Sequence Analysis Of Region Research Articles

Sequence analysis of the non-coding control region of John Cunningham virus isolates from patients with multiple sclerosis treated with natalizumab

Introduction. The John Cunningham virus (JCPyV) causes a fatal demyelinating disease of the central nervous system known as progressive multifocal leukoencephalopathy (PML). In healthy people, the JCPyV non-coding control region (NCCR) is not rearranged, while NCCRs in immunocompromised patients are characterized by frequent rearrangements and can be associated with PML development. Therefore, patients treated with natalizumab, which decreases the migration of leukocytes and monocytes through the blood-brain barrier to inflammatory foci, are at increased risk of developing PML.
 The purpose of the study was to analyze NCCR sequences of JCPyV isolates from patients with multiple sclerosis (MS) treated with natalizumab.
 Materials and methods. A total of 26 blood plasma samples and 8 cerebrospinal fluid samples were analyzed using nested PCR to study the JCPyV NCCR structure in Russian MS patients treated with natalizumab. The NCCRs present in the samples were cloned and sequenced by Sanger sequencing. All the JCPyV NCCR sequences were compared with the archetype sequence and mapped. The NCCR sequences were also examined for presence of putative transcription factor binding sites.
 Results. A total of 48 NCCR sequences were found. The analysis showed that up to 55% of NCCRs were identified as rearranged NCCRs, while the other were archetype-like NCCRs. All the sequences can be divided into 6 types with one dominant rearrangement pattern. This rearranged NCCR was also found in a patient with the confirmed PML diagnosis and a poor prognosis. All the rearranged NCCRs were characterized by the presence of additional transcription factor binding sites.
 Conclusion. The study has helped identify previously unknown NCCR patterns typical of MS patients treated with natalizumab in Russia, thus confirming the need for the further research on NCCR rearrangements in MS patients undergoing natalizumab treatment to gain better understanding of the origin of neurovirulent JCPyV variants.

Genetic identification of the original plant species for Mentha Herb listed in the Japanese Pharmacopoeia and analyses of their essential oil composition

Mentha arvensis Linné var. piperascens Malinvaud is an original plant species for "Mentha Herb (Hakka, ハッカ)" and "Mentha Oil (Hakka-yu, ハッカ)" listed in the Japanese Pharmacopoeia, whereas Mentha canadensis L. is that of "Mint oil, partly dementholised" listed in the European Pharmacopoeia. Although these two species are thought to be taxonomically identical, there are no data on whether the source plants of the Mentha Herb products distributed in the Japanese market are actually M. canadensis L. This is an important issue for international harmonization of the Japanese Pharmacopoeia and European Pharmacopoeia. In this study, 43 Mentha Herb products collected from the Japanese market and two plant samples of the original species of Japanese Mentha Herb harvested in China were identified by sequence analyses of the rpl16 regions in the chloroplast DNA, and the composition of their ether extracts was analyzed by GC-MS. Almost all samples were identified as M. canadensis L., and the main component of their ether extracts was menthol, although there were variations in their composition. However, there were some samples thought to be derived from other Mentha species, even though their main component was menthol. For quality control of Mentha Herb, it is important to be sure of not only the original plant species but also the composition of the essential oil and amount of menthol as the characteristic compound.

Phylogenetic analysis of Prunus genus using nuclear and chloroplast gene markers as a bioorganic structure profiling

Prunus species are known as model species for the family Rosaceae and other woody plants with their small genome size and relatively small life cycle as woody plants. Also Prunus species are economically important plants in the subfamily Amygdaloideae of the Rosaceae have a controversial taxonomic history due to the lack of a phylogenetic framework. Therefore, mapping, classification, determination the genetic structure and characterization of genes as a spesific chemical and fuctional units of nucleic acids and making phylogenetic analysis in these species have important implications. The aim of this study to find any gene markers as a bioorganic – chemical structure profiling to determine genetic diversity of different Prunus species from Iraq by using nuclear and chloroplast DNA markers to evaluate the phylogeny of Prunus. A total of 12 species Prunus subgenus amygdalus were collected from Iraq. Ten gene region markers on both nuclear DNA and chloroplast DNA have been tested to evaluate the genetic variation at their molecular levels by using multiplex PCR with 10 gene region primers and sequence analysis for matK. The name of the gene regions using in this study are ITS (ITS1+ITS2+5.8S coding region), rbcL, matK, rpl16, trnL-trnF, atpB-rbcL, rp136-infA-rps8, trnK-rps16, pbsM-trnD, psbA-trnH. As a result, five different phylogenetic trees were obtained from the gene sequences of the samples and the base sequences were close to each other. The estimated value of the shape parameter for the discrete Gamma Distribution is 0.05. The nucleotide frequencies are A = 29.41%, T/U = 37.37%, C = 17.52%, and G = 15.67%. The nucleotide diversity of the sequence was low with the 0.004113 value. There were 14 different informative base site between the samples. The polymorphism observed was less in agreement with higher level of conservation of the gene regions. The Prunus species from Iraq region were grouped on two closed clusters on the phylogenetic trees.

A Rare B-Myeloid Conversion of Follicular Lymphoma into Clonally Related Acute Myeloid Leukemia: A Case Report

Follicular lymphoma (FL) is a highly prevalent indolent lymphoma, and the risk of histological transformation is approximately 2-3% per year. Transformation of FL generally occurs in the same lineage (B cell lineage). Another rare form of disease progression is the transformation of neoplastic B-cells to another cell lineage such as acute myeloid leukemia (AML). The low incidence of B-myeloid transformation associated with poor prognosis hinders the establishment of model systems to identify molecular mechanisms. A 64-year-old woman was diagnosed with FL and achieved a satisfactory response after six cycles of R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone). Approximately one month after treatment terminated, the disease progressed to AML with an increased white blood cell count and abnormal coagulation. Interestingly, nucleotide sequence analysis of the genomic region encoding the immunoglobulin heavy-chain variable domain showed the possibility of homologous transformation from lymphoma to leukemia cells. Although the patient experienced transient improvement after undergoing treatment with one cycle of idarubicin and cytarabine combined with etoposide, she relapsed and died 8 days after venetoclax salvage therapy. Patient with B-myeloid transformation was associated with an aggressive clinical course and poor prognosis. Conventional strategies for treating histologically transformed AML were ineffective. However, treatment with a Bcl-2 inhibitor could serve as an option. Here we review the literature relevant to this rare histological transformation of FL.

DNA Barcoding and Sequence Analysis of the cpDNA rbcL Region in Some Pyrus communis L. (Rosaceae) Genotypes from Ardahan/Türkiye

DNA Barcoding and Sequence Analysis of the cpDNA rbcL Region in Some Pyrus communis L. (Rosaceae) Genotypes from Ardahan/Türkiye

Health care-associated measles outbreak in pediatric wards in a tertiary care hospital: Challenges and Swiss cheese model enforcement for patient safety

IntroductionMeasles is one of the most contagious of all infectious diseases, for example, up to 9 out of 10 susceptible people with close contact to a measles patient will develop measles. In countries where measles is rare, transmissions in health care facilities have been a key factor in amplifying outbreaks ObjectivesDescribe the hospital transmission of measles among unvaccinated children in pediatric service, challenges faced and recommendations for health care settings by applying the Swiss cheese model. MethodBetween December 2019 and January 2020; multiple exposures to measles cases occurred. The incident and factors that led to the outbreak are described. The matrix and fusion genes, non-coding region sequence analysis was also conducted on the 3 strains isolated from the cases. ResultsThe outbreak extended from December 2019 to January 2020, which resulted in 110 exposed individuals (85 health care workers and 25 patients). Eleven (44%) children exposed were vaccinated, 14 (56%) were not yet vaccinated, and the measles status of 10 (11.8%) HCWs was not known at the time of the outbreak. Two infants acquired measles in the hospital, and both required ICU care. Three infants and one HCW received immunoglobulin. The phylogenetic tree of the matrix and fusion genes, non-coding region sequencing confirmed that all three cases had 100% identical measles strain. ConclusionsIn countries where measles elimination goals are achieved, a multifaceted approach to prevent measles transmission in health care is vital to maintain patient safety.

Serological and Molecular Survey on Domestic Dog Hepadnavirus in Household Dogs, Italy

The discovery of hepadnaviruses in cats (domestic cat hepadnavirus, DCH) and of a DCH-like virus in dogs has raised several questions regarding the role of these viruses in pets, with particular emphasis on their potential impact on animal health and epidemiology, as well as possible zoonotic implications. In this study, by screening an age-stratified collection of 600 canine serum samples for DCH with an ELISA assay based on the recombinant core antigen (DCHCAg), specific antibodies were found with an overall prevalence of 10.0% (60/600), with a higher prevalence in younger and older dogs. By retesting the canine DCHCAbs-positive sera with an ELISA test based on the recombinant surface protein of DCH (DCHSAg), a total of 18 sera (30%, 18/60) also contained IgG anti-DCHSAg. All the sera were also assessed molecularly using either a consensus hepadnavirus PCR or a specific real-time PCR for DCH. Hepadnavirus DNA was detected in four seronegative dogs, with a prevalence rate of 0.7% (4/600). On sequence analysis of the polymerase region amplified with pan-hepadnavirus primers, the amplicons displayed the highest nucleotide identity (97.3-99.6%) to DCH sequences detected in cats and to the domestic dog hepadnavirus recently identified in a canine serum sample from Italy.

Comparison of Autof Ms1000 and EXS3000 MALDI-TOF MS Platforms for Routine Identification of Microorganisms.

Matrix-assisted laser desorption-ionization-time of flight mass spectrometry (MALDI-TOF) has recently been widely used in clinical microbiology laboratories, with the advantages of being reliable, rapid, and cost-effective. Here, we reported the performance of two MALDI-TOF MS instruments, EXS3000 (Zybio, China) and Autof ms1000 (Autobio, China), which are commonly used in clinical microbiology field. A total of 209 common clinical common isolates, including 70 gram-negative bacteria strains, 58 gram-positive bacteria strains, 33 yeast strains, 15 anaerobic bacteria strains, and 33 mold strains, and 19 mycobacterial strains were tested. All strains were identified by EXS3000 (Zybio, China) and Autof ms1000 (Autobio, China). Sequence analysis of 16S rRNA or ITS regions was used to verify all strains. Current study found that species-level discrimination was found to be 191 (91.39%) and 190 (90.91%) by EXS3000 and Autof ms1000, respectively. Genus-level discrimination was 205 (98.09%) by the EXS3000 and 205 (98.09%) by the Autof ms1000, respectively. The correct results at species level of the EXS3000 were 91.43% (64/70) for gram-negative bacteria, 93.1% (54/58) for gram-positive cocci, 93.94% (31/33) for yeast, 100% (15/15) for anaerobes and 81.82% (27/33) for filamentous fungi. The correct results at species level of the Autof ms1000 were 92.86% (65/70) for gram-negative bacteria, 91.38% (53/58) for gram-positive cocci, 93.94% (31/33) for yeast, 100% (15/15) for anaerobes and 78.79% (26/33) for filamentous fungi. Although the results show that the EXS3000 and Autof ms1000 systems are equally good choices in terms of analytical efficiency for routine procedures, the test result of EXS3000 is slightly better than Autof ms1000. It's worth mentioning that the target plate of the EXS 3000 instrument is reusable, but the target plate of the Autof ms1000 is disposable, making the EXS3000 more effective in reducing costs.

Novel recombinant avian infectious bronchitis viruses from chickens in Korea, 2019-2021.

Infectious bronchitis virus (IBV) has evolved through various mutation mechanisms, including antigenic drift and recombination. Four genotypic lineages of IBVs including GI-15, GI-16, GI-19, and GVI-1 have been reported in Korea. In this study, we isolated two IBVs from chicken farms, designated IBV/Korea/289/2019 (K289/19) and IBV/Korea/163/2021 (K163/21), which are two distinct natural recombinant viruses most likely produced by genetic reassortment between the S1 gene of K40/09 strain (GI-19 lineage) and IBV/Korea/48/2020 (GI-15 lineage) in co-infected commercial chickens. Comparative sequence analysis of hypervariable regions (HVRs) revealed that the K289/19 virus had similar HVR I and II with the K40/09 virus (100% and 99.2% nucleotide sequence identity, respectively), and HVR III with the IBV/Korea/48/2020 virus (100% nucleotide sequence identity). In contrast, the K163/21 virus had HVR I and II similar to the IBV/Korea/48/2020 virus (99.1% and 99.3% nucleotide sequence identity, respectively), and HVR III to the K40/09 virus (96.6% nucleotide sequence identity). The K289/19 virus exhibited similar histopathologic lesions, tissue tropism in trachea and kidney, and antigenicity with the parental K40/09 virus. The K163/21 exhibited similar pathogenicity and tissue tropism with the K40/09 virus, which were similar results with the isolate K289/19. However, it showed a lower antigenic relatedness with both parental strains, exhibiting R-value of 25 and 42, respectively. The continued emergence of the novel reassortant IBVs suggests that multiple recombination events have occurred between different genotypes within Korea. These results suggest that antigenic profiles could be altered through natural recombination in the field, complicating the antigenic match of vaccine strains to field strains. Enhanced surveillance and research into the characteristics of newly emerging IBVs should be carried out to establish effective countermeasures.

Investigation of the Epidemiology of Small Ruminant Lentivirus Infections southeast part of the Marmara region of Turkey

Small ruminant lentiviruses (SRLVs) are viral pathogens that are common in goats and sheep, affect production, and cause significant economic losses in small ruminant breeding. Caprine arthritis encephalitis virus (CAEV) and Maedi-Visna virus (MVV) are prototypes of SRLVs. Both of them affect animal health and welfare in sheep and goats and cause progressive and persistent infections in the small ruminant industry. The present study aimed to reveal the epidemiological status of lentivirus infection in the sheep region in Yalova province located in the southeast part of the Marmara region and determine the circulating genotypes by conducting the sequence analysis of the samples detected positive by a molecular method and molecular characterization of the detected field strains. To that end, 231 sheep blood samples were used between May 2016 and April 2018. Based on sampling results of the PCR test and ELISA tests, 5.62% (13/231) and 5.19% (12/231) positivity rates were found in sheep, respectively. According to the ELISA test results, a significant difference was found in terms of age groups (6 months -1 age, 1-3 age, >3 age) (χ2: 6.01; p=0.04). Furthermore, the sequence analysis of the gag gene region detected the existence of the A genotype of small ruminant lentiviruses in sheep. The data obtained from the study revealed a low seroprevalence course of SRLV infection in the study area in the absence of a systematic disease control program.

Hand-foot-genital syndrome due to a duplication variant in the GC-rich region of HOXA13

BackgroundHand-Foot-Genital Syndrome (HFGS) is an autosomal dominant disorder characterized by a broad phenotypic spectrum. Variants in HOXA13 gene were associated with HFGS. To date, only twenty families with HFGS have been reported. However, the challenge in HFGS is the limited sample sizes and phenotypic heterogeneity. The advent of next-generation sequencing has permitted the identification of patients with HOXA13 variants who do not manifest with the full HFGS syndromic features. MethodsTrio (parents-proband) Whole-exome sequence(WES) and whole-genome sequencing(WGS) was carried out in this study to investigate the underlying pathogenic genetic factor of the neonate with a wide variety of clinical abnormalities. ResultsNo possible pathogenetic variation was detected by trio-WES, and a duplication variant in HOXA13 (c.360_377dup, p.Ala128_Ala133dup), inherited from her mother, was identified by the subsequent WGS in the proband with malnutrition, feeding difficulties, electrolyte disorders, metabolic acidosis, recurrent urinary tract infections, hydronephrosis, nephrolithiasis, abnormal ureter morphology, cholelithiasis, uterus didelphys. Sequence analysis of the variant region (exon1) indicated a high GC content of 73.92%. In addition, further enquiry of the family history revealed that 5 members of the family in 4 generations had hand and foot anomalies. ConclusionThe neonate was diagnosed with HFGS by genetic analysis. GC content had less influence on sequence coverage in WGS than WES analysis. This was the first report of trio-WGS study for HFGS genetic diagnosis, revealed that subsequent WGS was necessary for identification of potentially pathogenic variants in unexplained genetic disorders.

Characterization of a highly virulent Avibacterium paragallinarum isolate.

Infectious coryza (IC) is an important respiratory infectious disease in chickens. In this study, an Avibacterium paragallinarum Page serovar C strain, named ZJ-C, was isolated from a local layer flock that was routinely vaccinated with an inactivated trivalent vaccine, using reference strain Modesto as the serovar C immunogen. The pathogenicity, immunogenicity, and genetic characteristics of ZJ-C were studied. The minimum pathogenic dose of the isolate was 100 CFU, which was 1/1,000 of the dose of the serovar C reference strain Modesto. The vaccination-challenge trial in specific pathogen-free (SPF) chickens showed that the ZJ-C bacterin could provide 100% protection against challenge from both ZJ-C and Modesto strains, whereas Modesto provided 100% protection against challenge from itself, but only 70% protection against ZJ-C. Sequence analysis of the HMTp210 hypervariable region (region 2) showed that the homology of region 2 between ZJ-C and Modesto was 96.14%, whereas the homology between ZJ-C and the Kume serovar C-4 reference strain HP60 was 99.83%. Phylogenetic analysis of region 2 showed that ZJ-C was most closely related to cluster C-4, represented by HP60. The experimental data obtained in this study will help the selection of optimal vaccine strains and assist serotyping studies of Av. paragallinarum.

A novel mutation in TANGO2 gene associated with recurrent muscle weakness with rhabdomyolysis , metabolic encephalopathy and cardiac arrhythmia: a case report

Background TANGO2 depletion was found to cause clinically recognizable multi-organ involvement disorder in pediatrics with episodic muscle weakness recurrent rhabdomyolysis, intellectual disability, metabolic encephalomyopathic crises and cardiac arrhythmia. TANGO2 deficiency is also referred to as \"metabolic encephalomyopathic crises, recurrent, with rhabdomyolysis, cardiac arrhythmias, and neurodegeneration\" (MECRCN) in OMIM. * 616830 Case presentation We report a case of a 4-year-old Saudi boy from a consanguineous Saudi family with two uncles deceased at 3 year of age with recurrent muscle weakness and hyperammonemia of unknown cause .Patient in last attack progressed to severe metabolic encephalomyopathic crisis that required assisted ventilation for 4 months, complicated with life threatening cardiac tachyarrhythmia. Laboratory findings of hypoglycemia, mild hyperammonemia , severely elevated plasma Creatine Kinase, myoglobinuria , lactic acidosis and increased TSH concentration indicating hypothyroidism have been documented. The clinical profile was highly suggestive of TANGO2-realted disorder. Direct DNA sequence analysis of the entire coding regions of TANGO2 gene identified a novel homozygous deletion for three nucleotides in exon 2 (c.11_13delTCT) resulting in amino acid deletion (phenylalanine) at position 5. Conclusion This report illustrates the importance of collating clinical data and keeping a high index of suspicion in order to reach to the diagnosis.

Short Communication: First report of Xanthomonas sacchari causing rice sheath rot disease in Lampung, Indonesia

Abstract. Ivayani, Widiastuti A, Suryanti, Suharjo R, Priyatmojo A. 2022. Short Communication: First report of Xanthomonas sacchari causing rice sheath rot disease in Lampung, Indonesia. Biodiversitas 23: 6463-6470. Rice sheath rot is recently reported as an emerging important rice disease in Indonesia, which can cause yield losses of up to 85%. Due to its potential loss, serious attention should be given on the disease. However, there is still limited information on the causal agent of the disease in Indonesia, especially from plant pathogenic bacteria. One bacterial isolate (LSE 33) was obtained from the sheath rot symptom of rice. Pathogenicity test revealed that bacteria produced symptoms that were similar to those obtained from the field. Based on the sequence analysis of 16S rRNA gene region, isolate LSE 33 was placed within group of the type strain and reference strains of Xanthomonas sacchari. Strain LSE 33 had 99.93% sequence similarity with Xanthomonas sacchari strain SAM 144 and strain AF 10 isolated from rice, and 99.35% similarity with strain LMG 471T isolated from sugarcane. To our knowledge, this is the first report of X. sacchari causing sheath rot on rice in Indonesia.

First report of entomopathogenic fungi, Aspergillus tamarii (Eurotiales: Trichocomaceae) on Musca domestica (Diptera: Muscidae) larvae

A fungus isolated from mango wasp was found to be pathogenic to houseflies. The isolated fungus was identified as Aspergillus tamarii using morphological characteristics and by comparative nucleotide sequence analysis of ITS regions. Fragments covering the region encoding ITS-1, 5.8S rDNA, and ITS-2 were amplified using the universal primers, ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC). The results of bioassays against early second instar larva showed dose-dependent mortality. Larvicidal activity was carried out at eight different concentrations viz, 1x106, 1x107, 1x108, 2x106, 2x107, 2x108, 3x106, 3x107, and 3x108 spores/ml. Among the two different methods of bioassays, bait method showed highest mortality. Beauveria bassiana was used as a positive control. Tween 80 (0.05%) was used as negative control. Larval mortality commences from day 3 until pupation in both bait and immersion methods. The least LC50 value observed for bait method was 5.28x107 spores/ml followed by immersion method, 5.12x109 spores/ml. On the other hand, the larva treated with commercial fungal strain, Beauveria bassiana showed an LC50 value of 1.26x108 spores/ml and 1.32x108 spores/ml for bait and immersion methods, respectively. Visual observation of mycosis was noticed on treated larva. Treated larvae had extensive growth of fungal hyphae on the larval surface. Scanning Electron Microscopy studies of treated larvae clearly showed the process of fungal infection. Longitudinal section of the treated larva showed fungal hyphae on the haemocoel.

First Report of Yeast-Spot Disease of Soybean Seeds Caused by Eremothecium coryli in Serbia.

Over the last 15 years, the area planted with soybeans (Glycine max) in Serbia has increased drastically, from 131,000 hectares in 2005 to 230,000 in 2019, and the average yield reached 3.2 t/ha in 2020. The Province of Vojvodina is the most important soybean production region with 95% of the total soybean area in Serbia (www.stat.gov.rs). During the 2021 growing season, soybean seeds with various kinds of symptoms including colour changes, light and dark brown spots, blotching, necrosis, and shriveling were collected from soybean field before harvest of soybean cv. Dukat in the Tamiš locality (South Banat District, Vojvodina Province: GPS: 44°56'12.936"N 20°43'24.216"E) in Serbia. The incidence of symptomatic seeds was estimated at 6.4%. Symptomatic soybean seeds were surface disinfected with 2% NaOCl for 2 min, rinsed in sterile water, dried on sterile filter paper, placed on potato dextrose agar (PDA) and were incubated at 25°C in the dark for 10 to 14 days. The identification of fungi at the genus level based on morphological characteristics revealed the presence of species of Macrophomina, Botrytis, Cercospora and Alternaria, which were previously reported as pathogens of soybean seed in Serbia (Krsmanović et al. 2020). Also, seven white to slightly creamy colonies with yeast-like morphology were observed around seeds expressing discoloration and necrotic and sunken spots. Ten days later, microscopic observations of yeast-like colonies revealed the presence of globose budding cells (diameter of 20 to 28 μm) mostly single or rarely in short chains. Also, two to eight needle-shaped ascospores (52 to 80 μm in length) were arranged lengthwise in many cylindrical to naviculate asci (60 to 96 x 8 to 12, avg. 72.4 x 9.2 µm). Ascospores were with a unilateral, slender, flexuous, whip-like appendage. The morphology of the different fungal structures indicated that the pathogen was Eremothecium coryli (Pelgion) Kurtzman and it was further supported by molecular identification. Total DNA was extracted directly from fungal mycelium with a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and PCR amplification performed with primers ITS1F (Gardes and Bruns 1993) and ITS4 (White et al. 1990). Sequence analysis of ITS region revealed that the Serbian isolate ND2/21 (GenBank Accession No. OL958602) shared the highest nucleotide identity of 100% with E. coryli isolate (Accession No. KY103387). For pathogenicity test, fresh soybean seeds (cv. Sava) were surface-disinfected with 2% NaOCl and rinsed in sterile water before inoculation. The seeds were pierced 3-4 times with a sterile insect pin through a drop of yeast suspension (concentration 106 ascospores/ml) of one selected single-spore isolate (ND2-21). Similarly, control seeds were pierced with sterile insect pins through a drop of sterile distilled water. Five inoculated seeds and control (five replicates per treatment) were arranged uniformly in a Petri dish (9 cm diameter) and incubated at 22 to 25°C in the dark and kept under >95% relative humidity during the first 48 h. Twenty days after inoculation, small brown necrotic lesions were visible on the soybean seeds. Re-isolation from symptomatic seeds on PDA dishes yielded yeast-like colonies with the same morphological characteristics as those used for inoculation, thus confirming Koch's postulates. The control seeds had no symptoms. This fungus is widely known as a pathogen of yeast spot disease on soybean seeds (Heinrichs et al. 1976; Kimura et al. 2008), but to our knowledge, it has never been reported in Serbia. Considering that invasive species Nezara viridula L. and Halyomorpha halys (STÅL, 1855), the vectors of this fungus, were reported in our country (Kereši et al. 2012; Šeat 2015) and that their mass appearance has been documented in recent years (Konjević et al. 2020), the presence of this pathogen has the potential to cause considerable damage and severe yield losses, resulting in significant economic impact on soybean production in Serbia.

Nucleotide Sequence Assessment of Four ORFs of Citrus Tristeza Virus: Evidence of Recombination

Citrus Tristeza Virus (CTV), usually occurs in nature as a mixture of genotypes. Six naturally infected citrus (Citrus sinensis) trees grafted on sour orange rootstock were collected from three citrus growing governorates in Egypt (Sharqia, Qalyubia and Garbia). In this study, RT-PCR, Single-Strand Conformation Polymorphism (SSCP) and nucleotide sequence analysis were used for four independent CTV genomic regions (p65, p18, p20, and p23) to detect and assess the sequence and genetic variabilities among CTV Egyptian isolates. RTPCR products (650 bp) for the CTV p23 gene obtained from the selected isolates were used for the SSCP analysis and DNA sequencing. SSCP patterns of p23 gene for individual isolates yielded different complex haplotype patterns. Nucleotide sequence analysis of p23 region amplified from six isolates under study revealed that p23 shared high nucleotide identity 98.7% with T36 isolate from USA, Florida. Phylogenetic analysis of p23 gene indicated a close evolutionary relationship between all examined isolates and Qaha isolate (T36 isolate group), suggesting that they may have originated from closely related ancestors. Nucleotide sequence analysis of the three genes located on CTV 3′-coterminal overhang, p18, p20 and p65, amplified from isolate A3, Sharqia governorate, revealed that the p18, p65, and p20 genes were related to the T3-KB isolate from South Africa with 99%–100% sequence homology. Phylogenetic relationship analysis for p65, p18 and p20 ORFs clustered the current A3 isolate with T3 genotype group. The recombination analysis identified three of six isolates from Sharqia, and Garbia as potential recombinant for p23 gene. The isolates T36 and T3 were identified as major donors for recombination events in isolate A3. Our results concluded that p23 ORF likely to be as a hotspot region for recombination and originated through recombination event. The current study indicated that recombination is an important factor for the origin of CTV strains in Egypt.

Genetic Diversity Relationship in Azakheli Buffalo Inferred from mtDNA and MC1R Sequences Comparison.

Azakheli is relatively smaller riverine breed with a very peculiar characteristics kept under unique traditional husbandry practices in comparison with rest of the Pakistani buffalo breeds; however, milk production is comparable. The present study was conducted to evaluate the genetic diversity of Azakheli breed. A total of sixty-six blood samples were collected for the amplification of mtDNA D-loop region and MC1R gene sequencing analysis. Median-joining network analysis of 191 mtDNA D-loop sequences of Azakheli and eight Indian riverine buffalo breeds clustered into three clades. Ancient Azakheli Region 1 clade was the oldest with the highest mutation steps and was present close to the root of UPGMA phylogenetic tree. There was 5 mutated lines distance between Pakistan buffalo and Indian riverine buffaloes. The populations of neighboring countries did not share any haplotypes with Azakheli buffalo of Pakistan. Possibly, residing for so long in the cold atmosphere and high elevation regions caused the mutation in mtDNA D-loop, though these conditions did not affect the overall performance of Azakheli as milch buffalo breed of Pakistan. MC1R analyses showed high mutations in Azakheli of Albino phenotype and all the black phenotype individuals of Azakheli buffalo share haplotypes with dominant Chinese and Indian black phenotypes buffaloes in MC1R median-joining network, indicating the reason of black coat color is due to MC1R gene. The haplotype diversity and nucleotide diversity was (H. 0.923, Pi: 0.00895) in Azakheli. Current results illustrated Asian ancestry for Azakheli buffalo, and mtDNA and MC1R analyses provided further evidence. Additional genetic analyses and archeological studies may provide further insight into the domestication period and history of Azakheli buffalo breed. The further studies are required on different coat colors with different genes on Azakheli buffalo to understand the phenotype variation.

Molecular diagnosis and possible control of the pathogenic Aspergillus flavus isolates associated with cultivated mushroom Agaricus bisporus in Iraq

Five isolates of Aspergillus flavus were isolated from casing soils, compost and fruiting bodies of Agaricus bisporus from several culture stations in Iraq. According to the pathogenicity test, the highest percentage of inhibition was recorded for isolate A.flavusB1 .It was molecularly diagnosed to the level of A.flavus on the basis of the nucleotide sequence analysis of the ITS genome region and I was recorded globally on the NCBI data base under the accession number ON738705.1. The effect of the hot aqueous extract of Cloves and Conocarpus, and the efficacy of the biocide VEROX on the production and phenotypic characteristics of the white edible fungus A. bisporus was studied in present of the pathogenic fungus. The results showed that the treatment of the combination of plant extracts + biocide + pathogenic fungus was recorded the highest rate of growth inhibition of the pathogenic fungus compared with other treatments ,and it was increased the number of fruiting bodies up to 505 compared with the control treatment of pathogenic fungus was 195. The total yield of the same treatment was 19.894 kg compared to 4.933 kg in the control treatment, and the biological efficiency was recorded by 33.7% compared to 12.6% in the control treatment. In general, this combination increased production and improved the qualitative characteristics of the fruiting bodies, as the average diameter of the cap was 43.1 mm and the stalk length was 39.1 mm compared to 28.5 mm and 23.5 mm in the control treatment, respectively.

Evaluation the pathogenicity and control of Penicillium citrinum isolates affecting the white fungus Agaricus bisporus

Five isolates of Penicillium citrinumwere isolated from casing soils, copmpost and fruiting bodies of Agaricusbisporus from several culture stations in Iraq. According to the pathogenicity test, the highest percentage of inhibition was recorded for isolate P.citrinum(B1). The causal agent was molecularly diagnosed to the level of P. citrinumaccording to the nucleotide sequence analysis of the ITS genome region and it was recorded globally on the NCBI data base under the accission number ON738710.1.The effect of the hot aqueous extract of cloves and conocarpus, and the efficacy of the biocide VEROX on the production and phenotypic characteristics of the white edable fungus Agaricusbisporus was studied with the presence of the pathogenic fungus. The results showed that the treatment of the combination of plant extracts + biocide + pathogenic fungus led to the highest rate of growth inhibition of the pathogenic fungus, increasing number of fruiting bodies up to 435 compared to the control treatment of pathogenic fungus 140. The total yield of the same treatment was 16.398 kg compared to 3.343 kg in the control treatment, and the biological efficiency was recorded by 37.2% compared to 10.2% in the control treatment. In general, this combination led to an increase in production and an improvement in the qualitative characteristics of the fruiting bodies, as the average diameter of the cap was 40.6 mm and the stalk length was 37.3 mm compared to 27.8 mm and 23.5 mm in the control treatment, respectively.