Pea Samples Research Articles

ИСХОДНЫЙ МАТЕРИАЛ ДЛЯ СОЗДАНИЯ СОРТОВ ГОРОХА ОВОЩНОГО НА КУБАНИ

Results of two yeaґs field studying of 522 samples of peas are presented. Twenty-five samples with valuable agronomic traits were selected for further breeding program. Correlation between duration of interstage periods was revealed.

RESULTS AND PROSPECTS OF PEA BREEDING

In the laboratory of leguminous crops of the “All-Russian Scientific Research Institute of vegetable breeding and seed production”, more than 100 samples of pea are studied annually. As a result, pre-breeding collection of the sources of agronomical valuable traits was developed. It is utilized for development of new pea varieties resistant to lodging. In 2012- 2014, the crossing were conducted. As a result of selection in F2-F6, the lines of different groups of maturity with lodging resistance were selected. These transgressing forms are suitable for canning, deep freezing, and drying. The following samples are recommended for development of high yielded varieties: «102- 82А5Б4» is the middle-early variety, the progenitor of early ripening cv. «Korsar» applied for the state variety trial in 2015 and two promising samples «15 КСИ 15» and «9 КСИ». The «16-05» is the middle-early variety, the transgressive form for the trait «seed amount per nod» with high attachment of lower bean. The sample «K-8915» is the middle-early genotype, high productive, with high attachment of lower bean. The sample «Troyika» is recommended for development of high productive, late ripening initial breeding material. As a result of step crossing this sample is characterized by late maturity, by three bean per nod, and by high attaching of lower bean. The sample «CM-10 m» is distinct in the aphyllous type of leaf, resistance to powdery mildew, paired bean, suitable for canning and drying. This sample was selected as a transgressive form for stem anatomy structure (spongy cell tissue) from sample developed by complex step hybridization. Owing the distinctive feature in the stem anatomy structure, this sample can be recommended as a main parental form for development of varieties resistant to lodging.

Effects of pre-treatments and drying temperatures on the quality of dried green peas

The freshly harvested green peas procured from local market were cleaned and sorted. The average moisture content of the fresh green peas was found 70 to 75 per cent on wet basis. Three different samples of green peas with respect to pre-treatments viz., raw, blanched and blanched after pricking were taken for drying experiment. A laboratory model tray dryer was used for drying green peas with different levels of drying air temperatures (50, 60, 70°C). Drying time, moisture reduction was calculated later with the help of observed data during tray drying. The dried green pea samples were taken for quality evaluation by sensory method, rehydration of final product was also carried out. Survey results underlined the need of technological intervention at various stages of post-harvest processing of green peas in this region. Drying of blanched green peas after pricking at 50°C drying air temperature resulted in shorter drying time to produce best quality dried product as compared to raw and blanched green peas. The dried green peas with final moisture content 7.52 per cent on wet basis showed best rehydration characteristics to yield good quality rehydrated peas which could be preserved and used during off-season.

Importance of spatial and spectral data reduction in the detection of internal defects in food products.

Despite the importance of data reduction as part of the processing of reflection-based classifications, this study represents one of the first in which the effects of both spatial and spectral data reductions on classification accuracies are quantified. Furthermore, the effects of approaches to data reduction were quantified for two separate classification methods, linear discriminant analysis (LDA) and support vector machine (SVM). As the model dataset, reflection data were acquired using a hyperspectral camera in 230 spectral channels from 401 to 879 nm (spectral resolution of 2.1 nm) from field pea (Pisum sativum) samples with and without internal pea weevil (Bruchus pisorum) infestation. We deployed five levels of spatial data reduction (binning) and eight levels of spectral data reduction (40 datasets). Forward stepwise LDA was used to select and include only spectral channels contributing the most to the separation of pixels from non-infested and infested field peas. Classification accuracies obtained with LDA and SVM were based on the classification of independent validation datasets. Overall, SVMs had significantly higher classification accuracies than LDAs (P < 0.01). There was a negative association between pixel resolution and classification accuracy, while spectral binning equivalent to up to 98% data reduction had negligible effect on classification accuracies. This study supports the potential use of reflection-based technologies in the quality control of food products with internal defects, and it highlights that spatial and spectral data reductions can (1) improve classification accuracies, (2) vastly decrease computer constraints, and (3) reduce analytical concerns associated with classifications of large and high-dimensional datasets.

Diversity of collection material of pea, soybean, bean, chickpea and lentil in terms of biological performance

As a result of long term studies of collection material of five pulses (pea, soybean, bean, chickpea, lentil), samples were grouped into three classes, depending on their level of biological performance (low, medium and high).Purpose. Classification of collection samples of pulses from the base collection of plant genetic resources ofUkraine according to their biological performance, investigation of its structural organization, identification of valuable sources.Material and Methods. The results of long-term (17 years) studies in field and laboratory experiments in breeding crop rotation 1 at the Plant Production Institute nd. a V. Ya. Yuryev NAAS are presented. The study material was collection samples. Over the study period 4,813 samples were estimated in a three-year cycle, including 1,390 pea samples, 821 soybean samples, 1,126 bean samples, 836 chickpea samples, and 640 lentil samples. Collection samples of pulses were investigated according to the "Guidelines of the All-Russian Research Institute of Plant Breeding for Studying Pulses" (1975).Results and Discussion. We analyzed the formation of biological performance of collection samples of pulses, depending on weather conditions and ripeness groups. The studied samples were grouped into three classes (according to classifiers of the corresponding genera) – with low, medium and high yield capacity. Most of the pea collection samples had medium (47.8%) and high (38.6%) biological performance, soybean, chickpea and bean samples were characterized by low yield capacity, lentil samples – by medium yield capacity. Pea, bean, lentil, and chickpea samples belonging to the middle-ripening group and soybean samples from the early season group had a high level of biological performance.Conclusions. The studied collection samples from the base collection of five pulses in terms of biological performance and its constituent elements are a representative selection of source material for the creation of pea, soybean, bean, chickpea, and lentils varieties of various ripeness groups with high biological yield capacity.

Modelos de predição da cinética de secagem dos grãos de guandu

O objetivo deste trabalho foi estudar a cinética de secagem em camada fina dos grãos de guandu submetidos a diversas condições de secagem, por meio de diferentes modelos matemáticos. Com o modelo de Fick, determinou-se a difusividade efetiva e a energia de ativação. Para tal, foram utilizadas amostras de 200 g de grãos de guandu com teor de água inicial de 25% (b.u.), as quais foram secas em um secador experimental de leito fixo, ajustado para operar nas temperaturas de 40, 50, 60 e 70 °C e velocidade do ar de secagem a 1,0 m s–1. A secagem, para cada temperatura, foi realizada até o teor de água de equilíbrio dinâmico. Os valores médios da temperatura e da umidade relativa do ar ambiente foram, respectivamente, 26 °C e 68%. A difusividade efetiva do produto foi determinada, para cada temperatura, pressupondo o grão de guandu como uma esfera de igual volume do grão. A difusividade efetiva do produto em função da temperatura foi expressa por uma equação semelhante à proposta por Arrhenius. A análise dos resultados possibilita concluir que as equações de Cavalcanti Mata com seis constantes e Midilli et al. representam, de forma satisfatória, o processo de secagem em todas as condições estudadas; e que utilizando o modelo de Fick a difusividade dos grãos de guandu variou de 2,1x10–10 até 6,8x10-10 m2.s–1 para as temperaturas entre 40 e 70 °C, respectivamente; e a energia de ativação obtida é igual a 34,51kJ.mol–1.

Prediction of pelleting outcomes based on moisture versus strain hysteresis during the loading of individual pea seeds

The pelleting of pea is related to some of the mechanical features of the seeds. Varying in moisture, intact seeds were assigned to unconfined loading–unloading with the help of a universal testing machine. Elastic and permanent strain energy and associated deformations were evaluated on the basis of load–displacement curves. In parallel, samples of pea at the same moisture levels were pelleted. The pelleting energy usage and pellet quality features, that is strength, durability, and bulk density, were tested for correlations with strain hysteresis data. Seed moisture and energy loss during the loading of a single seed showed a strong relevance to the processing and pellet properties. An observed increase in the proportion of non-recoverable strain energy, from 15.5 to 176.1 mJ, resulted in a significant decrease in all analysed pelleting features. The specific energy consumption decreased from 296.5 to 240.1 kJ kg−1. Bulk density and pellet strength SI decreased from 773.6 to 652.7 kg m−3 and 16.61 to 13.60 kN m−1, respectively. An empirical model was introduced for the estimation of pelleting effects as a function of seed plasticity. It was based on a hyperbolic formula, which proved to be accurate for the prediction of energy requirements for pelleting and the properties of pellets.

First Report of Tomato mottle mosaic virus Infection of Pepper in China.

Tomato mottle mosaic virus (ToMMV), a tentative member in genus Tobamovirus, was first reported from a greenhouse tomato sample collected in Mexico in 2013 (2). In August 2013, foliar mottle, shrinking, and necrosis were observed on pepper plants in several vegetable greenhouses of Lhasa, Tibet Autonomous Region, China. Seven symptomatic samples were collected and tested by dot-blot ELISA with antisera against Cucumber mosaic virus, Tobacco mosaic virus (TMV), Cucumber green mottle mosaic virus, Tomato spotted wilt virus, Turnip mosaic virus, and Broad bean wilt virus 2 (kindly provided by Dr. Xueping Zhou of Zhejiang University, China) (3). One of the bell pepper (Capsicum annuum var. grossum) samples reacted with the TMV antibody. Rod-shaped virus particles 300 nm in length were observed in this sample under electron microscopy. The results suggested that a tobamovirus closely related to TMV might be a causal agent. Total nucleic acids were then extracted from all seven samples using a CTAB method (1) and tested by RT-PCR using a pair of tobamovirus degenerate primers, TobamoF (GCWAAGGTKGTWYTBGTRGAYGG) and TobamoR (GTAATTGCTATTGDGTWCCWGC). These two primers were designed according to a conserved region of the TMV, Tomato mosaic virus, and ToMMV genomes (nt 2551-3433 of ToMMV genome [KF477193]). An amplicon of approximately 880 bp was obtained only from the TMV-positive sample. The amplicon was cloned and sequenced (GenBank Accession No. KJ605653). NCBI BLAST search showed that it shared the highest identity (99%) with ToMMV (KF477193), and shared the sequence homology of 82% to Tomato mosaic virus (AF332868) and 77% to TMV (V01408). The results indicated that the symptomatic pepper was infected with ToMMV. To investigate the distribution and incidence of ToMMV, 313 samples of symptomatic pepper, tomato, pumpkin, cucumber, radish, Chinese cabbage, broad bean, pea, and kidney bean samples were collected from 65 fields in Yunnan Province and Tibet Autonomous Region, and tested in RT-PCR with ToMMV-specific primers ToMMVF (AGAGAGATGGCGATAGGTTAAC, identical to nt 830-851 of ToMMV genome, GenBank Accession No. KF477193) and ToMMVR (CTGCAGTCATAGGATCTACTTC, complementary to nt1849-1828). The virus was detected in three tabasco peppers (C. frutescens) from Yunnan and one bell pepper plant from Tibet, suggesting that ToMMV has a restricted host range and is not common in these two regions. To our knowledge, this is the first report of natural infection of ToMMV in peppers as well as in China.

Characterization of saponins in peas (Pisum sativum L.) by HPTLC coupled to mass spectrometry and a hemolysis assay

Peas (Pisum sativum L.) contain two kinds of monodesmosidic, triterpene saponins, structurally comparable to those from soybeans — saponin B (soyasaponin I) and DDMP saponin (soyasaponin βg).A high-performance thin-layer chromatography (HPTLC) method for the fast and reliable estimation of saponins in selected pea cultivars has been developed. Identification of the substances was achieved by coupling HPTLC directly to electrospray ionization mass spectrometry (HPTLC-ESI-MS). Quantitative assessment of saponin B and DDMP saponin was carried out densitometrically after post-chromatographic derivatization with p-anisaldehyde sulphuric acid. The thermal stability of DDMP saponin was investigated at 50°C and 60°C with a time period of 24h. Additionally, particular attention was on the hemolytic activity of the saponins analyzed directly on blood-gelatin covered TLC plates.The presence of DDMP saponin and saponin B in the pea samples was proven by HPTLC-ESI-MS and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS). Their concentration varied depending on the cultivar, with saponin B being always the more abundant compound, predominantly located in the hulls. The temperature dependent decrease of DDMP saponin concentration was more pronounced at 60°C than at 50°C. When treating peas for 24h, nearly all of the DDMP conjugate was converted to saponin B whereas the total amount of saponins was more or less constant. Neither pea saponins nor those from soybeans possess hemolytic activity. In sum, the results are consistent with previous reports and gave evidence that HPTLC is an adequate methodology facilitating a fast and simultaneous analysis of numerous legume and further samples.

Multilocus sequence typing confirms wild birds as the source of a Campylobacter outbreak associated with the consumption of raw peas.

From August to September 2008, the Centers for Disease Control and Prevention (CDC) assisted the Alaska Division of Public Health with an outbreak investigation of campylobacteriosis occurring among the residents of Southcentral Alaska. During the investigation, pulsed-field gel electrophoresis (PFGE) of Campylobacter jejuni isolates from human, raw pea, and wild bird fecal samples confirmed the epidemiologic link between illness and the consumption of raw peas contaminated by sandhill cranes for 15 of 43 epidemiologically linked human isolates. However, an association between the remaining epidemiologically linked human infections and the pea and wild bird isolates was not established. To better understand the molecular epidemiology of the outbreak, C. jejuni isolates (n=130; 59 from humans, 40 from peas, and 31 from wild birds) were further characterized by multilocus sequence typing (MLST). Here we present the molecular evidence to demonstrate the association of many more human C.jejuni infections associated with the outbreak with raw peas and wild bird feces. Among all sequence types (STs) identified, 26 of 39 (67%) were novel and exclusive to the outbreak. Five clusters of overlapping STs (n=32 isolates; 17 from humans, 2 from peas, and 13 from wild birds) were identified. In particular, cluster E (n=7 isolates; ST-5049) consisted of isolates from humans,peas, and wild birds. Novel STs clustered closely with isolates typically associated with wild birds and the environment but distinct from lineages commonly seen in human infections. Novel STs and alleles recovered from human outbreak isolates allowed additional infections caused by these rare genotypes to be attributed to the contaminated raw peas.

Isolation and biochemical characterization of rhizobium from pea crop at Swabi

Microorganisms like Rhizobium are symbiotic bacteria forming nitrogen fixing nodules on legumes. Nodule inducing bacteria are capable of colonizing the roots of legumes to fix nitrogen and to produce phosphorus, phytohormones, siderophores and HCN. To study the important characters of Rhizobium was the main objective of this study which will help for growth and improvement of Pea. Nitrogen (N) and Phosphorus (P) are the foremost limiting nutrients in agricultural soils of Pakistan. Through the enhancement of these microorganisms the deficiency of these major plant nutrients can be control. From diverse areas of Swabi pea samples were collected. Rhizobium strains were isolated from nodules on Yeast-Manitol Agar medium (YMA) and were characterized bio-chemically for Nitrogenase activity, phytohormone production, phosphate solubalization, siderophores and HCN production. Nitrogenase was determined through calorimetrically. The production of ethylene by the Rhizobium strains were ranges from 20.7 µ moles C2H2/hr to 38.4 µ moles C2H2/hr. Phytohormone (IAA) was measured through Electro-Spectrophotometer. The qualitative assessment of phosphorus solubalization was made by size of halo zones around the colonies on Pikovskaya agar medium. Rhizobium strains produced IAA (ranging from 14.25-13.65 µg/ml), Phosphorus solubilized (18-24µg ml-1) and four Rhizobium strains were siderophores positive. Out of seven Rhizobium strains only five strains were able to produce hydrogen cyanide (HCN). Furthermore, biozotes (Biofertilizer) were prepared from inoculation of these Rhizobium strains and were applied in pot experiment to check their effects on pea. All the inoculants showed positive effect on growth and development of peas and significantly increased root shoot length, dry and fresh weight

First Report of Tobacco streak virus Infecting Pigeon Pea (Cajanus cajan) in India

Pigeon pea is an important pulse crop grown in diversified cropping systems in India. In the rainy season of August 2011 and September 2012, pigeon pea cv. LRG 30 plants with leaf necrosis having wrinkled margin on one side were observed in Kadiri mandal of the Anantapuram district of Andhra Pradesh (A.P.), India. Symptoms included necrotic spots on young leaves followed by wilting of leaves, petiole and branch/axillary shoot proliferation, with small leaves having mosaic symptoms. Symptomatic leaves were sap-inoculated onto 10 seedlings of cowpea (cv. Pusa Komal) using 0.01 M phosphate buffer (pH 7.0). Localized necrotic lesions developed in all the inoculated plants after 2 days post inoculation. Field symptoms were reproduced on healthy pigeon pea upon back inoculation using single lesions of infected cowpea leaves. In direct antigen coating (DAC)-ELISA, all the infected pigeon pea and cowpea leaf samples were positive to a polyclonal antiserum specific to Tobacco streak virus (TSV) supplied by ICRISAT, India. Total RNA was extracted using infected pigeon pea and healthy leaf samples by TRI Reagent (Sigma). Reverse transcription (RT)-PCR was carried out using primers specific to the coat protein (CP) gene of TSV (1). A product of the 700-bp DNA fragment was obtained in field-infected pigeon pea samples but not in healthy controls. The amplicon was cloned into PTZ57R/T using the Ins TA clone PCR kit (Fermentas). Recombinant clone was sequenced in both directions and the CP gene sequence obtained was deposited in GenBank (KF220492). Sequence analysis of the CP gene of TSV from pigeon pea shared 98 to 100% identity with Indian TSV isolates originating from different hosts including groundnut (FJ355948), mung bean (FJ749259), and sunflower (DQ864448), and 88 to 92% similarity with TSV type isolate (white clover: X00435) both at nucleotide and amino acid levels. TSV belongs to the genus Ilarvirus of family Bromoviride and has a wide host range. TSV is pollen borne, assisted by thrips causing mechanical injury (2). To our knowledge, this is the first report of TSV on pigeon pea in India and was widespread in Anantapuram, Kadapa, Kurnool, and Mahbubnagar districts of A.P. Yield loss depends on the stage of infection as early infection resulted in complete failure of the crop. TSV was prevalent on many legume crops such as black gram, green gram, and groundnut in A.P, Tamil Nadu, Karnataka, and Maharashtra states (3). TSV infection of pigeon pea may pose a serious implication for pulse production.

Use of variogram analysis to classify field peas with and without internal defects caused by weevil infestation

In this study, we acquired 72 (training data) and 30 (independent validation) high-spatial resolution (7 by 7 pixels per mm2) hyperspectral imaging data [240 spectral bands from 392 to 889nm (spectral resolution=2.1nm)] from samples of field peas (Pisum sativum) with and without pea weevil (Bruchus pisorum) infestation. The reflectance data were analyzed with linear discriminant analysis (LDA) or either reflectance values only or of a combination of reflectance values and variogram parameters (derived from variogram analysis) from a single spectral band (782nm). All examined classification models were assessed based on sensitivity (ability to positively detect infestation), specificity (ability to positively detect non-infestation), and accurate classification of 30 samples of independent validation data. Highest classification performance was obtained with a combination of reflectance values in two spectral bands (641nm and 868nm) and variogram parameters derived from 782nm. This classification model was associated with a sensitivity of 94.7% and a specificity of 100%. In addition, all 30 independent validation data were accurately classified (100%). For comparison, traditional linear discriminant analyses of 108,351 reflectance profiles from individual pixels in the 72 samples or average reflectance profiles from the 72 samples classified the validation data with 84.0% and 83.3% accuracy, respectively. We are unaware of any reflectance-based classification system, which – based on reflectance data acquired in only three channels (spectral bands) – can provide this level of sensitivity and specificity and classification of independent validation data of internal defects in food products. Accurate and reliable classification of food objects based reflectance values in only a few spectral bands would likely imply low computer processing requirements and rapid data analysis. Thus, we believe that the current classification method may be useful for quality control systems of a wide range of food products.

Characterization of the fungi associated with ascochyta blight of field pea in Alberta, Canada

Ascochyta blight, caused by a complex of Mycosphaerella pinodes, Phoma pinodella, Ascochyta pisi, and/or Phoma koolunga, is a devastating disease of field pea. In order to understand the composition of fungi associated with ascochyta blight in Alberta, Canada, a total of 157 single-pycnidiospore fungal isolates were obtained from diseased pea samples collected from central and northern Alberta in 2011. These isolates were characterized for species identity, aggressiveness, DNA sequence variation in the internal transcribed spacer (ITS) region, and random amplification of polymorphic DNA (RAPD) patterns. The ITS sequences obtained from 142 fungal isolates were all identical to the ITS sequences from M. pinodes and/or P. pinodella. Inoculation of the 157 isolates on a susceptible pea cultivar Midas indicated that most of the isolates were moderately to highly aggressive. Phylogenetic analysis based on the RAPD data revealed two main groups and six sub-groups, with one main group comprising 78% of the 157 isolates. Distinct RAPD patterns were associated with isolates from particular geographic locations, but were not generally associated with isolate aggressiveness.

Fatty acid profiling of the seed oils of some varieties of field peas (Pisum sativum) by RP-LC/ESI-MS/MS: Towards the development of an oilseed pea

Reversed-phase liquid chromatography coupled to negative-ion electrospray tandem mass spectrometry (RP-LC/ESI-MS/MS) was used to study the fatty acid profile from the oil of harvested field pea (Pisum sativum) varieties as part of a research project to develop this legume as a commercial oilseed for Canada. The seed oils from pea samples contained palmitic and stearic acids as major saturated fatty acids. Oleic, linoleic and linolenic acids were the major unsaturated fatty acids found. Small percentages of other long chain fatty acids were also detected. This profile suggests that the species of field pea investigated might have the potential to be used as raw materials to develop a future new oilseed crop for the food industry. Fatty acid extracts did not require further manipulation before final analysis by RP-LC/ESI-MS/MS, indicating the utility and relative simplicity of this technique for future screening studies.

PEA RESISTANCE TO POWDERY MILDEW

The results of the evaluation of breeding pea samples for resistance to powdery mildew are shown. Sources of resistance are recommended.

THE STUDY OF THE INHERITANCE OF EARLINESS OF RIPENQING OF PEA

«The number of infertile nodes» is a stable variety trait of pea plants, and it is directly related to the duration of the growing season. To study the manifestations of this trait in hybrid proge, nies the reciprocal crosses among pea samples of different groups of maturity have been made.

STUDY OF PERSPECTIVE MODELS OF PEA AS GENETIC SOURCES IN BREEDING FOR QUALITY AND PRODUCTIVITY

The green pea collection consisting of 277 samples varied in geographical distance, quantity, and quality traits was evaluated. The samples with agronomic valuable traits were selected. The starch grains in selected green pea samples were studied. The molecular analysis of these samples was conducted. The selected samples were used for the reciprocal crossing. The pattern inheritance of hybrids F1 was studied.

Development of Specific LC-ESI-MS/MS Methods to Determine Bifenthrin, Lufenuron, and Iprodione Residue Levels in Green Beans, Peas, and Chili Peppers Under Egyptian Field Conditions

The dissipation of bifenthrin, lufenuron, and iprodione was studied in green beans, peas, and chilli peppers under Egyptian field conditions. For this purpose, three specific and one multi-analyte liquid chromatography-electrospray ionization-tandem mass spectrometry methods were developed and validated according to SANCO guidelines for the determination of bifenthrin, iprodione, and lufenuron residues in the selected commodities. Sample preparation was carried out by the QuEChERs approach, and determination was performed in positive ionization mode for iprodione and bifenthrin and in negative mode for lufenuron. Optimization of the ionization parameters and the chromatographic conditions was performed for each method developed. All methods showed satisfactory performance criteria. Linear dynamic range, limits of detection (LOD) and quantification (LOQ), precision, recovery, and matrix effects were estimated, and the calculated LODs were in the micrograms-per-kilogram range, namely 0.14, 0.61, and 1.4 μg/kg for bifenthrin, lufenuron, and iprodione, respectively. Field trials were carried out in one of the biggest farms in Egypt (Blue Nile) that exports significant quantities of vegetables to the European Union (EU) countries. All the examined pesticides showed high degradation rates. The t 1/2 values for bifenthrin were 3.3, 2.1, and 9.6 days in green beans, peas, and chili peppers, respectively. For iprodione, they reached 2.4 and 14.4 days in green beans and peppers. Furthermore, the calculated pre-harvest interval (PHI) values, according to the maximum residue limits set by EU, were 0, 4, and 0 days for bifenthrin in green beans, peas, and peppers, respectively, and for iprodione, 2 days in green beans and 0 days in peppers. In case of lufenuron, no t 1/2 and PHI were estimated as no residues were found in all pea samples.

Ionic liquid‐based microwave‐assisted extraction for the determination of flavonoid glycosides in pigeon pea leaves by high‐performance liquid chromatography‐diode array detector with pentafluorophenyl column

In this study, an ionic liquid-based microwave-assisted extraction (ILMAE) followed by high-performance liquid chromatography-diode array detector with a pentafluorophenyl column for the extraction and quantification of eight flavonoid glycosides in pigeon pea leaves is described. Compared with conventional extraction methods, ILMAE is a more effective and environment friendly method for the extraction of nature compounds from herbal plants. Nine different types of ionic liquids with different cations and anions were investigated. The results suggested that varying the anion and cation had significant effects on the extraction of flavonoid glycosides, and 1.0 M 1-butyl-3-methylimidazolium bromide ([C4MIM]Br) solution was selected as solvent. In addition, the extraction procedures were also optimized using a series of single-factor experiments. The optimum parameters were obtained as follows: extraction temperature 60°C, liquid-solid ratio 20:1 mL/g and extraction time 13 min. Moreover, an HPLC method using pentafluorophenyl column was established and validated. Good linearity was observed with the regression coefficients (r(2)) more than 0.999. The limit of detection (LODs) (S/N = 3) and limit of quantification (LOQs) (S/N = 10) for the components were less than 0.41 and 1.47 μg/mL, respectively. The inter- and intraday precisions that were used to evaluate the reproducibility and relative standard deviation (RSD) values were less than 4.57%. The recoveries were between 97.26 and 102.69%. The method was successfully used for the analysis of samples of pigeon pea leaves. In conclusion, the developed ILMAE-HPLC-diode array detector using pentafluorophenyl column method can be applied for quality control of pigeon pea leaves and related medicinal products.