Scintillation Vials Research Articles

Crystal Structure of Biotin Carboxylase in Complex with Substrates and Implications for Its Catalytic Mechanism

Biotin-dependent carboxylases are widely distributed in nature and have important functions in many cellular processes. These enzymes share a conserved biotin carboxylase (BC) component, which catalyzes the ATP-dependent carboxylation of biotin using bicarbonate as the donor. Despite the availability of a large amount of biochemical and structural information on BC, the molecular basis for its catalysis is currently still poorly understood. We report here the crystal structure at 2.0 A resolution of wild-type Escherichia coli BC in complex with its substrates biotin, bicarbonate, and Mg-ADP. The structure suggests that Glu(296) is the general base that extracts the proton from bicarbonate, and Arg(338) is the residue that stabilizes the enolate biotin intermediate in the carboxylation reaction. The B domain of BC is positioned closer to the active site, leading to a 2-A shift in the bound position of the adenine nucleotide and bringing it near the bicarbonate for catalysis. One of the oxygen atoms of bicarbonate is located in the correct position to initiate the nucleophilic attack on ATP to form the carboxyphosphate intermediate. This oxygen is also located close to the N1' atom of biotin, providing strong evidence that the phosphate group, derived from decomposition of carboxyphosphate, is the general base that extracts the proton on this N1' atom. The structural observations are supported by mutagenesis and kinetic studies. Overall, this first structure of BC in complex with substrates offers unprecedented insights into the molecular mechanism for the catalysis by this family of enzymes.

Comparative Safety of Various Intracanal Irrigation Systems

The objective of this project was to evaluate the safety of various intracanal irrigation systems by measuring the apical extrusion of irrigant. Twenty-two single canal, extracted mature teeth were instrumented and secured through the lid of a scintillation vial to collect apically extruded irrigant. A precision syringe pump delivered controlled amounts of irrigant at a constant flow. The irrigation systems used were EndoVac Micro and Macro Cannula, EndoActivator, manual irrigation with Max-I-Probe needle, Ultrasonic Needle Irrigation, and Rinsendo. Results were analyzed by using one-way analysis of variance with Scheffé test ( P < .05). The EndoVac Micro and Macro cannulae groups did not extrude irrigant, and there was no statistically significant difference between these 2 groups and the EndoActivator group. Within the groups that produced extrusion, EndoActivator extruded statistically significantly less irrigant than Manual, Ultrasonic, and Reinsendo groups. There was no statistically significant difference among Manual, Ultrasonic, and Rinsendo groups. This study showed that the EndoVac did not extrude irrigant after deep intracanal delivery and suctioning the irrigant from the chamber to full working length. EndoActivator had a minimal, although statistically insignificant, amount of irrigant extruded out of the apex when delivering irrigant into the pulp chamber and placing the tip into the canal and initiating the sonic energy of the EndoActivator. Manual, Ultrasonic, and Rinsendo groups had significantly greater amount of extrusion compared with EndoVac and EndoActivator.

Prolonged AICAR-induced AMP-kinase activation promotes energy dissipation in white adipocytes: novel mechanisms integrating HSL and ATGL

This study was designed to investigate the effects of prolonged activation of AMP-activated protein kinase (AMPK) on lipid partitioning and the potential molecular mechanisms involved in these processes in white adipose tissue (WAT). Rat epididymal adipocytes were incubated with 5'-aminoimidasole-4-carboxamide-1-beta-d-ribofuranoside (AICAR;0.5 mM) for 15 h. Also, epididymal adipocytes were isolated 15 h after AICAR was injected (i.p. 0.7 g/kg body weight) in rats. Adipocytes were utilized for various metabolic assays and for determination of gene expression and protein content. Time-dependent in vivo plasma NEFA concentrations were determined. AICAR treatment significantly increased AMPK activation, inhibited lipogenesis, and increased FA oxidation. This was accompanied by upregulation of peroxisome proliferator-activated receptor (PPAR)alpha, PPARdelta, and PPARgamma-coactivator-1alpha (PGC-1alpha) mRNA levels. Lipolysis was first suppressed, but then increased, both in vitro and in vivo, with prolonged AICAR treatment. Exposure to AICAR increased adipose triglyceride lipase (ATGL) content and FA release, despite inhibition of basal and epinephrine-stimulated hormone-sensitive lipase (HSL) activity. Here, we provide evidence that prolonged AICAR-induced AMPK activation can remodel adipocyte metabolism by upregulating pathways that favor energy dissipation versus lipid storage in WAT. Additionally, we show novel time-dependent effects of AICAR-induced AMPK activation on lipolysis, which involves antagonistic modulation of HSL and ATGL.

Disruption of a Plasmodium falciparum Multidrug Resistance-associated Protein (PfMRP) Alters Its Fitness and Transport of Antimalarial Drugs and Glutathione

ATP-binding cassette transporters play an important role in drug resistance and nutrient transport. In the human malaria parasite Plasmodium falciparum, a homolog of the human p-glycoprotein (PfPgh-1) was shown to be involved in resistance to several drugs. More recently, many transporters were associated with higher IC50 levels in responses to chloroquine (CQ) and quinine (QN) in field isolates. Subsequent studies, however, could not confirm the associations, although inaccuracy in drug tests in the later studies could contribute to the lack of associations. Here we disrupted a gene encoding a putative multidrug resistance-associated protein (PfMRP) that was previously shown to be associated with P. falciparum responses to CQ and QN. Parasites with disrupted PfMRP (W2/MRPΔ) could not grow to a parasitemia higher than 5% under normal culture conditions, possibly because of lower efficiency in removing toxic metabolites. The W2/MRPΔ parasite also accumulated more radioactive glutathione, CQ, and QN and became more sensitive to multiple antimalarial drugs, including CQ, QN, artemisinin, piperaquine, and primaquine. PfMRP was localized on the parasite surface membrane, within membrane-bound vesicles, and along the straight side of the D-shaped stage II gametocytes. The results suggest that PfMRP plays a role in the efflux of glutathione, CQ, and QN and contributes to parasite responses to multiple antimalarial drugs, possibly by pumping drugs outside the parasite.

2-Bromopalmitate and 2-(2-hydroxy-5-nitro-benzylidene)-benzo[b]thiophen-3-one inhibit DHHC-mediated palmitoylation in vitro

Pharmacologic approaches to studying palmitoylation are limited by the lack of specific inhibitors. Recently, screens have revealed five chemical classes of small molecules that inhibit cellular processes associated with palmitoylation (Ducker, C. E., L. K. Griffel, R. A. Smith, S. N. Keller, Y. Zhuang, Z. Xia, J. D. Diller, and C. D. Smith. 2006. Discovery and characterization of inhibitors of human palmitoyl acyltransferases. Mol. Cancer Ther. 5: 1647-1659). Compounds that selectively inhibited palmitoylation of N-myristoylated vs. farnesylated peptides were identified in assays of palmitoyltransferase activity using cell membranes. Palmitoylation is catalyzed by a family of enzymes that share a conserved DHHC (Asp-His-His-Cys) cysteine-rich domain. In this study, we evaluated the ability of these inhibitors to reduce DHHC-mediated palmitoylation using purified enzymes and protein substrates. Human DHHC2 and yeast Pfa3 were assayed with their respective N-myristoylated substrates, Lck and Vac8. Human DHHC9/GCP16 and yeast Erf2/Erf4 were tested using farnesylated Ras proteins. Surprisingly, all four enzymes showed a similar profile of inhibition. Only one of the novel compounds, 2-(2-hydroxy-5-nitro-benzylidene)-benzo[b]thiophen-3-one [Compound V (CV)], and 2-bromopalmitate (2BP) inhibited the palmitoyltransferase activity of all DHHC proteins tested. Hence, the reported potency and selectivity of these compounds were not recapitulated with purified enzymes and their cognate lipidated substrates. Further characterization revealed both compounds blocked DHHC enzyme autoacylation and displayed slow, time-dependent inhibition but differed with respect to reversibility. Inhibition of palmitoyltransferase activity by CV was reversible, whereas 2BP inhibition was irreversible.

A Role for the Proton-coupled Folate Transporter (PCFT-SLC46A1) in Folate Receptor-mediated Endocytosis

Recently, this laboratory identified a proton-coupled folate transporter (PCFT), with optimal activity at low pH. PCFT is critical to intestinal folate absorption and transport into the central nervous system because there are loss-of-function mutations in this gene in the autosomal recessive disorder, hereditary folate malabsorption. The current study addresses the role PCFT might play in another transport pathway, folate receptor (FR)-mediated endocytosis. FRalpha cDNA was transfected into novel PCFT(+) and PCFT(-) HeLa sublines. FRalpha was shown to bind and trap folates in vesicles but with minimal export into the cytosol in PCFT(-) cells. Cotransfection of FRalpha and PCFT resulted in enhanced folate transport into cytosol as compared with transfection of FRalpha alone. Probenecid did not inhibit folate binding to FR, but inhibited PCFT-mediated transport at endosomal pH, and blocked FRalpha-mediated transport into the cytosol. FRalpha and PCFT co-localized to the endosomal compartment. These observations (i) indicate that PCFT plays a role in FRalpha-mediated endocytosis by serving as a route of export of folates from acidified endosomes and (ii) provide a functional role for PCFT in tissues in which it is expressed, such as the choroid plexus, where the extracellular milieu is at neutral pH.

The Commonly Used cGMP-dependent Protein Kinase Type I (cGKI) Inhibitor Rp-8-Br-PET-cGMPS Can Activate cGKI in Vitro and in Intact Cells

Small-molecule modulators of cGMP signaling are of interest to basic and clinical research. The cGMP-dependent protein kinase type I (cGKI) is presumably a major mediator of cGMP effects, and the cGMP analogue Rp-8-Br-PET-cGMPS (Rp-PET) (chemical name: beta-phenyl-1,N2-etheno-8-bromoguanosine-3',5'-cyclic monophosphorothioate, Rp-isomer) is currently considered one of the most permeable, selective, and potent cGKI inhibitors available for intact cell studies. Here, we have evaluated the properties of Rp-PET using cGKI-expressing and cGKI-deficient primary vascular smooth muscle cells (VSMCs), purified cGKI isozymes, and an engineered cGMP sensor protein. cGKI activity in intact VSMCs was monitored by cGMP/cGKI-stimulated cell growth and phosphorylation of vasodilator-stimulated phosphoprotein. Unexpectedly, Rp-PET (100 microm) did not efficiently antagonize activation of cGKI by the agonist 8-Br-cGMP (100 microm) in intact VSMCs. Moreover, in the absence of 8-Br-cGMP, Rp-PET (100 microm) stimulated cell growth in a cGKIalpha-dependent manner. Kinase assays with purified cGKI isozymes confirmed the previously reported inhibition of the cGMP-stimulated enzyme by Rp-PET in vitro. However, in the absence of the agonist cGMP, Rp-PET partially activated the cGKIalpha isoform. Experiments with a fluorescence resonance energy transfer-based construct harboring the cGMP binding sites of cGKI suggested that binding of Rp-PET induces a conformational change similar to the agonist cGMP. Together, these findings indicate that Rp-PET is a partial cGKIalpha agonist that under certain conditions stimulates rather than inhibits cGKI activity in vitro and in intact cells. Data obtained with Rp-PET as cGKI inhibitor should be interpreted with caution and not be used as sole evidence to dissect the role of cGKI in signaling processes.

Measurement of radon emanation of drainage layer media by liquid scintillation counting

Slab-on-ground is a typical base floor construction type in Finland. The drainage layer between the slab and soil is a layer of sand, gravel or crushed stone. This layer has a minimum thickness of 200 mm and is sometimes even 600 mm thick, and thus may be a significant contributor to indoor air radon. In order to investigate radon emanation from the drainage layer material, a simple laboratory test was developed. Many organic solvents have high Ostwald coefficients for radon, i.e., the ratio of the volume of gas absorbed to the volume of the absorbing liquid, which enables direct absorption of radon into a liquid scintillation cocktail. Here, we first present equations relating to the processes of gas transfer in emanation measurement by direct absorption into liquid scintillation cocktails. In order to optimize the method for emanation measurement, four liquid scintillation cocktails were assessed for their ability to absorb radon from air. A simple apparatus consisting of a closed glass container holding an open liquid scintillation vial was designed and the diffusion/absorption rate and Ostwald coefficient were determined for a selected cocktail. Finally, a simple test was developed based on this work.

Role of a Pro-sequence in the Secretory Pathway of Prothyrotropin-releasing Hormone

The biogenesis of rat thyrotropin releasing hormone (TRH) involves the processing of its precursor (proTRH) into five biologically active TRH peptides and several non-TRH peptides where two of them had been attributed potential biological functions. This process implicates 1) proper folding of proTRH in the endoplasmic reticulum after its biosynthesis and exit to the Golgi apparatus and beyond, 2) initial processing of proTRH in the trans Golgi network and, 3) sorting of proTRH-derived peptides to the regulated secretory pathway. Previous studies have focused on elucidating the processing and sorting determinants of proTRH. However, the role of protein folding in the sorting of proTRH remains unexplored. Here we have investigated the role in the secretion of proTRH of a sequence comprising 22 amino acid residues, located at the N-terminal region of proTRH, residues 31-52. Complete deletion of these 22 amino acids dramatically compromised the biosynthesis of proTRH, manifested as a severe reduction in the steady state level of proTRH in the endoplasmic reticulum. This effect was largely reproduced by the deletion of only three amino acid residues, 40PGL42, within the proTRH31-52 sequence. The decreased steady state level of the mutant DeltaPGL was due to enhanced endoplasmic reticulum-associated protein degradation. However, the remnant of DeltaPGL that escaped degradation was properly processed and sorted to secretory granules. Thus, these results suggest that the N-terminal domain within the prohormone sequence does not act as "sorting signal" in late secretion; instead, it seems to play a key role determining the proper folding pathway of the precursor and, thus, its stability.

Yeast Pgc1p (YPL206c) Controls the Amount of Phosphatidylglycerol via a Phospholipase C-type Degradation Mechanism

The product of the open reading frame YPL206c, Pgc1p, of the yeast Saccharomyces cerevisiae displays homology to bacterial and mammalian glycerophosphodiester phosphodiesterases. Deletion of PGC1 causes an accumulation of the anionic phospholipid, phosphatidylglycerol (PG), especially under conditions of inositol limitation. This PG accumulation was not caused by increased production of phosphatidyl-glycerol phosphate or by decreased consumption of PG in the formation of cardiolipin, the end product of the pathway. PG accumulation in the pgc1Delta strain was caused rather by inactivation of the PG degradation pathway. Our data demonstrate an existence of a novel regulatory mechanism in the cardiolipin biosynthetic pathway in which Pgc1p is required for the removal of excess PG via a phospholipase C-type degradation mechanism.

Non-transferrin Iron Reduction and Uptake Are Regulated by Transmembrane Ascorbate Cycling in K562 Cells

K562 erythroleukemia cells import non-transferrin-bound iron (NTBI) by an incompletely understood process that requires initial iron reduction. The mechanism of NTBI ferrireduction remains unknown but probably involves transplasma membrane electron transport. We here provide evidence for a novel mechanism of NTBI reduction and uptake by K562 cells that utilizes transplasma membrane ascorbate cycling. Incubation of cells with dehydroascorbic acid, but not ascorbate, resulted in (i) accumulation of intracellular ascorbate that was blocked by the glucose transporter inhibitor, cytochalasin B, and (ii) subsequent release of micromolar concentrations of ascorbate into the external medium via a route that was sensitive to the anion channel inhibitor, 4,4'-diisothiocyanatostilbene-2,2'-disulfonate. Ascorbate-deficient control cells demonstrated low levels of ferric citrate reduction. However, incubation of the cells with dehydroascorbic acid resulted in a dose-dependent stimulation of both iron reduction and uptake from radiolabeled [(55)Fe]ferric citrate. This stimulation was abrogated by ascorbate oxidase treatment, suggesting dependence on direct chemical reduction by ascorbate. These results support a novel model of NTBI reduction and uptake by K562 cells in which uptake is preceded by reduction of iron by extracellular ascorbate, the latter of which is subsequently regenerated by transplasma membrane ascorbate cycling.

Three-dimensional structure/function analysis of SCP-2-like2 reveals differences among SCP-2 family members

Mosquito sterol carrier protein-2 (AeSCP-2) and sterol carrier protein-2-like2 (AeSCP-2L2) are members of the SCP-2 protein family with similar expression profiles in the mosquito life cycle. In an effort to understand how lipids can be transported by different SCP-2 proteins, the three-dimensional crystal structure of AeSCP-2L2 was solved at 1.7 A resolution. AeSCP-2L2 forms a dimer and binds three fatty acids, one of which resides in a position within the internal cavity at a right angle to the others. This first report of ligand-bound dimerized protein in the SCP-2 protein family indicates that the family has a much more divergent mode of interaction with ligands than previously reported. The potential function of AeSCP-2L2 was investigated via in vivo incorporation of [(3)H]cholesterol and [3H]palmitic acid. Overexpression of AeSCP-2L2 in mosquito cells leads to an increased uptake of free fatty acid, whereas knockdown of AeSCP-2L2 in adult females decreases the accumulation of free fatty acid in the fat body from a blood meal. In contrast, overexpression or knockdown of AeSCP-2L2 has no effect on cholesterol uptake. Our results suggest that the main function of AeSCP-2L2 is as a general intracellular fatty acid carrier, as opposed to having a dedicated role in cholesterol transport.

The Farnesyl-diphosphate/Geranylgeranyl-diphosphate Synthase of Toxoplasma gondii Is a Bifunctional Enzyme and a Molecular Target of Bisphosphonates

Farnesyl-diphosphate synthase (FPPS) catalyzes the synthesis of farnesyl diphosphate, an important precursor of sterols, dolichols, ubiquinones, and prenylated proteins. We report the cloning and characterization of two Toxoplasma gondii farnesyl-diphosphate synthase (TgFPPS) homologs. A single genetic locus produces two transcripts, TgFPPS and TgFPPSi, by alternative splicing. Both isoforms were heterologously expressed in Escherichia coli, but only TgFPPS was active. The protein products predicted from the nucleotide sequences have 646 and 605 amino acids and apparent molecular masses of 69.5 and 64.5 kDa, respectively. Several conserved sequence motifs found in other prenyl-diphosphate synthases are present in both TgFPPSs. TgFPPS was also expressed in the baculovirus system and was biochemically characterized. In contrast to the FPPS of other eukaryotic organisms, TgFPPS is bifunctional, catalyzing the formation of both farnesyl diphosphate and geranylgeranyl diphosphate. TgFPPS localizes to the mitochondria, as determined by the co-localisation of the affinity-purified antibodies against the protein with MitoTracker, and in accord with the presence of an N-terminal mitochondria-targeting signal in the protein. This enzyme is an attractive target for drug development, because the order of inhibition of the enzyme by a number of bisphosphonates is the same as that for inhibition of parasite growth. In summary, we report the first bifunctional farnesyl-diphosphate/geranylgeranyl-diphosphate synthase identified in eukaryotes, which, together with previous results, establishes this enzyme as a valid target for the chemotherapy of toxoplasmosis.

Measurement of drug agglomerates in powder blending simulation samples by near infrared chemical imaging

This research note describes a powder blending simulation study conducted using 20-mL scintillation vials and a bench-top rotating mixer on a scale of 2 g for each sample. In order to investigate the impact of mean particle size and size distribution on blending behavior of an active pharmaceutical ingredient (API), the drug substance was separated into sieve fractions using the US standard sieves of 60, 80, 100, 200, and 325 mesh. Each of the fractions was mixed with two excipients (hydroxypropyl methylcellulose and microcrystalline cellulose) for up to 20 min. Then the blending samples were analyzed by a near infrared chemical imaging (NIR-CI) system. The NIR-CI system was able to measure API particles/domains (agglomerates) at 0.001 mm 2 and above within a 11.2 mm × 9.0 mm field of view. It was found that blends prepared with larger API particles (60–200 mesh) contain agglomerated API domains ≥0.1 mm 2. The blends prepared with finer API particles (≤325 mesh) show the characteristics of a randomized mixing. This simple and effective method can be used for evaluation of blending behavior for APIs in formulation development.

ETHANOL PRESERVATION OF FIRE ANTS ALLOWS RETROSPECTIVE SCREENING FOR SOLENOPSIS INVICTA VIRUS-1

Solenopsis invicta virus-1 (SINV-1) is a positive-strand RNA virus assigned to the Dicistroviridae (Mayo 2002) that appears to infect ants only in the Solenopsis genus (Valles et al. 2007). SINV1 infection has been associated with brood death among colonies of Solenopsis invicta, but whether it is the causative agent of mortality is not known (Valles et al. 2004). Thus, it is hoped that SINV-1 may be able to be exploited for use as a microbial control agent, or as a mode of delivering genes or inhibitors to study functional genomics in this ant pest. Because the virus was only recently discovered and it is the only currently known virus to infect S. invicta, basic knowledge about its biology is lacking. Epidemiologic and phylogenetic studies would certainly benefit if the virus could be examined in archived samples. To address this question, we archived SINV-1-positive S. invicta worker ants in 95% ethanol and tested the ants for the presence of SINV-1 on an irregular basis over a 2-year period. In addition, we examined 2propanoland ethanol-archived S. invicta samples from 1999 and 2001, respectively, for the presence of SINV-1. In February 2005, 2 groups of approximately 300 worker ants from a colony of S. invicta previously determined to be SINV-1-positive (collected from Gainesville, FL) were placed into a 7-ml scintillation vial containing 5 ml of 95% ethanol and stored at room temperature. On an irregular basis over the next 2 years, RNA was extracted from a group of 20 workers from each vial. RNA was extracted by the Trizol (Invitrogen, Carlsbad, CA) method as described previously (Valles & Strong 2005). cDNA was synthesized and subsequently amplified by the One-Step RT-PCR kit (Invitrogen) with oligonucleotide primers p114 (5' CTTGATCGGGCAGGACAAATTC) and p116 (5' GAACGCTGATAACCAATGAGCC). Samples were considered positive for virus when a visible amplicon of anticipated size (646 nt) was present after separation on 1.2% agarose gel containing ethidium bromide. Positive and negative controls were included for each time point. RT-PCR was conducted in a PTC 100 thermal cycler (MJ Reearch, Waltham, MA) under the following optimized temperature regime: 1 cycle at 45'C for 30 min, 1 cycle at 94oC for 2 min, 35 cycles of 94?C for 15 s, 54?C for 15 s, 68'C for 30 s, followed by a final elongation step of 680C for 5 min. Additional alcohol-archived S. invicta ant samples from previous surveys of Florida were examined for the presence of SINV-1 by RT-PCR. Samples from 2001 were archived in 95% ethanol, and those from 1999 were archived in 70% 2-propanol. Table 1 summarizes the results of ethanol

Identification of Acidic Amino Acid Residues in the Protein Kinase Cα V5 Domain That Contribute to Its Insensitivity to Diacylglycerol

The protein kinase C (PKC) isoforms are maintained in an inactive and closed conformation by intramolecular interactions. Upon activation these are disrupted by activators, binding proteins and cellular membrane. We have seen that autophosphorylation of two sites in the C-terminal V5 domain is crucial to keep PKC alpha insensitive to the activator diacylglycerol, which presumably is caused by a masking of the diacylglycerol-binding C1a domain. Here we demonstrate that the diacylglycerol sensitivity of the PKC beta isoforms also is suppressed by autophosphorylation of the V5 sites. To analyze conformational differences, a fusion protein ECFP-PKC alpha-EYFP was expressed in cells and the FRET signal was analyzed. The analogous mutant with autophosphorylation sites exchanged for alanine gave rise to a substantially lower FRET signal than wild-type PKC alpha indicating a conformational difference elicited by the mutations. Expression of the isolated PKC alpha V5 domain led to increased diacylglycerol sensitivity of PKC alpha. We identified acidic residues in the V5 domain that, when mutated to alanines or lysines, rendered PKC alpha sensitive to diacylglycerol. Furthermore, mutation to glutamate of four lysines in a lysine-rich cluster in the C2 domain gave a similar effect. Simultaneous reversal of the charges of the acidic residues in the V5 and the lysines in the C2 domain gave rise to a PKC alpha that was insensitive to diacylglycerol. We propose that these structures participate in an intramolecular interaction that maintains PKC alpha in a closed conformation. The disruption of this interaction leads to an unmasking of the C1a domain and thereby increased diacylglycerol sensitivity of PKC alpha.

Polarity of Response to Transforming Growth Factor-β1 in Proximal Tubular Epithelial Cells Is Regulated by β-Catenin

Transforming growth factor-beta1 (TGF-beta1)-mediated loss of proximal tubular epithelial cell-cell interaction is regulated in a polarized fashion. The aim of this study was to further explore the polarity of the TGF-beta1 response and to determine the significance of R-Smad-beta-catenin association previously demonstrated to accompany adherens junction disassembly. Smad3 signaling response to TGF-beta1 was assessed by activity of the Smad3-responsive reporter gene construct (SBE)(4)-Lux and by immunoblotting for phospho-Smad proteins. Similar results were obtained with both methods. Apical application of TGF-beta1 led to increased Smad3 signaling compared with basolateral stimulation. Association of Smad proteins with beta-catenin was greater following basolateral TGFbeta-1 stimulation, as was the expression of cytoplasmic Triton-soluble beta-catenin. Inhibition of beta-catenin expression by small interfering RNA augmented Smad3 signaling. Lithium chloride, a GSK-3 inhibitor, increased expression of beta-catenin and attenuated TGF-beta1-dependent Smad3 signaling. Lithium chloride did not influence degradation of Smad3 but resulted in decreased nuclear translocation. Smad2 activation as assessed by Western blot analysis and activity of the Smad2-responsive reporter constructs ARE/MF1 was also greater following apical as compared with basolateral TGFbeta-1 stimulation, suggesting that this is a generally applicable mechanism for the regulation of TGF-beta1-dependent R-Smads. Caco-2 cells are a colonic carcinoma cell line, with known resistance to the anti-proliferative effects of TGF-beta1 and increased expression of beta-catenin. We used this cell line to address the general applicability of our observations. Inhibition of beta-catenin in this cell line by small interfering RNA resulted in increased TGF-beta1-dependent Smad3 phosphorylation and restoration of TGF-beta1 anti-proliferative effects.

Feedback Inhibition of Pantothenate Kinase Regulates Pantothenol Uptake by the Malaria Parasite

To survive, the human malaria parasite Plasmodium falciparum must acquire pantothenate (vitamin B5) from the external medium. Pantothenol (provitamin B5) inhibits parasite growth by competing with pantothenate for pantothenate kinase, the first enzyme in the coenzyme A biosynthesis pathway. In this study we investigated pantothenol uptake by P. falciparum and in doing so gained insights into the regulation of the parasite's coenzyme A biosynthesis pathway. Pantothenol was shown to enter P. falciparum-infected erythrocytes via two routes, the furosemide-inhibited "new permeation pathways" induced by the parasite in the infected erythrocyte membrane (the sole access route for pantothenate) and a second, furosemide-insensitive pathway. Having entered the erythrocyte, pantothenol is taken up by the intracellular parasite via a mechanism showing functional characteristics distinct from those of the parasite's pantothenate uptake mechanism. On reaching the parasite cytosol, pantothenol is phosphorylated and thereby trapped by pantothenate kinase, shown here to be under feedback inhibition control by coenzyme A. Furosemide reduced this inherent feedback inhibition by competing with coenzyme A for binding to pantothenate kinase, thereby increasing pantothenol uptake.

Radioactivity measurement with a plastic scintillation vial

Liquid scintillation counting is widely used to measure radioactivity, but it generates radioactive organic liquid waste. Not to generate the liquid waste using a liquid scintillation counter, novel counting method with a plastic scintillation vial was designed. The counting efficiency for 32P was 10–40% and that for 125I was 4–8%. The efficiency depended on the sample volume. The color quenching effect was negligible. No radioactive liquid waste was generated by this method. In addition, you can reuse the measured sample.

Preferential photostructural modification of heteroleptic titanium alkoxides for molecular assembly

The response of a mononuclear, heteroleptic titanium alkoxide [(OPy)2Ti(4MP)2, where OPy = pyridinecarbinol; NC5H4(CH2O) and 4MP = 4-mercaptophenol; OC6H4(SH)] to ultraviolet (UV) irradiation in dilute solution and in solid-state samples has been measured. Vibrational spectroscopy [Fourier transform infrared (FTIR) absorption and Raman scattering] was used to monitor changes in molecular structure upon exposure to 337.1- and 365-nm light. Assignment of spectral features to vibrational modes of the molecule was aided by a normal-mode analysis of the energy-minimized molecular structure within a density-functional theory framework. Photoinduced decreases in peak areas were observed in both FTIR spectra of the precursor solutions and Raman data collected from solution-cast films of the precursor material. These changes were associated with vibrational modes localized at the 4MP ligands. Conversely, no significant modification of vibrational structure associated with the OPy moiety was observed under the excitation conditions examined. In a related study, thin films of the precursor were cast, sampled, and irradiated with UV light in scintillation vials under hydrated air (40% relative humidity) and dry Ar to evaluate the influence of local atmospheric composition on the photoresponse. An increase in the magnitude of photoinduced vibrational changes was observed in the moist-air environment, again associated primarily with the 4MP ligand. The results support an interpretation of these structural changes in terms of a preferential enhancement of hydrolysis at the 4MP site under these conditions. These findings are discussed in the context of an optically driven molecular assembly strategy based on the photoinitiation of intermolecular bonding at selected sites about the metal center.