Semantic Variant Primary Progressive Aphasia Research Articles

Resolving the problem of surface dyslexia in Italian through inflection of irregular verbs.

Surface dyslexia and dysgraphia are considered diagnostic features of semantic variant primary progressive aphasia (svPPA) and are useful signs in English, a language whose attributes afford numerous opportunities to observe these phenomena. This, however, is not the case in many languages, including Italian, that have high transparency between orthography and phonology, making surface reading and spelling errors scarce. This creates a problem in applying the diagnostic recommendations for svPPA in such languages. Surface dyslexia and dysgraphia are examples of 'regularization' errors in which semantic knowledge loss leads to a failure to recognize exceptions that do not follow standard rules of pronunciation. Another form of regularization involves the incorrect inflection of irregular verbs using the rules that govern regular verbs. Unlike irregularly pronounced words, Italian, as with many languages, has numerous irregular verbs. The Italian Verb Inflection Test (IVIT) was developed to test the hypothesis that svPPA would regularize irregular verbs when inflecting them into two Italian past tenses. Results confirmed that people with svPPA made a significantly greater proportion of regularization errors compared to people with typical Alzheimer's disease or logopenic variant PPA. Without recourse to the other diagnostic features of PPA subgroups, the IVIT on its own could separate svPPA from these other two groups with 70% sensitivity and ~ 80% specificity. Regularization of irregular verb inflection offers a solution to the problem of applying the surface dyslexia/dysgraphia criterion for svPPA diagnosis in Italian.

Speech perception and language comprehension in primary progressive aphasia

Primary progressive aphasia (PPA) is a neurodegenerative disorder characterized by progressive loss of speech and language. Although speech perception and language comprehension deficits are observed in individuals with PPA, these deficits have been understudied relative to production deficits. Recent work has examined receptive language processing at sublexical, lexical, and semantic levels in PPA; however, systematic investigation of these levels of processing within a single PPA cohort is lacking. The current study sought to fill this gap. Individuals with logopenic, nonfluent, and semantic variants of PPA and healthy, age-matched controls completed minimal pairs syllable discrimination, auditory lexical decision, and picture-word verification tasks to assess sublexical, lexical, and semantic processing. Distinct profiles were observed across PPA variants. Individuals with logopenic variant PPA had impaired performance on auditory lexical decision and picture-word verification tasks, with a trend toward impaired performance on the syllable discrimination task. Individuals with nonfluent and semantic variant PPA had impaired performance only on auditory lexical decision and picture-word verification. Evaluation of the types of errors made on the picture-word verification task (phonological and semantic) provided further insight into levels of deficits across the variants. Overall, the results indicate deficits in receptive processing at the lexical-phonological, lexical-semantic, and semantic levels in logopenic variant PPA, with a trend toward impaired sublexical processing. Deficits were observed at the lexical-semantic and semantic levels in semantic variant PPA, and lexical-phonological deficits were observed in nonfluent PPA, likely reflecting changes both in lexical-phonological processing as well as changes in predictive coding during perception. This study provides a more precise characterization of the linguistic profile of each PPA subtype for speech perception and language comprehension. The constellation of deficits observed in each PPA subtype holds promise for differential diagnosis and for informing models of intervention.

MRI-Based Multi-Class Relevance Vector Machine Classification of Neurodegenerative Diseases.

Machine learning algorithms are a promising automated candidate that can help mitigate the growing need for dementia experts. Despite the substantial development in MRI-based machine learning analyses, case misclassification is a universal finding, yet the reasons behind misclassification are poorly understood. We implemented a multi-class classification approach that uses relevance vector machine and logistic classification to classify research participants based on their whole-brain T1-weighted MRI scans. A total of 468 participants from seven diagnostic classes were included: 144 healthy controls, 84 Alzheimer's disease, 108 behavioral variant frontotemporal dementia (bvFTD), 30 semantic variant primary progressive aphasia (svPPA), 30 non-fluent variant primary progressive aphasia (nfvPPA), 30 corticobasal syndrome (CBS), and 42 progressive supranuclear palsy syndrome (PSPS). We compared the algorithm's diagnostic accuracy against the clinical, pathological, genetic, and quantitative imaging data. The exact neurodegenerative syndrome was predicted in 71% of the cases, the neurodegenerative disease spectrum was predicted in 80% of the cases, and the algorithm distinguished controls from any dementia in 85% of the cases. The algorithm showed high performance in diagnosing healthy controls, moderate performance in diagnosing AD, bvFTD, and svPPA, and low performance in diagnosing CBS, nfvPPA, and PSPS. Based on the quantitative imaging data, most of the misclassified neurodegenerative cases had minimal atrophy and brain volumes comparable to healthy controls. In AD, early-onset AD cases with minimal brain atrophy represented most of the misclassified cases. In bvFTD, FTD genetic mutation carriers (predominantly C9orf72 repeat expansion), FTD phenocopy, patients meeting only possible bvFTD criteria represented most misclassified cases. Case misclassification in machine learning studies in neurodegenerative diseases results from neurodegenerative disease heterogeneity and the limitations of structural MRI's ability to capture the whole gamut of biological changes. Larger and more inclusive datasets that are representative of population biologic heterogeneity are needed to train better machine learning techniques, and a margin of error is expected and should be acceptable, like the uncertainty of a clinical diagnosis by a dementia expert.

Perceptual and semantic deficits in face recognition in semantic dementia

State of the artSemantic dementia (SD) patients including semantic variant primary progressive aphasia (svPPA) and semantic behavioral variant frontotemporal dementia (sbvFTD) patients show semantic difficulties identifying faces and known people related to right anterior temporal lobe (ATL) atrophy. However, it remains unclear whether they also have perceptual deficits in face recognition. MethodologyWe selected 74 SD patients (54 with svPPA and predominant left ATL atrophy and 20 with sbvFTD and predominant right ATL atrophy) and 36 cognitively healthy controls (HC) from UCSF Memory and Aging Center. They underwent a perceptual face processing test (Benton facial recognition test-short version; BFRT-S), and semantic face processing tests (UCSF Famous people battery – Recognition, Naming, Semantic associations – pictures and words subtests), as well as structural magnetic resonance imaging (MRI). Neural correlates with the task’s performance were conducted with a Voxel-based morphometry approach using CAT12. ResultssvPPA and sbvFTD patients were impaired on all semantic face processing tests, with sbvFTD patients performing significantly lower on the famous faces’ recognition task in comparison to svPPA, and svPPA performing significantly lower on the naming task in comparison to sbvFTD. These tasks predominantly correlated with gray matter (GM) volumes in the right and left ATL, respectively. Compared to HC, both svPPA and sbvFTD patients showed preserved performance on the perceptual face processing test (BFRT-S), and performance on the BFRT-S negatively correlated with GM volume in the right posterior superior temporal sulcus (pSTS). ConclusionOur results suggest that early in the disease, with the atrophy mostly restricted to the anterior temporal regions, SD patients do not present with perceptual deficits. However, more severe SD cases with atrophy in right posterior temporal regions might show lower performance on face perception tests, in addition to the semantic face processing deficits. Early sparing of face perceptual deficits in SD patients, regardless of hemispheric lateralization, furthers our understanding of clinical phenomenology and therapeutical approaches of this complex disease.

Inappropriate trusting behaviour in dementia.

Inappropriate trusting behaviour may have significant social, financial and other consequences for people living with dementia. However, its clinical associations and predictors have not been clarified. Here we addressed this issue in canonical syndromes of frontotemporal dementia (FTD) and Alzheimer's disease (AD). In 34 patients with AD and 73 with FTD (27 behavioural variant (bv)FTD, 22 semantic variant primary progressive aphasia (svPPA), 24 nonfluent/agrammatic variant (nfv)PPA) we recorded inappropriate trusting and other abnormal socio-emotional behaviours using a semi-structured caregiver survey. Patients were comprehensively characterised using a general cognitive assessment and the Revised Self-Monitoring Scale (RSMS; an informant index of socioemotional awareness). Inappropriate trusting was more frequent in svPPA (55%) and bvFTD (44%) than nfvPPA (17%) or AD (24%). After adjusting for age, sex, education and Mini-Mental State Examination (MMSE) score, inappropriate trusting was significantly more likely in svPPA (odds ratio 3.61; 95% confidence interval 1.41-8.75) and bvFTD (3.01, 1.23-6.65) than AD. Significant predictors of inappropriate trusting comprised apathy in svPPA, disinhibition and altered pain responsiveness in bvFTD, and lower MMSE and RSMS (self-presentation) scores in AD. Dementia syndromes vary in prevalence and predictors of abnormal trusting behaviour, with implications for clinical counselling and safeguarding.

Everyday Memory Disturbance in Primary Progressive Aphasia

Introduction: Mounting evidence indicates distinct memory profiles among the primary progressive aphasia (PPA) variants. Neuropsychological tests reveal disproportionate memory impairments in the logopenic variant PPA (lv-PPA) relative to the non-fluent variant PPA (nfv-PPA) and semantic variant PPA (sv-PPA). The real-world experience of day-to-day memory disturbances in PPA, however, remains poorly understood. Methods: Everyday expressions of memory in 26 lv-PPA, 24 nfv-PPA, and 40 sv-PPA patients, and 70 healthy controls were examined using the Cambridge Behavioural Inventory-Revised (CBI-R) carer questionnaire. Kruskal-Wallis tests compared CBI-R Memory items (1–8) across groups. Receiver operating characteristic curves evaluated the most discriminative items to distinguish lv-PPA from nfv-PPA. Results: Compared to controls, lv-PPA and sv-PPA patients were reported to experience more day-to-day memory issues (item 1), increased repetition of questions (2), forgetting the names of familiar people and objects (4, 5), and poor concentration (6). lv-PPA patients were also reported to exhibit more occurrences of losing or misplacing items (3) and forgetting the day (7). All PPA groups experienced more confusion in unfamiliar environments (8) than controls. Direct comparisons among PPA groups revealed distinct profiles, with lv-PPA and sv-PPA patients exhibiting more frequent forgetting of names and objects (3, 4) than nfv-PPA, and sv-PPA demonstrating greater day-to-day memory impairment (1), repeated questions (2), and poor concentration (6) compared to nfv-PPA. Forgetting the names of familiar objects (5) was the most sensitive and specific item to distinguish lv-PPA from nfv-PPA. Conclusions: Our findings demonstrate distinct day-to-day memory profiles in PPA. Future research should explore the influence of language impairments on these profiles.

Perceptual and semantic deficits in face recognition in semantic dementia.

Semantic dementia (SD) patients including semantic variant primary progressive aphasia (svPPA) and semantic behavioral variant frontotemporal dementia (sbvFTD) patients show semantic difficulties identifying faces and known people related to right anterior temporal lobe (ATL) atrophy. However, it remains unclear whether they also have perceptual deficits in face recognition. We selected 74 SD patients (54 with svPPA and predominant left ATL atrophy and 20 with sbvFTD and predominant right ATL atrophy) and 36 cognitively healthy controls (HC) from UCSF Memory and Aging Center. They underwent a perceptual face processing test (Benton facial recognition test-short version; BFRT-S), and semantic face processing tests (UCSF Famous people battery - Recognition, Naming, Semantic associations - pictures and words subtests), as well as structural magnetic resonance imaging (MRI). Neural correlates with the task's performance were conducted with a Voxel-based morphometry approach using CAT12. svPPA and sbvFTD patients were impaired on all semantic face processing tests, with sbvFTD patients performing significantly lower on the famous faces' recognition task in comparison to svPPA, and svPPA performing significantly lower on the naming task in comparison to sbvFTD. These tasks predominantly correlated with gray matter (GM) volumes in the right and left ATL, respectively. Compared to HC, both svPPA and sbvFTD patients showed preserved performance on the perceptual face processing test (BFRT-S), and performance on the BFRT-S negatively correlated with GM volume in the right posterior superior temporal sulcus (pSTS). Our results suggest that early in the disease, with the atrophy mostly restricted to the anterior temporal regions, SD patients do not present with perceptual deficits. However, more severe SD cases with atrophy in right posterior temporal regions might show lower performance on face perception tests, in addition to the semantic face processing deficits. Early sparing of face perceptual deficits in SD patients, regardless of hemispheric lateralization, furthers our understanding of clinical phenomenology and therapeutical approaches of this complex disease.

‛It's all communication': Family members' perspectives on the communication needs for themselves and their relatives with primary progressive aphasia.

Communication disabilities, such as primary progressive aphasia (PPA), impact family members as well as the individuals with the condition. To provide adequate communication care to people with PPA (PwPPA) and their family members, it is crucial to understand the communication needs from the family members' perspectives. To date, research on the communication needs of people with primary progressive aphasia and their family members from the perspectives of family members has been limited. The specific research objectives were to explore (a) the communication needs pertaining to PwPPA in the early, middle and late stages; and (b) the communication needs pertaining to family members of PwPPA in the early, middle and late stages, from the perspectives of family members. This study employed a qualitative description approach, underpinned by the pragmatic paradigm. Data collection involved semi-structured qualitative interviews with eight family members (relatives of four individuals with the logopenic variant of PPA, of two individuals with the nonfluent variant of PPA, of one individual with the semantic variant of PPA and of one individual with mixed PPA). Qualitative content analysis was used to identify codes and categories in relation to the research objectives. Qualitative content analysis revealed eight categories of communication needs pertaining to the PwPPA: person-specific needs; diagnosis and disclosure; general communication difficulties; impact on communication in everyday life; impact on cognition; impact on psychosocial well-being; impact on person's dignity and autonomy; and future planning. Six categories were identified pertaining to the family members: information about and awareness of PPA; impact of communication difficulties on family/others; increased responsibilities for the family in everyday life; impact on psychosocial well-being; and future planning. This investigation has expanded our knowledge in the area by providing insights about communication needs which speech-language pathologists and other health professionals should be aware of and take into account when providing communication care to PwPPA and their families. What is already known on the subject Person- and family-centred communication care is optimally guided by the person's and family's needs and values. Research on communication care for people with primary progressive aphasia has underscored the inclusion of family members. Previous research has investigated the impact and experiences of living with primary progressive aphasia from the family member perspective. What this paper adds to existing knowledge To date, research focusing on identifying the communication needs of people with primary progressive aphasia and their family members from the perspective of family members is limited. This study adds the family members' perspectives on the communication needs pertaining to themselves and their relatives with primary progressive aphasia in the early, middle and late stages of primary progressive aphasia. What are the potential or clinical implications of this work? Several clinical implications have been raised. Family members experience communication needs for themselves and should be included as recipients of communication care. Clinicians supporting people with primary progressive aphasia should be cognizant of the impact of communication fatigue on everyday life and therapy tasks. Communication care for this population should include communication partner training, support for psychosocial well-being and support with communication around future planning.

Hemispheric asymmetries in hippocampal volume related to memory in left and right temporal variants of frontotemporal degeneration.

In addition to Alzheimer's disease (AD), the hippocampus is now known to be affected in variants of frontotemporal degeneration (FTD). In semantic variant primary progressive aphasia (svPPA), characterized by language impairments, hippocampal atrophy is greater in the left hemisphere. Nonverbal impairments (e.g., visual object recognition) are prominent in the right temporal variant of FTD (rtvFTD), and hippocampal atrophy may be greater in the right hemisphere. In this study we examined the hypothesis that leftward hippocampal asymmetry (predicted in svPPA) would be associated with selective verbal memory impairments (with relative preservation of visual memory), while rightward asymmetry (predicted in rtvFTD) would be associated with the opposite pattern (greater visual memory impairment). In contrast, we predicted that controls and individuals in the amnestic mild cognitive impairment stage of AD (aMCI), both of whom were expected to show symmetrical hippocampal volumes, would show roughly equivalent scores in verbal and visual memory. Participants completed delayed recall tests with words and geometric shapes, and hippocampal volumes were assessed with MRI. The aMCI sample showed symmetrical hippocampal atrophy, and similar degree of verbal and visual memory impairment. The svPPA sample showed greater left hippocampal atrophy and verbal memory impairment, while rtvFTD showed greater right hippocampal atrophy and visual memory impairment. Greater asymmetry in hippocampal volumes was associated with larger differences between verbal and visual memory in the FTD samples. Unlike AD, asymmetry is a core feature of brain-memory relationships in temporal variants of FTD.

Genetic Screening of Patients with Sporadic Alzheimer's Disease and Frontotemporal Lobar Degeneration in the Chinese Population.

Alzheimer's disease (AD) and frontotemporal lobar degeneration (FTLD) account for the vast majority of neurodegenerative dementias. AD and FTLD have different clinical phenotypes with a genetic overlap between them and other dementias. This study aimed to identify the genetic spectrum of sporadic AD and FTLD in the Chinese population. A total of 74 sporadic AD and 29 sporadic FTLD participants were recruited. All participants underwent whole-exome sequencing (WES) and testing for a hexanucleotide expansion in C9orf72 was additionally performed for participants with negative WES results. Four known pathogenic or likely pathogenic variants, including PSEN1 (p.G206D), MAPT (p.R5H), LRRK2 (p.W1434*), and CFAP43 (p.C934*), were identified in AD participants, and 1 novel pathogenic variant of ANXA11 (p.D40G) and two known likely pathogenic variants of MAPT (p.D177V) and TARDBP (p.I383V) were identified in FTLD participants. Twenty-four variants of uncertain significance as well as rare variants in risk genes for dementia, such as ABCA7, SORL1, TRPM7, NOS3, MPO, and DCTN1, were also found. Interestingly, several variants in participants with semantic variant primary progressive aphasia were detected. However, no participants with C9orf72 gene variants were found in the FTLD cohort. There was a high frequency of genetic variants in Chinese participants with sporadic AD and FTLD and a complex genetic overlap between these two types of dementia and other neurodegenerative diseases.

Clinical and neuroanatomical characterization of the semantic behavioral variant of frontotemporal dementia in a multicenter Italian cohort

BackgroundSemantic behavioral variant frontotemporal dementia (sbvFTD) is a neurodegenerative condition presenting with specific behavioral and semantic derangements and predominant atrophy of the right anterior temporal lobe (ATL). The objective was to evaluate clinical, neuropsychological, neuroimaging, and genetic features of an Italian sbvFTD cohort, defined according to recently proposed guidelines, compared to semantic variant primary progressive aphasia (svPPA) and behavioral variant FTD (bvFTD) patients.MethodsFifteen sbvFTD, sixty-three bvFTD, and twenty-five svPPA patients and forty controls were enrolled. Patients underwent clinical, cognitive evaluations, and brain MRI. Symptoms of bvFTD patients between onset and first visit were retrospectively recorded and classified as early and late. Grey matter atrophy was investigated using voxel-based morphometry.ResultssbvFTD experienced early criteria-specific symptoms: world, object and person-specific semantic loss (67%), complex compulsions and rigid thought (60%). Sequentially, more behavioral symptoms emerged (apathy/inertia, loss of empathy) along with non-criteria-specific symptoms (anxiety, suspiciousness). sbvFTD showed sparing of attentive/executive functions, especially compared to bvFTD and better language functions compared to svPPA. All sbvFTD patients failed at the famous face recognition test and more than 80% failed in understanding written metaphors and humor. At MRI, sbvFTD had predominant right ATL atrophy, almost specular to svPPA. Three sbvFTD patients presented pathogenic genetic variants.ConclusionWe replicated the application of sbvFTD diagnostic guidelines in an independent Italian cohort, demonstrating that the presence of person-specific semantic knowledge loss and mental rigidity, along with preserved executive functions and a predominant right ATL atrophy with sparing of frontal lobes, should prompt a diagnosis of sbvFTD.

Computer-Based Naming Treatment for Semantic Variant Primary Progressive Aphasia With History of Traumatic Brain Injury: A Single-Case Experimental Design.

The purpose of this study was to investigate the effectiveness of a self-administered naming treatment for one individual, B.N., presenting with semantic variant primary progressive aphasia (svPPA) and a history of traumatic brain injury (TBI). Naming treatment included components of Lexical Retrieval Cascade Treatment and was self-administered using an adaptive spaced retrieval software, Anki. Using a multiple-baseline, single-case experimental design, naming accuracy probes were taken during pretreatment, treatment, posttreatment, and follow-up (through 12 months) for 60 trained words and 10 untrained words. Item-level Bayesian generalized mixed-effects models were used to estimate (a) the treatment effect for trained words, (b) change in untrained words, and (c) maintenance of treatment effects from posttreatment to each subsequent follow-up. Statistical analyses revealed that a gain of 35 out of 60 trained words (35.3; 90% CI [30.6, 39.5]) was directly attributable to treatment. Following treatment, evidence of generalization to untrained words was not observed. During the follow-up period, there was gradual decline in naming accuracy of trained items. The positive treatment results reported here support the use of self-administered naming treatments for those with svPPA and a history of TBI. Although the utility of this treatment approach is constrained by patient factors including motivation, self-administered naming treatments represent a unique opportunity to expand access to speech-language intervention for people with svPPA, including those with concomitant diagnoses. https://doi.org/10.23641/asha.25119080.

More than a piece of cake: Noun classifier processing in primary progressive aphasia.

Clinical understanding of primary progressive aphasia (PPA) has been primarily derived from Indo-European languages. Generalizing certain linguistic findings across languages is unfitting due to contrasting linguistic structures. While PPA patients showed noun classes impairments, Chinese languages lack noun classes. Instead, Chinese languages are classifier language, and how PPA patients manipulate classifiers is unknown. We included 74 native Chinese speakers (22 controls, 52 PPA). For classifier production task, participants were asked to produce the classifiers of high-frequency items. In a classifier recognition task, participants were asked to choose the correct classifier. Both semantic variant (sv) PPA and logopenic variant (lv) PPA scored significantly lower in classifier production task. In classifier recognition task, lvPPA patients outperformed svPPA patients. The classifier production scores were correlated to cortical volume over left temporal and visual association cortices. This study highlights noun classifiers as linguistic markers to discriminate PPA syndromes in Chinese speakers. Noun classifier processing varies in the different primary progressive aphasia (PPA) variants. Specifically, semantic variant PPA (svPPA) and logopenic variant PPA (lvPPA) patients showed significantly lower ability in producing specific classifiers. Compared to lvPPA, svPPA patients were less able to choose the accurate classifiers when presented with choices. In svPPA, classifier production score was positively correlated with gray matter volume over bilateral temporal and left visual association cortices in svPPA. Conversely, classifier production performance was correlated with volumetric changes over left ventral temporal and bilateral frontal regions in lvPPA. Comparable performance of mass and count classifier were noted in Chinese PPA patients, suggesting a common cognitive process between mass and count classifiers in Chinese languages.

Hearing symptom profiles in Alzheimer’s disease and frontotemporal dementia

AbstractBackgroundHearing loss has emerged as a marker of cognitive decline and potential treatment target in dementia, however the symptom profiles that characterise hearing impairment in different dementia syndromes are poorly characterised. Beyond sound detection, these diseases impair aspects of auditory perception that are crucial for communication in daily life. Here we addressed changes in everyday hearing function in Alzheimer’s disease and frontotemporal dementia syndromes, using standardised auditory symptom questionnaires completed by patients’ caregivers.MethodPrimary caregivers for patients with Alzheimer’s disease (n = 20), logopenic variant primary progressive aphasia (n = 8), nonfluent variant primary progressive aphasia (n = 13), semantic variant primary progressive aphasia (n = 13) and behavioural variant frontotemporal dementia (n = 18) completed the Hearing Impairment Impact – Significant Other Profile, adapted Amsterdam Inventory for Auditory Disability and Khalfa Hyperacusis questionnaires. The Amsterdam Inventory for Auditory Disability was also completed by 15 healthy age‐matched individuals. No participant had a past history of significant otological disease.ResultScores on the Hearing Impairment Impact – Significant Other Profile and Khalfa Hyperacusis Questionnaire respectively demonstrated greater carer burden and increased sensitivity to sound in the behavioural variant frontotemporal dementia group compared with the Alzheimer’s disease group. On the Amsterdam Inventory for Auditory Disability, multi‐domain hearing difficulties were endorsed for the behavioural variant frontotemporal dementia and primary progressive aphasia groups relative to healthy controls, and total scores in the logopenic and semantic variant primary progressive aphasia groups were significantly worse than both the healthy control and Alzheimer’s disease groups. Syndromic groups showed differentiable hearing profiles across hearing domains.ConclusionMajor dementia syndromes have distinct profiles of everyday hearing difficulty, and patients with frontotemporal dementia and progressive aphasia syndromes may have particularly marked (albeit often unrecognised) changes in their hearing. These findings should motivate the development of bespoke auditory tests to assess central hearing function and personalised hearing management strategies in these diseases.

Differentiation of frontotemporal dementia subtypes using neuroimaging‐based multi‐type parallel feature embedding

AbstractBackgroundFrontotemporal dementia (FTD) represents a collection of neurocognitive syndromes with frontotemporal lobar degeneration (FTLD) neuropathology, and is associated with significant clinical, pathological, and genetic heterogeneity. We trained a deep neural network (DNN) classifier to differentiate behavioral‐variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA), and non‐fluent variant (nfvPPA) patients using MRI scans drawn from two multi‐site neuroimaging consortiums.MethodBvFTD (N = 173), nfvPPA (N = 63), and svPPA (N = 41) patients with T1‐MRI were extracted from the FTLD Neuroimaging Initiative (FTLDNI) and the ARTFL‐LEFFTDS Longitudinal Frontotemporal Lobar Degeneration (ALLFTD) databases. MRI data were preprocessed with FreeSurfer, with cortical thickness, cortical volume, and subcortical volumes extracted. Cortical measures were parcellated into 360 patches (i.e., ROIs) according to the HCP‐MMP1 atlas. Both the patch‐based cortical thickness and volume features were harmonized to control confounding effects of sex, age, total intracranial volume (TIV), cohort, and scanner. Multi‐type features were parallelly fed into a multi‐layer‐perceptron (MLP)‐based classifier. Weighted cross‐entropy loss function was used to account for unbalanced sample sizes across FTD subtypes. 10‐fold nested cross‐validation was used to evaluate the robustness of the classification model, with data split into 80/10/10 of training/validation/test data sets.ResultVisual evaluation z‐scores of cortical features among FTLDNI and ALLFTD groups revealed site‐specific differences significantly reduced by feature harmonization, especially for volume (Figure 1). The balanced accuracy of the ensembled DNN classifier of each FTD subtype on test sets across all ten folds reached 0.76 ± 0.09 for bvFTD, 0.79 ± 0.07 for nfvPPA, and 0.88 ± 0.07 for svPPA (Figure 2). Figure 3 shows confusion matrices for classification performance in the test set across ten cross‐validation folds.ConclusionWe developed a deep‐learning‐based framework to classify three FTD subtypes: bvFTD, nfvPPA, and svPPA. The combination of feature harmonization and parallel multi‐type feature embedding framework showed promising differentiation power. This work can be used to recognize at‐risk populations for early and precise diagnosis, to aid intervention planning. Future studies will compare classification based on different input features and use visualization methods to identify the most discriminative regions and explore their clinical relevance.

Progranulin gene mutation of frontotemporal dementia in China: A case report and literature review

AbstractBackgroundProgranulin (GRN) mutations of Frontotemporal dementia (FTD) were rarely reported in China. This study was to report one novel GRN mutation and summarize the genetic and clinical features of patients with GRN mutations in China.MethodComprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58‐year‐old patient who was diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and the clinical and genetic features of patients with Progranulin mutations in China were summarized.ResultMarked lateral atrophy and hypometabolism on the left‐side frontal, temporal and parietal lobes of the patient were found on neuroimages, and amyloid and tau positron emission tomography ruled out pathological protein deposition. A novel heterozygous 45‐bp deletion (c.141414_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was identified through Whole Exon Sequencing of the patient’s genomic deoxyribonucleic acid. Nonsense‐mediated messenger ribonucleic acid decay was implicated in the degradation of the mutated messenger ribonucleic acid, and it was defined as pathogenic by American College of Medical Genetics and Genomics guidelines. In the literature review, we found Chinese reports of 13 patients with Progranulin mutations. A 1.2%–2.6% prevalence, an early disease onset and a female predominance were reported in Chinese patients with GRN mutations.ConclusionOur findings expand the mutational profile of Progranulin mutations in China and provide a basis for potential treatments for Progranulin.

In vivo Braak staing using 18F‐MK‐6240 PET in Alzheimer’s disease

AbstractBackgroundThis study aimed to identify the distribution of [18F]MK‐6240 PET retention and classified according to Braak staging in Alzheimer’s disease (AD). We also evaluated the relationship between [18F]MK‐6240 PET retention and cognitive functions and neurodegeneration.MethodWe enrolled 194 participants including 70 CU (cognitively unimpaired elderly participants older than 60 years old), 56 MCI, 60 probable AD, and 8 patients who had dementia other than AD (subcortical vascular dementia (n = 3), semantic variant primary progressive aphasia (n = 2), frontotemporal dementia (n = 2), corticobasal syndrome (n = 1)). All participants underwent 3T MRI, [18F]MK‐6240, and [18F]Flutemetamol (FLUTE) PET scans, APOE genotyping, and detailed neuropsychological tests. Braak staging was defined as the stages where regional SUVR of ROIs composing each Braak stage > = 1.3. We assessed the Braak staging in the subjects. Correlation analyses between global retention of MK‐6240 PET and neuropsychological test results or neurodegeneration were performed using linear regression.ResultThe proportion of amyloid positivity was 11.4% in CU, 45.5% in MCI, and 83.3% in probable AD. Among probable AD (n = 60), 12 patients were classified to other dementia after amyloid PET and tau PET confirmation. Main Braak stage was Braak 0 in CU, Braak III/IV in amyloid (+) MCI, Braak V/VI in AD dementia. In CU an patents with AD spectrum, global retention of MK‐6240 PET was significantly correlated with MMSE, CDR SOB, language, visuospatial function, memory and frontal/executive functions. In addition, global retention of MK‐6240 PET was correlated with the MRI markers for neurodegeneration, that is, mean cortical thickness and hippocampal volumes.Conclusion [ 18F]MK‐6240 PET successfully identified the Braak staging and associated with amyloid pathology and clinical phenotype in patients with AD. MK‐6240 PET also correlated with cognitive functions and neurodegeneration. MK6240 is a promising tau PET tracer with the potential to be sensitive surrogate markers of AD.

Clinical Manifestations.

Despite considerable interest in music as an index of brain function and a therapeutic modality in dementia, the neural correlates of music processing in different dementias remain poorly defined. In the frontotemporal dementia spectrum, behavioral variant frontotemporal dementia (bvFTD) and semantic variant primary progressive aphasia (svPPA) are often associated with striking changes in musical function and/or retained musical skills, suggesting frontotemporal dementia may be an instructive disease model in which to assess brain mechanisms of music processing in neurodegenerative pathologies. Here we addressed this issue using activation fMRI in patients with frontotemporal dementia. Nineteen patients (10 svPPA, nine bvFTD) and 26 healthy age-matched controls underwent 3-Tesla 'sparse' fMRI in which they listened passively to musical melodies. In a 2×2 factorial design, stimulus conditions were manipulated to probe two key dimensions of music processing: semantic memory (familiarity: familiar vs. novel melodies) and perceptual features (temporal structure: isochronous vs. anisochronous melodies). Post-scan behavioral testing assessed participants' ability to discriminate melodies under each of the two manipulated stimulus dimensions. Information about participant demographics and musical background was also collected. The healthy older control group showed separable profiles of activation in posterior superior temporal cortex for processing musical temporal structure, and in anterior temporal and inferior frontal cortices for processing musical familiarity. Compared with healthy older listeners, syndromic groups showed differential patterns of engagement of these distributed neural networks. In post-scan behavioral testing, patients with bvFTD also exhibited significantly impaired musical familiarity judgments relative to healthy controls. Frontotemporal dementia syndromes show distinct functional neuroanatomical signatures of music perception. Future work should explore fMRI of music processing as a probe of neural function in particular molecular pathologies and a candidate marker of therapeutic potential in dementia.

EEG correlates in the three variants of Primary Progressive Aphasia

AbstractBackgroundThe analysis of EEG cortical sources is promising for the investigation of neurodegenerative disorders. The aim of this study is to explore its value in the characterization of the three clinical presentations of primary progressive aphasia (PPA).MethodA resting‐state 19‐channel EEG was obtained in 48 patients diagnosed with PPA (21 nonfluent/agrammatic variant PPA [nfv‐PPA], 18 logopenic variant PPA [lv‐PPA], 9 semantic variant PPA [sv‐PPA]) and in 21 matched healthy controls. Using eLORETA, EEG current source density (CSD) values were estimated at voxel‐level and compared among groups of patients and controls.ResultPatients showed a low‐to‐moderate cognitive impairment. Lv‐PPA cases showed a higher delta density over the left frontal and temporal regions when compared to sv‐PPA subjects, and in left precuneus and posterior cingulate when compared to nfv‐PPA patients. They also displayed a higher delta density in left frontal, parietal and temporal regions than healthy subjects, and lower alpha1 density in left occipital regions compared with other patient groups. Lv‐PPA patients also showed reduced alpha2, beta1 and beta2 density over the left occipital regions when compared to healthy subjects. No significant differences were found in terms of CSD among sv‐PPA, nfv‐PPA and healthy subjects.ConclusionConsistently with our previous studies, findings in PPA patients suggest that Alzheimer’s disease (AD), but not fronto‐temporal degeneration (FTD), might induce a characteristic disruption of the cortical electrical activity, detectable by EEG. EEG might thus help in the differential diagnosis between AD‐related and FTD‐related PPA variants.

Dyslexia phenotypes in Chinese‐speaking individuals with Primary Progressive Aphasia

AbstractBackgroundThere are more than 7,000 living languages worldwide with wide heterogeneities in their linguistic features. Varying dementia symptomatology has been noted across speakers of different languages. Chinese languages adopt logographic scripts that contrast greatly from Indo‐European languages with alphabetic writing systems. For instance, Chinese characters have weak grapheme‐phoneme correspondence, with only 19‐ 39% pronounced per their phonetic components. Chinese characters also have 20 different spatial configurations with varying visuospatial complexity and abundant heteronyms. Past literature has focused on the reading presentations of primary progressive aphasia (PPA) patients that adopt Indo‐European languages. This study outlined the reading presentations of Chinese‐speaking PPA patients.MethodThe CLAP (Chinese Language Assessment for PPA) battery is designed to characterize the neurolinguistics features of Chinese‐speaking PPA individuals. In CLAP character reading test, participants are tasked to read aloud 50 Chinese characters that vary in lexicality (pictographic, regular compound, and irregular compound characters), character frequency and concreteness. Voxel‐based morphometry(VBM) was performed to examine the neural basis of reading performance. Participants are also tasked with reading pairs of compound words with heteronyms (e.g., “bow tie” vs “bow down).ResultsA total of 15 Mandarin‐speaking controls and 38 PPA individuals [6 nonfluent variant (nfv) PPA, 9 semantic variant (sv) PPA and 23 logopenic variant (lv) PPA] completed CLAP reading task. In character reading test, svPPA scored significantly lower than controls and nfvPPA (pictographic: p = 0.026; regular compound: p = 0.007; irregular compound characters: p<0.001). Regardless of lexicality, the reading score significantly correlated with volumetric changes over left temporal pole. While over‐regularization errors/surface dyslexia was the most common reading error across control and PPA groups, it was not specific to svPPA (p = 0.109). Conversely, on heteronym word reading test, svPPA and lvPPA scored significantly lower in accuracy, with over‐regularization errors more frequently noted in svPPA group.ConclusionContrary to English svPPA patients that struggled specifically with irregular word reading and showed frequent surface dyslexia, Chinese PPA patients showed no variant‐specific differences across lexicality, and svPPA‐specific over‐regularization phenomenon were found at the lexical (i.e., heteronym‐reading) and not sub‐lexical reading. Diagnostic criteria for PPA syndrome vary with languages and should ideally be tailored linguistically.