored two type-I PKS, one of which was responsible for levantilide C, one type-II PKS, one type-III PKS, two NRPS and five hybrid PKS/NRPS gene clusters. We predicted products derived from these gene clusters through bioinformatic analyses. Consequently, these two strains are revealed to be promising sources for diverse non-ribosomal peptide and polyketide compounds.

First Report of Bacterial Leaf Spot on Tobacco Caused by Pseudomonas psychrotolerans in China.

Tobacco (Nicotiana tabacum) is an economically important crop, and its productivity is challenged due to pathogen infection. In 2020 and 2021, a previously uncharacterized disease was observed on field grown tobacco (Variety NC102) in Zhucheng City, Shandong Province, China (119°7'14" E, 36°0'58" N), where tobacco has been grown for decades. The disease can be found throughout the growth period of tobacco and mainly occurred from fast growing period (about 13-16 leaves) to leaf maturity stage. In severely diseased areas, the incidence rate can reach 100%. The symptoms first began as chlorotic water stain like small spots, then the spots merged into larger irregular necrotic maculae around the chlorotic halos. Small pieces of symptomatic leaves from 10 different infected plants were collected for pathogen isolation. The small pieces of discolored leaves were surface sterilized with 75% ethanol for 40s and washed with sterile water for three times. The sterilized leaves were ground with a glass rod with 1mL sterile water, and 100 μL suspensions were spread on nutrient agar medium then incubated at 28oC for 48 hours. Yellow round colonies with undulating edges were showed up on nutrient agar medium 48 hours later. Three isolates were randomly picked up from each of the 10 plates for subsequent analysis. After purification and culture on nutrient agar plate, the 16S rRNA gene of the 30 isolates were amplified with primers 27F and 1492R and the amplicons were sequenced and analyzed by sequence alignment. The sequence alignment results showed that the 16S rRNA nucleotide identity of the 30 isolates were 100%. One typical isolate named ZC5 was selected for subsequent analysis, and the resulting 16S rRNA sequence was deposited at GenBank, NCBI under accession OK092624. The 16S rRNA sequence identity with those of P. psychrotolerans strain K3-2 (KY882083) and M3-1 (KY882120) were 100%, respectively. The phenotypic analysis by Biolog Gen Ⅲ indicated that the bacterial isolate (ZC5) showed highest similarity (98.3%) with strain Pseudomonas oryzihabitans. P. oryzihabitans and P. psychrotolerans have a high degree of homology in the phylogenetic relationship based on the phylogenetic analysis of three concatenated sequences of gyrB, rpoB and rpoD genes (Mulet et al. 2010). The gyrB (ON462356), rpoB (ON462355), rpoD (ON462357) gene of isolate ZC5were also amplified and sequenced by using primers gyrB-For/gyrB-Rev, rpoB-For/rpoB-Rev and rpoD-For/rpoD-Rev (Hauser et al. 2004), respectively. While P. psychrotolerans and P. oryzihabitans form the same clade in phylogenies, strains of P. psychrotolerans do form a unique sub-clade. Isolate ZC5 clustered more closely with the type strain of P. psychrotolerans LMG 21977 in the phylogenetic tree. Therefore, based on the concatenated sequences of three genes (gyrB, rpoB and rpoD), the isolate ZC5 was confirmed as P. psychrotolerans. Based on morphological, Biolog characteristics and phylogenetic analysis, the isolate was identified as P. psychrotolerans. The tobacco plants at fast growing stage were selected for pathogenicity tests. Pathogenicity tests were conducted by injecting 10 μL bacterial suspension (108cfu/mL) of ZC5 into tobacco leaves with a syringe. Sterile water was inoculated into the tobacco leaves in the same way as the control. Six plants were selected for pathogenicity tests each time and five leaves of each tobacco plant were inoculated, and the tests were repeated three times. To simulate disease conditions in the natural environment, the inoculated plants were moved outdoors. The average temperature was 32°C during the day and 20°C at night. To maintain humidity, the tobacco leaves were sprayed with water every two days. Symptoms appeared on the pathogen inoculated leaves seven days after inoculation, whereas the control treatment remained symptomless. The pathogens were reisolated from diseased leaves and identified as P. psychrotolerans based on morphological, molecular and phylogenetic analysis, which fulfilled Koch's postulates. To our knowledge, this is the first report of tobacco bacterial leaf spot caused by P. psychrotolerans.

First Report of Enterobacter roggenkampii and E. cloacae complex sp. Caused Tomato Pith Necrosis in Guangdong Province, China.

Tomato (Solanum lycopersicum L.) is an important greenhouse and field-grown vegetable. During 2019 to 2021, a new bacterial pith necrosis broke out in tomato producing areas in China. The disease incidence rate in the field was approximately 10% to 30% in a few tomato planting areas of Guangdong province, and even 100% in Dianbai distinct, Maoming city. Diseased plants showed yellowing of the lower leaves, brown vascular tissues, and wilting along with brown necrotic spots and a large number of adventitious roots on the stem. Diseased plants were collected, and short fragments of the diseased stems were sterilized with 75% alcohol for 2 minutes, washed with sterile water twice, and stripped the cortex (Fang 1998). Dilutions of xylem specimen soaking solution were plated onto the TTC medium (peptone 10.0 g, acid hydrolyzed casein 1.0 g, glucose 5.0 g, agar 15.0 g, distilled water 1000 mL, 0.5% 2, 3, 5-triphenyltetrazolium chloride, pH7.0), and cultured at 28℃ for 24 h. Three pink single colonies (A2 from Guangzhou (113°21' E, 23°9' N), Guangdong, and K6, and K7 from Maoming (110°55' E, 21°25' N), Guangdong) were selected and purified. Strains A2, K6, and K7 were Gram-negative, motile, and showed white fluidal colonies with pink center on TTC medium, and white, round, and smooth-surface colonies on NA medium (peptone 10 g, beef extract 3 g, sodium chloride 5 g, agar 15 g, distilled water 1000 mL, pH7.0) at 28℃ for 24 h. Three strains could utilize citrate, sorbitol, lactose and arginine, and were negative for methylred reaction test, determination of phenylalanine amino acid deaminase, lysine decarboxylase, urease, soluble starch decomposition and gelatin liquefaction, whereas were positive for Voges-Proskauer test, which conformed to the characteristics of genus Enterobacter (Davin-Regli et al. 2019). To determine the species of the Enterobacter isolates, partial sequences 16S rDNA, gyrB, and rpoB of strain A2, K6, and K7 were amplified. The PCR products were purified, sequenced, and deposited to GenBank. The BLASTN analysis of 16S rDNA, rpoB and gyrB sequences showed strain A2 (MW785888, OL364948, OL364943) was 99.20%, 99.17% and 98.57% identity with E. roggenkampii DSM16690, respectively, strain K6 (MW785890, OL364950, OL364945) was 99.73%, 99.63%, 99.63% identity with E. cloacae complex sp. N13-01531, and strain K7 (MW785893, OL364951, OL364946) was 99.8%, 98.81%, 98.99% identity with the E. roggenkampii Ed-982 and Ek140. Nucleotide sequences of 3 strains were aligned using ClustalW program, and neighbor-joining method (NJ) was used in the construction of a phylogenetic tree using MEGA7 program. Phylogenetic trees based on gyrB sequence, rpoB sequence, and the concatenated sequence of 16S rDNA-rpoB-gyrB and rpoB-gyrB showed strain A2 and K7 were clustered to E. roggenkampii, strain K6 was clustered to E. cloacae complex sp. The roots of tomato material 'Moneymaker' at stage of 4-5 true leaves were cut and irrigated 10 mL bacterial suspension (OD600=0.6) of strains A2, K6, and K7, respectively. As a control, the tomato roots were treated with 10 mL sterile water. All plants were incubated at 30°C. The experiments were conducted with 20 tomato seedlings for each tested strain and control, and repeated twice. All plants inoculated showed yellowing in the lower leaves 6-7 days after inoculation (DAI), subsequently the stems of some plants were rotten, along with bacterial pus in the internodes. The plants wilted, and stems were hollow 20 DAI, which is similar to the field symptoms. No symptoms were observed in control plants. Strains were successfully reisolated from wilting plants, and identified as A2, K6, and K7, respectively, based on gyrB sequence analysis, fulfilling Koch's postulates. Zhou et al. (2021) reported that E. roggenkampii caused bacterial wilt of mulberry in Guangxi, China. Chen et al. (2021) reported E. asburiae caused tomatoes pith necrosis in Fujian and Zhejiang, China. To our knowledge, this is the first report of E. roggenkampii and E. cloacae complex sp. causing bacterial pith necrosis of tomato. Further research would focus on exploring the pathogenic mechanism of the pathogen, and providing reference of controlling the disease.

Pseudomonas nunensis sp. nov. isolated from a suppressive potato field in Greenland.

The bacterial strain In5T was previously isolated from a suppressive potato field in southern Greenland and has been characterized and described as Pseudomonas fluorescens. However, the results of new polyphasic analyses coupled with those of phenotypic, phylogenetic and genomic analyses reported here demonstrate that the affiliation to the species P. fluorescens was incorrect. The strain is Gram-stain-negative, rod-shaped, aerobic and displays growth at 4-28 °C (optimum temperature 20-25 °C) and at pH 5-9 (optimum pH 6-7). Major fatty acids were C16 : 0 (38.2 %), a summed feature consisting of C16 : 1ω6c and/or C16 : 1ω7c) (20.7 %), C17 : 0cyclo ω7c (14.3 %) and a summed feature consisting of C18 : 1ω6c and/or C18 : 1ω7c (11.7 %). The respiratory quinones were determined to be Q9 (95.5 %) and Q8 (4.5 %) and major polar lipids were phosphatidylethanolamine, phosphatidylglycerol and diphosphatidylglycerol. The DNA G+C content was determined to be 59.4 mol%. The results of phylogenetic analysis based on the 16S rRNA gene and multi-locus sequence analysis (MLSA; concatenated 16S rRNA, gyrB, rpoB and rpoD sequences) indicated that In5T was affiliated with the Pseudomonas mandelii subgroup within the genus Pseudomonas. Comparison of the genome sequence of In5T and those of related type strains of species of the genus Pseudomonas revealed an average nucleotide identity (ANI) of 87.7 % or less and digital DNA-DNA hybridization (dDDH) of less than 34.5 % relatedness, respectively. Two more strains, In614 and In655, isolated from the same suppressive soil were included in the genome analysis. The ANI and dDDH of In614 and In655 compared with In5T were ANI: 99.9 and 97.6 and dDDH (GGDC) 99.9 and 79.4, respectively, indicating that In5T, In614 and In655 are representatives of the same species. The results of the phenotypic, phylogenetic and genomic analyses support the hypothesis that strain In5T represents a novel species of the genus Pseudomonas, for which the name Pseudomonas nunensis sp. nov. is proposed. The type strain is In5T(=LMG 32653T=NCIMB 15428T).

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

Re-evaluation of critical concentrations of antituberculosis fluoroquinolones in the Mycobacteria Growth Indicator Tube 960 system.

Fluoroquinolones (FQs) have substantial activity against the Mycobacterium tuberculosis complex (MTBc) by preventing bacterial DNA synthesis through DNA gyrase inhibition. The reference standard for FQ-resistance testing is phenotypic drug-susceptibility testing (pDST) based on growth inhibition of MTBc in drug-containing Mycobacteria Growth Indicator Tube system (MGIT) media at a critical concentration (CC) that differentiates phenotypically wild-type from nonwild-type MTBc and at a clinical breakpoint that identifies strains that will likely still respond to treatment at higher doses. Despite the recent introduction of powerful new TB drugs, highly sensitive detection of clinically defined FQ resistance remains key. In this study, we re-evaluated the current WHO-recommended CCs of Lfx (1.0 mg/ml), Mfx (0.25 mg/ml), Gfx (0.25 μg/ml), and the nowadays, obsolete CC of Ofx (2.0 mg/ml) for MGIT, using 147 MTBc isolates with known gyrA and gyrB sequences including both high-and low-level FQ resistance-conferring mutants. We tested a wide range of drug concentrations covering the current and former/obsolete WHO-recommended CCs for FQs and some intermediate concentrations to challenge the current WHO-recommended CCs. The specificity of all four CCs was 100%. The sensitivities varied: 92.4% for Ofx and Lfx, 85.7% for Mfx, and 83.2% for Gfx. Lowering the CC of Mfx to 0.125 mg/ml would allow to correctly classify all wild-type and mutant isolates while lowering the CC of Gfx to 0.125 mg/ml would still misclassify some gyrA/gyrB mutants as susceptible. Based on our findings, a minimal inhibitory concentration of 0.125 mg/ml on MGIT medium is a more appropriate CC for Mfx and probably also as a surrogate for overall FQ resistance in the MTBc.

First report of rice bacterial leaf blight disease caused by Pantoea ananatis in the United States.

In August 2021, bacterial leaf blight-like symptoms were observed on 14 out of 570 rice genotypes (Oryza sativa) in research field plots of global rice germplasm grown in Arkansas (eXtra Figure S1. A & B). The disease was characterized by spreading lesions on leaves, panicle sterility and reduced yield in highly susceptible, mature rice germplasm. No spread of disease to nearby plants was observed. Isolations were performed at Colorado State University, where soakates from symptomatic leaves were spread onto nutrient agar. After 72 h at 28°C, uniform, distinct, yellow-colored bacterial colonies were observed. To screen for the presence of common rice bacterial pathogens, PCR amplification directly from colonies or from DNA isolated from symptomatic field-collected leaves was performed. Primers specific for Xanthomonas oryzae pvs. oryzae and oryzicola (Lang et al., 2010), Burkholderia glumae (Echeverri-Rico et al., 2021), and Pseudomonas fuscovaginae (Ash et al., 2014) did not amplify indicating these organisms were not present. Sequencing of 16S rRNA gene (Weisburg et al., 1991) amplicons suggested the bacteria belonged to the genera Pantoea and Sphingomonas (NCBI accession no. OP683332 and OP683333, respectively). Amplicons resulting from primers specific to the gyrB gene region of P. ananatis (Kini et al., 2021) were sequenced and the fragment was compared to the P. ananatis PA13 reference genome using a BLAST analysis. One candidate (AR358) showed 100% identity with the P. ananatis gyrB region. Primers specific for Sphingomonas sp. (Bangratz et al., 2020) confirmed the second candidate (AR359) as a Sphingomonas sp. The identity of P. ananatis was confirmed by the Plant Pathogen Confirmatory Diagnostics Laboratory (Beltsville, MD, USA). To determine pathogenicity, leaves from 7-day-old seedlings of rice (Oryza sativa) cultivar Kitaake were scissor-clip inoculated (Kauffman et al., 1973) with four different treatments and compared to control leaves inoculated with sterile water. Treatments for the experiment consisted of bacterial suspensions (108 CFU/ml) of the two candidate organisms, P. ananatis (strain AR358) or Sphingomonas sp. (strain AR359), individually or in a 1:1 ratio of P. ananatis:Sphingomonas sp., or soakate from infected field tissue. Lesions similar to those observed in the field were only detected on leaves inoculated with P. ananatis or infected field tissue soakate at 7-days post-inoculation (eXtra Figure S1. C). Bacteria were recovered from the leaves of the artificially inoculated seedlings from three treatments (P. ananatis, P. ananatis:Sphingomonas sp. and soakate from the infected field tissue) and were determined to be P. ananatis based on colony morphology, amplification of 16s rRNA, and gyrB sequence data. Our results confirm the pathogenicity of P. ananatis to rice and fulfill Koch's postulates. P. ananatis was also recovered from several similarly diseased rice breeding lines at the University of Arkansas System Division of Agriculture Rice Research and Extension Center. We conclude that P. ananatis is the causal pathogen for leaf blight-like symptoms observed in the global rice cultivars grown in Arkansas. P. ananatis was previously reported as a pathogen on rice in several rice growing regions, including China (Yu et al., 2021), India (Reshma et al., 2022), and Africa (Kini et al., 2017), however, this is the first report of P. ananatis as a pathogen of rice in the United States.

First report of a new bacterial stem rot disease of strawberry (Fragaria×ananassa) caused by Pantoea ananatis in Jiangsu, China.

Strawberry (Fragaria×ananassa Duch.) is an important economic fruit crop in the world. With the continuous expansion of strawberry planting area, strawberry disease is one of the most important limiting factors, which seriously affects the agronomic performance and leads to significant economic losses. In November 2020, an infected stem rot disease of strawberries was detected in the strawberry growing area of Donghai County, Jiangsu Province, China. The disease incidence ranged from 30 % to 45 %. Initially, infected plants included stunted growth of new leaves, leaflet asymmetry, and holes in the vertical section of the stem, resulting in leaf blight and death in severe cases. To isolate the pathogen, two symptomatic plants were randomly collected. And then infected plants were surface sterilized with 75 % ethanol for 1 min, followed by 2 % sodium hypochlorite for 6 minutes. After that, the infected plants were washed 4-5 times with double sterilized distilled water, cut into 3-5 mm small pieces, and soaked in 2 ml of sterile water for 15 min, after which 100 µl of liquid suspension were spread onto Luria-Bertani medium (LB) and incubated at 28 °C for 12-16 h. All isolates showed yellow, viscous, round, and smooth (Figure S1, C) and the isolates were designated as JX1 and JX2. To identify the pathogen, the genomic DNA were extracted from isolates using the Ezup Column Bacteria Genomic DNA Purification Kit (Sangon Biotech, China) and the fragments of gyrB, rpoB and leuS gene were amplified using the primer pairs UP-1S/UP-2Sr (Yamamoto and Harayama 1995), rpoB-F/rpoB-R and leuS-F/leuS-R (Yu et al. 2022), respectively. Sequence analyses showed that the nucleotide sequences of gyrB, rpoB, and leuS fragments of the isolates shared 99.72 %, 99.67 % and 98.37 % identity with the Pantoea ananatis type strain LMG 2665 (KF482590.1, EF988972.1 and KF482626.1, respectively ), which suggests that the isolate could be Pantoea ananatis. To further verify that P. ananatis was identity of these isolates, the whole genome was sequenced using PacBio sequel II technology. The Average Nucleotide Identity (ANI) calculation showed that the whole-genome sequence was 99.0% similar to that of the Pantoea ananatis type strain LMG 2665 (Jain et al. 2018). The isolates were therefore recognized as P. ananatis. To confirm pathogenicity, roots of strawberry plants were inoculated by wounding as described (Wang et al. 2017) with bacterial suspensions (108 CFU/ml) for 30 min, and transplanted into 10 cm ×8.5 cm pots filled with substrate (peat: perlite: vermiculite =3:1:1). The negative control plants were inoculated with sterile distilled water (20 individual plants per group). All infected plants were placed in a greenhouse under the following environmental conditions: 30 ℃/25 ℃ day/night, >70 % relative humidity, 16-h/8-h photoperiod. The experiment was carried out three times. After 3 to 4 weeks of inoculation, the new leaves of the plants were smaller and asymmetrical, while the negative plants remained healthy. After 8 weeks, a significant stem rot pocket developed on all inoculated plants, similar to the symptoms observed in the field. In contrast, no symptoms were observed in negative plants (Figure S2). To fulfill Koch's postulates bacteria were further isolated, purified and identified from the greenhouse inoculated plants. The results proved that the causative agent of strawberry stem rot was P. ananatis. In recent decades, P. ananatis has been found to cause bacterial leaf blight in strawberries (Bajpai et al. 2020). It has also caused other crop diseases, such as maize white spot, peach soft rot and others (Cui et al.2022; Liao et al. 2015). Although other crop diseases caused by P. ananatis, a bacterial pathogen, there has been no report of P. ananatis causing the symptoms of stem rot disease in strawberry. To our knowledge, this is the first report of P. ananatis causing stem rot in strawberry. This study provides solid evidence that strawberry stem rot disease in China can also be caused by the novel pathogen Pantoea ananatis. In conclusion, this report will provide a theoretical reference for the prevention and control measures of P. ananatis causing strawberry stem rot disease in the future.

First Report of Pantoea ananatis Causing Crown Necrobiosis on Strawberry in China.

Strawberry (Fragaria × ananassa) is an economically important crop in Zhejiang, China. In the autumn of 2021, crown necrobiosis and angular leaf spot was observed in commercial strawberry fields (cultivar 'fenyu') in Cixi, Ningbo, Zhejiang, China (N30°9'55″, E121°21'13″). The disease incidence ranged from 5 to 8 % in the field, but could reach 50 to 60 % in some heavily affected plastic tunnels. In the affected field, this disease could reduce strawberry production by 50%. Early symptoms were water-soaked lesions around the vein of the abaxial leaves; subsequently, reddish-brown irregular spots and coalesced lesions developed. In humid conditions, a sticky bacterial ooze exuding from lesions was observed. Finally, the crown of the diseased plant was necrotized, and several pockets were observed inside the crown after dissection. To isolate the causal agent, the infected leaves and crown tissues from six different plants were surface-sterilized with 75% ethanol for 1 min, rinsed twice with sterile distilled water, cut into small pieces, and soaked in 5 ml of sterile distilled water for 20 min. The supernatant from the cut-up pieces was serially diluted and spread on nutrient agar medium. After 2 to 3 days at 28℃, several yellow colonies were grown on the medium. The colonies from five infected plants were gram-negative, anaerobic rods, yellow, viscous, and gloss, which are typical characteristics of Erwinia anana (Wells et al. 1986). To confirm the identity of the causal bacteria, PCR was conducted for six randomly selected colonies to amplify 16S rRNA (Monciardini et al. 2002), fusA, and gyrB (Stice et al. 2002). The amplicons were sequenced and blasted, and the results showed that the six colonies were identical. The 16S rRNA, fusA, gyrB sequences of the isolate CM3 were deposited in GenBank with accession number ON754076.1, OP587277, and OP587278; BLAST search showed 99.93% (1445 bp out of 1446 bp), 100% (746 bp out of 746 bp), 99.64% (1371 bp out of 1376 bp) similarity with strains of Pantoea ananatis (KT741001.1, MH015093.1 and CP066803.1 accessions, respectively). The resulting concatenated data set of 16S rRNA-fusA-gyrB was used to build a multilocus phylogenetic analysis (MLSA) by maximum likelihood criteria. The MLSA tree indicated that the isolate CM3 belonged to Pantoea ananatis. The isolate's identity was further confirmed by P. ananatis-specific primers pagyrB-F/R (Xiao et al. 2022). Thus, this isolate was designated as P. ananatis CM3. To fulfill Koch's postulates, two old leaves were broken off each of the ten 2-month-old strawberry (cultivar 'fenyu') plants to create wounds, each plants was sprayed with a cell suspension ofP. ananatis (107CFU/ml, 0.5 ml) on the stem base. Ten plants were sprayed with water to serve as a control. All plants were kept at 28/25°C (day/night) under a 12-h/12-h photoperiod. All plants were covered with transparent plastic bags to maintain humidity. After 48 h, the bags were removed. After 2 weeks, water-soaked lesions on some leaves were observed similar to those in the field . Three to five weeks after inoculation, the crown of the inoculated plants was necrotized, which was similar to the symptoms in the field. No symptoms were observed in the control plants. The experiment was repeated three times. The bacteria were successfully reisolated from the inoculated crown tissues and leaves and confirmed as CM3 according to the same methodologies used for the initial identification. Bacterial leaf blight in strawberry caused byPantoea ananatishas been reportedin Nova Scotia, Canada, and Egypt (Bajpai et al. 2019; Abdel-Gaied et al. 2022). To our knowledge, this is the first report of Pantoea ananatis causing crown necrobiosis on strawberry in China. This report provides a basis for further research on this disease and its management and control.

Polyphasic study of phytopathogenic bacterial strains associated with deep bark canker of walnut in Serbia revealed a new species, Brenneria izbisi sp. nov.

Serious outbreaks of walnut deep bark canker were observed on young walnut trees (Juglans regia L.) in two localities in the northern part of Serbia during 2020. From the symptomatic walnut tissues, two types of bacterial colonies were isolated, predominantly, light cream, circular and smooth colonies, as well as small, yellowish, mucoid and convex ones. PCR analysis and phenotypic assays suggested that the former group belongs to Brenneria spp., while the latter isolates were identified as Xanthomonas arboricola pv. juglandis. Within the Brenneria group, two strains were identified as Brenneria nigrifluens, while other 15 strains did not belong to any Brenneria species described so far. Therefore, we selected four representative strains of the unknown Brenneria sp. and subjected them to polyphasic analysis. As expected, in a phylogenetic tree based on partial 16S rDNA sequences, four novel strains grouped with other Brenneria representatives, and showed close phylogenetic relationship to Brenneria salicis. Furthermore, multilocus sequence analysis (MLSA) based on the partial sequences of atpD, gyrB, infB and rpoB housekeeping genes and core-genome phylogeny indicated that the studied strains form a novel and a clearly separate Brenneria lineage. Overall genome relatedness indices showed that they represent a new Brenneria species. The new species can be differentiated from the other Brenneria spp. infecting walnut and closely related B. salicis strains based on phenotypic characteristics, as well. Moreover, the pathogenicity tests on two-year-old walnut plants proved the ability of strains to cause necrosis and longitudinal black lesions and cracks on the trunk and branches of walnut trees. Overall, polyphasic characterization showed that the studied strains isolated from walnut with symptoms of deep bark canker represent a novel species of the genus Brenneria for which the name Brenneria izbisi sp. nov. is proposed. The type strain of B. izbisi is KBI 423T (= CFBP 9035T = LMG 32479T). To facilitate rapid identification of newly described species, a conventional PCR protocol and primers targeting the putative gene hrpP, were developed. Further study should reveal the potential role of each pathogen isolated from symptomatic walnut in disease development as well as possible interaction between them.

First Report of Bacterial Wilt Caused by Enterobacter mori of Strawberry in Beijing, China.

Strawberry (Fragaria × ananassa) is an economically important crop in China, and a crucial part of urban agriculture in Beijing. In November 2020, wilt symptoms were observed in strawberry seedlings in several greenhouses in the Pinggu District of Beijing city (40.14° N; 117.12° E). The average disease incidence was 20%. Water-soaked lesions appeared along the veins of diseased strawberry leaves and bacterial ooze was also present on severely affected leaves. Bisected crowns had a reddish-brown discoloration in the xylem which later turned black. Three diseased strawberry seedlings were collected for pathogen identification. Isolations were conducted from stem, crown, leaf, and roots of diseased strawberry plants. Samples were surface sterilized by immersion in 70% ethanol for 30 s and rinsed three times with sterile distilled water, before being placed on potato dextrose agar (PDA) medium and incubated at 28℃. Several bacterial colonies grew on the medium after 24 h. Colonies were then purified on Lysogeny broth (LB) agar plates using the streak plate method. Twenty-nine isolates were obtained from 36 diseased tissue samples, which were from stem(10), crown(12), leaf(2) and roots(5) separately. All isolates appeared white, round, opaque and smooth on LB plates. To identify the isolates, genomic DNA was extracted from nine purified bacterial colonies (CM1 to CM9). The fragments of atpD, gyrB, infB and rpoB gene were amplified and sequenced with primers atpD 01-F/ atpD 02-R, gyrB 01-F/ gyrB 02-R, and infB 01-F/ infB 02-R (Brady et al. 2008) and RpoB-F/ RpoB-R (Mollet et al. 1997), respectively. All atpD, gyrB, infB and rpoB sequences belonging to the isolates were identical. The sequences of atpD, gyrB, infB and rpoB gene of isolates CM1 and CM3 were deposited in GenBank under accession numbers ON055247, ON055248, ON055249, ON055250, ON055251, ON055252, OL771192 and OL771193. BLAST searches were conducted with the sequences of atpD, gyrB, infB and rpoB. The atpD, gyrB, infB and rpoB sequences of the obtained isolate showed 99.53%, 99.06%, 99.19% and 99.80% identity with the corresponding sequences of Enterobacter mori strains, respectively. Phylogenetic analysis was performed using the maximum likelihood (ML) method with the CIPRES Science Gateway platform (http://www.phylo.org/) based on the combined atpD, gyrB, infB and rpoB sequences (Brady et al. 2013; Palmer et al. 2018). In the phylogenetic tree, the isolates were clustered together with E. mori strain LMG 25706. To confirm the pathogenicity, 200 μL of bacterial suspensions (108 CFU/mL) of the two isolates were injected into the crown of six healthy Fragaria × ananassa cv. Bennihope strawberry seedlings respectively with 1 mL sterilized syringe, and the control seedlings were injected with sterile water. The seedlings were kept in a moist chamber (28°C, 16-h light and 8-h dark period) for 2 days. Then all the seedlings were transferred to the greenhouse with conditions similar to those where the diseased plants were collected. Forty days after inoculation, old leaves started to wilt and leaf midvein necrosis, along with xylem discoloration, was observed in inoculated plants. No symptoms were observed in the control group. Pathogenicity tests were conducted three times with similar results. The bacteria were re-isolated from the symptomatic diseased strawberry plants and confirmed as E. mori by morphological and sequence analyses as above, fulfilling Koch's postulates. To the best of our knowledge, this is the first report of strawberry bacterial wilt caused by E. mori. Due to the significant crop loss from this disease, more research is needed in epidemiology and disease management.

Confirmation of Burkholderia gladioli as the Causal Agent of Bacterial Scab on Gladiolus (Gladiolus spp.) in Ohio.

Ohio is one of the top five floriculture producers in the United States, grossing over $200 million annually (NASS 2019). Within the international floriculture trade, gladiolus cut flowers represent the fifth highest grossing crop (Ahmed et al. 2002). In September 2021, the Ornamental Crops Pathology Lab at the Ohio State University received a gladiolus (Gladiolus spp.) sample of an unknown cultivar from a home garden in Franklin Co., OH where several plants had failed to grow from planted corms or were stunted and displaying symptoms of disease. Bleached, water-soaked spots with necrotic margins along the flowering stems, stunted flowers with partial necrosis, and necrotic bracts were observed on the submitted sample. Bacterial isolations were performed by surface disinfesting small sections of bract tissue from the border of a lesion by soaking in 10% bleach for 30 sec and rinsing twice in sterile water, macerating the tissue in sterile water, and streaking the suspension on nutrient agar (NA) plates. Plates were incubated at 28°C for 48 hours and the resulting colonies were purified by re-streaking a single colony on NA twice. Bacterial colony morphology on NA presented as cream-colored and shiny with an irregular form and undulate margin. Five in vitro tests were performed using one representative isolate to identify the bacterium to the genus level: (1) confirmed levan production, (2) confirmed pectinolytic activity, (3) confirmed ability to grow at 40°C, (4) inability to grow under anaerobic conditions, and (5) a negative oxidase test (Schaad et al. 2000). All test results identified the genus as Burkholderia. To identify to species level, gyrase subunit B (gyrB) and RNA polymerase subunit D (rpoD) markers were PCR amplified and sequenced using primers UP1-E/AprU, and 70F2/70R2, respectively (Maeda et al. 2006). NCBI GenBank BLASTn comparison showed that the gyrB sequence shared 99.33% identity to the type strain of B. gladioli (CP009323.1), while the rpoD sequence showed 99.53% identity (CP009322.1). Sequences were deposited in GenBank under accession numbers ON597852 (gyrB) and ON597853 (rpoD). To confirm pathogenicity, each of two Gladiolus communis 'Mini Elvira' potted plants were inoculated with two bacterial and two control treatments (3 leaves/treatment/plant) as follows: leaf infiltration with 1 mL of either (i) a distilled water-Tween 20 (0.03% v/v) bacterial suspension (106 cfu/mL) or (ii) a sterile water-Tween 20 suspension using a needle-less syringe; foliar spray with either (iii) the bacterial suspension or (iv) water-Tween suspension until run-off. Following inoculation, plants were covered for 24 hours with a plastic bag to increase humidity and favor infection and maintained in a greenhouse at an average temperature of 23°C. After 3 days, water-soaked, necrotic lesions were observed on the inoculated plants regardless of inoculation method, while control leaves remained asymptomatic. To fulfill Koch's postulates, bacteria were re-isolated from the lesions 7 days post-inoculation and confirmed to be identical to the original isolate based on rpoD gene sequencing. Bacterial scab of gladiolus was reported in Ohio in the late 1900s as caused by Pseudomonas gladioli (syn. P. marginata; Ellett, 1989). To the best of our knowledge, this report represents the first molecular identification of the causal agent as Burkholderia gladioli. In Ohio, the pathogen has also been observed causing slippery skin on onion but not officially reported in the peer-reviewed literature. Additionally, B. gladioli has been reported in other parts of the United States on orchid, corn, and rice (Keith et al. 2005; Lu et al. 2007; Nandakumar et al. 2009). Given the significant role of gladiolus within Ohio's floricultural trade, as well as the ability of this pathogen to infect other regional crops, monitoring of bacterial scab is important for floriculture and field crop growers alike.

GyrB in silico mining in 27 151 global gonococcal genomes from 1928-2021 combined with zoliflodacin in vitro testing of 71 international gonococcal isolates with different GyrB, ParC and ParE substitutions confirms high susceptibility.

Antimicrobial resistance (AMR) in Neisseria gonorrhoeae is a global threat and novel treatment alternatives are imperative. Herein, susceptibility to the novel antimicrobial zoliflodacin, currently in a global Phase 3 randomized controlled clinical trial for gonorrhoea treatment, was investigated by screening for zoliflodacin GyrB target mutations in publicly available gonococcal genomes and, where feasible, determination of the associated zoliflodacin MIC. The European Nucleotide Archive was queried using the search term 'Taxon: 485'. DNA sequences from 27 151 gonococcal isolates were analysed and gyrB, gyrA, parC and parE alleles characterized. GyrB amino acid alterations were rare (97.0% of isolates had a wild-type GyrB sequence). GyrB V470L (2.7% of isolates) was the most prevalent alteration, followed by S467N (0.12%), N. meningitidis GyrB (0.092%), V470I (0.059%), Q468R/P (0.015%), A466T (0.0074%), L425I + L465I (0.0037%), L465I (0.0037%), G482S (0.0037%) and D429V (0.0037%). Only one isolate (0.0037%) carried a substitution in a resistance-associated GyrB codon (D429V), resulting in a zoliflodacin MIC of 8 mg/L. None of the other detected gyrB, gyrA, parC or parE mutations caused a zoliflodacin MIC outside the wild-type MIC distribution. The zoliflodacin target GyrB was highly conserved among 27 151 global gonococcal isolates cultured in 1928-2021. The single zoliflodacin-resistant clinical isolate (0.0037%) was cultured from a male patient in Japan in 2000. Evidently, this strain has not clonally expanded nor has the gyrB zoliflodacin-resistance mutation disseminated through horizontal gene transfer to other strains. Phenotypic and genomic surveillance, including gyrB mutations, of zoliflodacin susceptibility are imperative.

Hotspots sequences of gyrA, gyrB, parC, and parE genes encoded for fluoroquinolones resistance from local Salmonella Typhi strains in Jakarta

BackgroundInfection of Salmonella enterica subsp. enterica serovar Typhi is the primary etiology of typhoid fever globally and is common in many developing countries, especially those with dense populations and poor environmental sanitation. Antibiotic fluoroquinolones were used for the treatment in the 1980s due to the resistance to the first-line antibiotics. However, many cases of treatment failure of fluoroquinolones in typhoidal patients have been reported from numerous countries in Asia, Europe, Africa, and America. Mutations in quinolone resistance determining regions (QRDR) genes, gyrA, gyrB, parC, and parE, are found in fluoroquinolone-resistant Salmonella Typhi. Contrast reports came from the S. Typhi isolates in Indonesia, mainly Jakarta and the surroundings, obtained from patients with typhoid fever, with good sensitivity to the fluoroquinolones, i.e., nalidixic acid, ciprofloxacin, moxifloxacin, and levofloxacin. The present study, therefore, aimed to identify the hotspot sequences of gyrA, gyrB, parC, and parE genes of the local S. Typhi strains based on their susceptibility to fluoroquinolones from patients with typhoid fever in Jakarta and its satellite cities.ResultsA total of 28 isolates were identified as S. Typhi. All isolates were susceptible to nalidixic acid, levofloxacin, and moxifloxacin. Twenty-seven isolates (96.4%) were susceptible to ciprofloxacin, with one isolate (3.6%) being intermediate. The hotspot sequences of gyrA, gyrB, parC, and parE genes from all isolates were identical to the fluoroquinolone-sensitive reference sequence Salmonella enterica subsp. enterica serovar Typhi Ty2 (NCBI GenBank AE014613.1), including the isolate with intermediate susceptibility. The mutation was not found, and amino acid deduced from all hotspots in susceptible and intermediate isolates showed no replacement in all reported codons.ConclusionsThis study showed that the local S. Typhi strains from Jakarta and surroundings were susceptible to fluoroquinolones (nalidixic acid, ciprofloxacin, levofloxacin, and moxifloxacin), and the hotspot sequences of the gyrA, gyrB, parC, and parE genes were all identical to the reference sequence. Thus, the hotspot sequences of the gyrA, gyrB, parC, and parE genes seemingly were conserved in Jakarta’s local S. Typhi strains and could be considered wild type. The phenotypic susceptibility was consistent with the genotypic characteristic without non-synonymous mutations associated with drug resistance.

Brenneria tiliae sp. nov., isolated from symptomatic Tilia × moltkei and Tilia × europaea trees in the UK.

Several strains of a previously undescribed bacterial species were isolated from mature Tilia hybrid trees suffering from bleeding cankers at various geographic locations in the UK. The strains were Gram-negative, facultatively anaerobic, and partial sequencing of the gyrB gene revealed that the strains belong to the genus Brenneria with the closest phylogenetic neighbours being Brenneria corticis and Brenneria nigrifluens. Further investigation using a polyphasic approach was undertaken to determine the taxonomic position of the novel species. Phylogenies based on the 16S rRNA gene and multilocus sequence analysis of partial housekeeping gene sequences of gyrB, rpoB, infB and atpD revealed that the strains formed an independent cluster within the genus Brenneria. The phenotypic and chemotaxonomic assays demonstrated that the strains could be differentiated from the closest relatives. Genome analysis of representative strains revealed in silico DNA-DNA hybridization values below the threshold for species delimitation, although the average nucleotide identity values obtained when compared to B. corticis (95.9-96%) were slightly higher than the suggested cut-off value of 95%. However, as all other data suggests that the strains belong to a novel taxon that can be differentiated from the closest relatives, we propose that the strains represent a novel species in the genus Brenneria, Brenneria tiliae sp. nov. (type strain WC1b.1T=LMG 32575T=NCPPB 4697T).

Co-infections of Aeromonas veronii and Nocardia seriolae in largemouth bass (Micropterus salmoides)

Largemouth bass (Micropterus salmoides) is an important commercial fish species that is widely cultured throughout China. With the application of high-density culture, M. salmoides is usually infected by different pathogens in water. Particularly, co-infection with multiple pathogens was common, which has considerably outweighed the impact caused by single infections. In this research, two bacteria strains were isolated from diseased fish by incubating on brain heart infusion agar. According to the results of 16S rRNA and gyrB sequence, as well as the analysis of morphological, physiological and biochemical features, the isolated bacterial strains were finally identified as Aeromonas veronii and Nocardia seriolae, respectively. In addition, eight virulence genes related to pathogenicity including enterotoxin, lipase, elastase, quorum sensing, hemolysin and adhesion were identified in A. veronii isolate and eight virulence genes encoding mammalian cell entry family proteins, glyceraldehyde-3-phosphate dehydrogenase, mycolyltransferase, nitrate reductase subunits, and putative cytotoxin/hemolysin were detected in N. seriolae isolate. Drug sensitivity testing indicated that both A. veronii and N. seriolae isolates were susceptible to kanamycin, streptomycin, gentamycin, neomycin, doxycycline, tetracycline, ciprofloxacin and levofloxacin, and resistant to amikacin, cefpimizole, ampicillin, piperacillin, carbenicillin, oxacillin, rifampicin, trimethoprim, vancomycin, meropenem, imipenem and sulfisoxazole. Moreover, serious histopathological changes, such as typical granulomas with necrotic center, cell degeneration and necrosis, hemorrhage and inflammatory cell infiltration, were found in the naturally diseased fish. The LD50 of A. veronii and N. seriolae isolates were 7.94 × 105 CFU/g and 3.16 × 106 CFU/g fish weight, respectively. In addition, the coinfection of A. veronii and N. seriolae induce quick and higher mortality in comparison with those challenged by single bacteria. These results revealed that both A. veronii and N. seriolae participated in the disease outbreaks of the M. salmoides, and concurrent of those two bacteria synergistically exacerbate the disease severity.

Isolation and identification of a new biocontrol bacteria against Salvia miltiorrhiza root rot and optimization of culture conditions for antifungal substance production using response surface methodology

BackgroundS. miltiorrhiza root rot is a soil-borne disease mainly caused by Fusarium solani and Fusarium oxysporum, which has spread rapidly in China in recent years. To reduce the amount of pesticides to control this plant fungal disease, biological control using endophytic bacteria is a promising method. Many endophytic bacteria show good biocontrol potential against various plant fungal diseases. The aims of this study were to isolate and identify endophytic bacteria with antifungal activity from Salvia miltiorrhiza plant tissue. In order to increase antifungal substances production, the culture conditions of the isolated DS-R5 strain were optimized through response surface methodology.ResultsThirteen endophytic bacteria with antifungal activity against the target pathogenic fungus were successfully screened. The DS-R5 strain that had the strongest antifungal activity was identified based on morphological, physiological and biochemical characteristics, 16S rRNA and gyrB sequence analysis.The results of response surface methodology experiments showed that the optimal values of the three significant factors were as follows: medium volume, 51.0 ml; initial pH, 6.7; fermentation temperature, 33.1 °C. Under these optimal culture conditions, the titer of antifungal substances produced by the DS-R5 strain was 77.6% higher than that under the initial culture conditions.ConclusionsThe antifungal activity of endophytic bacteria from Salvia miltiorrhiza has been demonstrated for the first time, which may benefit future crop quality and production. In addition, response surface methodology can be well applied the optimization of culture conditions for antifungal substance, which lays the foundation for further research on strain DS-R5.

Identification and whole-genome sequencing analysis of Vibrio vulnificus strains causing pearl gentian grouper disease in China

Vibrio vulnificus is a pathogenic bacterium that causes disease in marine fish, affecting fish farming and human health worldwide. In May 2021, in the Bohai Bay region, a disease broke out in commercially farmed pearl gentian grouper (♀Epinephelus fuscoguttatus × ♂Epinephelus lanceolatus), causing huge economic losses. The diseased fish had skin lesions, water accumulation in their abdomens, and showed tissue and organ damage. V. vulnificus biotype 2 has been reported in eels and other marine fish, but it is less reported in pearl gentian grouper. In this study, the pathogenic strain isolated from diseased fish was identified as V. vulnificus EPL 0201 biotype 2 on the basis of physiological and biochemical characteristics and the results of 16S rRNA gene and gyrB sequencing, virulence gene detection, and recursive infection experiments. To gain a comprehensive understanding of the pathogenicity and drug resistance of this strain, whole-genome sequencing was performed. Whole-genome analysis showed that the gene map of this strain was complete. The Virulence Factor Database annotation results showed that this strain had the key virulence factor genes vvhA and rtxA, which cause host disease. In addition, this strain had genes conferring resistance against cephalosporins, aminoglycosides, tetracyclines, and sulfonamides. Antimicrobial susceptibility testing confirmed the presence of these resistance genes identified in the genome. The results of this study show that V. vulnificus EPL 0201 biotype 2 is a multi-drug resistant strain with high pathogenicity.