Diseased Plant Samples Research Articles

DNA‐based detection and quantification of Ascochyta rabiei in chickpea (Cicer arietinum) using droplet digital PCR

AbstractAscochyta blight (AB) disease, caused by the fungal pathogen Ascochyta rabiei, is a major production constraint in many chickpea‐growing regions worldwide, causing substantial reductions in grain yield and seed quality. The management of AB is challenging due to limited genetic resistance and the evolving aggressiveness of A. rabiei. Currently, there is a heavy reliance on visual assessment by expert pathologists for the detection and quantification of disease severity, and limited ability to impartially quantify pathogen growth and inoculum potential in the field. In this study, we address these gaps by developing a single‐copy genetic marker for the sensitive detection and quantification of A. rabiei mycelium and conidiospores. Using a droplet digital PCR (ddPCR) assay, our method provides a sensitive (≤5 × 10−2 pg DNA, 1 gene copy) approach to assess A. rabiei biomass throughout its lifecycle on living and dead plant tissues. The method (i) has specificity to A. rabiei in diseased plant samples; (ii) discriminates among chickpea cultivars with varying AB resistance prior to the onset of visible symptoms; (iii) detects differences in primary A. rabiei conidiospore inoculum load from field‐grown chickpea stubble; and (iv) has potential application to disease management, breeding and epidemiology.

First report of bacterial wilt caused by Clavibacter michiganensis subsp. michiganensis affecting tomato in Iğdır

Tomato wilt disease caused by Clavibacter mihiganensis subsp. michiganensis (Cmm) is one of the most destructive tomato diseases and causes significant crop loss in both greenhouse and field tomato production areas worldwide. In this study, the presence of the causal agent of bacterial wilt disease in tomato plants was investigated in Aras Valley. Isolation was made from diseased plant samples and it was determined whether the strains were pathogenic by cellulase activity and HR test. The virulence, morphological and biochemical characteristics of the strains were determined. Strains that fatty acid methyl ester extraction, isolation and purification were performed were identified at species and subspecies level with % similarity index using gas chromatography system. The diagnosis was confirmed with the Biolog Gen III System and all strains were identified at the subspecies level with a % similarity index. As a result of this study, 57 strains were obtained in the isolation, and 39 of the strains were determined not to be pathogenic. Strain 18 was determined as the pathogen causing the most damage to tomato plants with 100 % disease severity. Strains were identified as Cmm at subspecies level with a similarity index of 71-87 % using gas chromatography system and 54-75 % similarity index with Biolog Gen III System. According to the heat map created, it was determined that the strains consisted of two main clusters. The presence of pathogen in Aras Valley was proved for the first time by this study.

PRIMER REPORTE DE Macrophomina pseudophaseolina ASOCIADO A LA PUDRICIÓN DE RAÍZ EN CHILE APAXTLECO NATIVO (Capsicum annuum L.) EN GUERRERO, MÉXICO

<p><strong>Background.</strong> Chili is an important crop for Mexican culture. <strong>Objective. </strong>To identify the pathogen associated with the causal agent of root rot in a native chili pepper Apaxtleco in Guerrero, Mexico. <strong>Methodology.</strong> Root samples of diseased plants were taken from a chili plot in Apaxtla, Guerrero, and were taken to the Phytopathology Laboratory, at Colegio Superior Agropecuario del Estado de Guerrero (CSAEGRO), México. Subsequently, 1 cm root sections were made from healthy and diseased tissue, which were disinfected with 3% sodium hypochlorite for 1 min, and washed three times with sterile distilled water for 1 min, and dried with sterile absorbent paper, later, moistened sterilized paper was placed in the Petri dish and moistened with sterile distilled water and two slides were placed on it arranged in the shape of a cross and at each end of the slides and in the center of these, a piece of previously disinfected root was placed. The plates were kept at 28 °C ± 2 °C for 168 h. The purification of the pathogen was carried out using the hyphal tip and the identification was morpho-molecular. <strong>Results.</strong> The causal agent of root rot in Apaxtleco native chili plants was <em>Macrophomina pseudophaseolina</em>. <strong>Implications.</strong> Our result reveals the opportunity to improve the control of this pathogen at Guerrero, Mexico. <strong>Conclusion.</strong> <em>M. pseudophaseolina</em> causing root rot, in Apaxtleco native chili is reported for the first time.</p>

Multiplex PCR specific for genus Phytophthora and P. nicotianae with an internal plant DNA control for effective quarantine of Phytophthora species in Japan

To prevent threats from pathogens such as Phytophthora species from international plant trade, molecular identification techniques are needed for rapid, accurate quarantine inspection. Here, for quarantine control in Japan, we developed a simple DNA extraction for plants and a practical detection method that combines multiplexed PCR using primers specific for Phytophthora species, for P. nicotianae, which is the only non-quarantine Phytophthora species, and as internal controls, for plants. For the new genus-level primer set, we modified previously reported genus-specific primers to improve detectability. The new primers were able to detect mycelial DNA of 155 taxa among Phytophthora clades 1–10, with a sensitivity of 100 fg/µL for three representative species, P. ramorum, P. kernoviae and P. nicotianae. In the PCRs using DNA from non-target species, amplification was observed for only three taxa, and for some strains, four taxa in a closely related genus. Duplex and triplex PCR of the genus-specific primers combined with previously reported plant primers verified the success of DNA extraction and PCR detection from diseased plant samples, and in the triplex PCR, whether the pathogen was diagnosed as P. nicotianae or not by the species-specific primer. The new method detected the pathogen in naturally infected and inoculated plants. The amplicons using the genus-specific primer have enough variation to be sequenced to identify the species. This new method can be used immediately for detecting Phytophthora species and for quarantine control in Japan.

FIRST REPORT OF CURVULARIA LUNATA AND ALTERNARIA ALTERNATA CAUSING LEAF BLIGHTS ON TOMATOES IN SINDH, PAKISTAN

The tomato is an economically important crop that grows worldwide. The numerous fungal pathogens attacking tomato crops and causing severe diseases lead to yield loss. A few studies conducted regarding the identification of tomato fungal pathogens in Pakistan. However, no report was found to identify the fungal pathogens of tomato crops grown in Sindh. This study aimed to isolate, identify and characterize the tomato fungal pathogens in District Kamber Shahdadkot. Subsequently, thirty diseased tomato plant samples (leaves & stems) were collected from distinct villages of Taluka Kamber District Kamber Shahdadkot. These samples were collected in polythene bags and marked with symbols like S1, S2 and so on (S=Sample). All samples were brought into Botany Department lab and CBC Shah Abdul Latif University Khairpur. PDA media was prepared, sterilized and poured into petri plates. Prior to the inoculation, pieces from samples were soaked in a 1% solution of sodium hypochlorite (NaOCl) for a minute. The petri plates were inoculated separately and incubated at natural room temperature (260C to 280C) for arising and growth. Three days later, the inoculation site manifests signs and symptoms of fungal development. Within a week fungus reached at preferable growth and spores were formed. Two slides from each petriplate were prepared i. e. one from the center of the cultures and other from the margins of the cultures. In order to finish this application, slide-sized scotch tape was cut up and immersed on the surface of cultures gently. The off cuts of the scotch tap introduced the fungal materials (mycelia and spores), which were pressed with love to the glass slides and observed. The fungi identification was made by using applications of morphological characteristics like morphology of the cultures, nature, and type of the mycelium, the shape of spores, and the color of the spores. Following these characters two fungal species were identified i. e. Curvularia lunata and Alternaria alternata

Occurrence of Pseudomonas cichorii Causing Midrib Rot of Lettuce Under Hydroponic Cultivation in Chile

In Chile, lettuce is the vegetable that has increased in cultivated area the most in recent years, reaching 8,309 ha. The Coquimbo Region contributes the most to this growth in production with 3,284 ha in 2022 (ODEPA 2023). Most lettuce is grown under open field conditions, but there is significant production in greenhouses and an increase in hydroponic production systems (INIA 2017). During April to June 2021 and 2022 in the Coquimbo Region, butterhead-type lettuce seedlings (Lactuca sativa) cv. Neil, cultivated under a hydroponic system, showed severe brown to black lesions in the leaves and midrib (Figure S1). To determine the etiology of this problem, samples of diseased plants were taken. Pieces of symptomatic tissue were macerated, and the extract was spread on nutrient agar (NA) and on King's B medium (KB) and incubated at 23°C for 48 h. The bacterial colonies observed were predominantly circular, creamy-white in color with irregular margins and fluorescent in KB medium. Isolates were gram-negative strictly aerobic. LOPAT test (Lelliot et al. 1966) results of two selected isolates were: levan production (-), oxidase reaction (+), potato soft rot (-), arginine dihydrolase production (-), and tobacco hypersensitivity (+), which corresponds to the profile of Pseudomonas cichorii. Molecular identification was performed through amplification and sequencing of the 16S rRNA (GenBank Accessions No. OR540674 to OR540675), gyrB and rpoD genes (Hwang et al. 2005; Sarkar and Guttmann 2004) (GenBank Accessions No. OR558279 to OR558282). BLAST analysis of the 16S rRNA gene of the isolates resulted in a match with a 99.86% identity with P. cichorii type strain ATCC 10857 (NR_112070.1). BLAST analysis of gyrB and rpoD resulted in a match with a 100% (630/630 bp) and >99% (546/550 bp) identity respectively, with strains of P. cichorii. Five six-month-old lettuce plants cv. Desert Storm were pricked in the midrib with a toothpick smeared with a fresh colony grown on KB medium. Seven days after inoculation, the plants showed dark brown, watery lesions, characteristic of damage caused by P. cichorii (Figure S1). Bacteria were isolated again from the inoculated plants and were identified as P. cichorii using LOPAT and molecular identification techniques. Midrib rot caused by P. cichorii was reported as an emerging disease of greenhouse-grown lettuce by Cottyn et al. (2009). In Chile, P. cichorii was previously described affecting nectarine fruits (Pinto de Torres and Carreño Ibañez 1983) and reported as a pathogen of lettuce among others horticultural crops by Servicio Agrícola y Ganadero of the Government of Chile (Acuña 2008), but this is the first report of P. cichorii affecting hydroponic lettuce plants in Chile. These results will be the basis of future studies to evaluate the origin of the infection, the potential dissemination, and the implementation of disease management to avoid the damage caused by this bacterium in hydroponic systems in this crop of growing importance in Chile.

Enhanced disease detection through image fusion in solanum tuberosum l.

Disease detection in agricultural crops, such as Solanum tuberosum L. (potato), is of utmost importance to ensure crop health and maximize yield. Traditional methods for disease detection in potatoes rely on manual inspection, which can be time-consuming and prone to human error. Image processing and machine learning techniques have shown promise in automating disease detection processes. This study proposes a novel approach for disease detection in Solanum tuberosum L. by leveraging image fusion techniques. The proposed method involves the fusion of multiple images of potato plants, acquired using different sensors or imaging modalities, to create a comprehensive and informative representation of the crop. Image fusion methods, such as discrete wavelet transform and continuous wavelet transform, are employed to combine the spectral and spatial information from the images effectively. The different image fusion rule is applied to the input images and resultant fused images, where relevant features are extracted to distinguish between healthy and diseased potato plants. The training dataset comprises diverse samples of both healthy and diseased potato plants, captured under various environmental conditions and disease stages. The performance of the proposed disease detection system is evaluated using standard metrics such as entropy. The results demonstrate the effectiveness of the image fusion approach in accurately identifying diseased potato plants, achieving high detection accuracy and generalization capabilities. The potential benefits of this paper include providing farmers and agricultural experts with an efficient and reliable tool for early disease detection in potato crops. Early detection can lead to timely intervention, minimizing crop losses and optimizing agricultural practices. The proposed methodology also lays the groundwork for future research in using advanced image processing techniques and machine learning algorithms for disease detection in other agricultural crops, contributing to the overall improvement of crop management and food security.

Genetic diversity and pathogenicity of fungi associated with rice sheath rot in the Fogera plain, Northwest Ethiopia

AbstractSheath rot is a widespread rice disease that affects rice crops worldwide. It is particularly prevalent in Ethiopia, with the Fogera plains exhibiting the highest incidence and severity. However, the lack of reliable molecular‐level identification of rice fungal pathogens in Ethiopia has hindered the development of effective management practices. This study aimed to assess the diversity of fungal agents causing sheath rot disease in rice crops around the Fogera plains, Ethiopia, using both morphology and nucleotide sequences of the ITS1 rDNA region. Additionally, the pathogenicity of the isolates was evaluated using attached tiller assay methods. A total of 16 fungal isolates were recovered from diseased plant samples. Among these, five species; Phoma spp., Phoma herbarium, Epicoccum sorghinum, Epicoccum lantuscollum and Microdochium seminicola were identified and reported as new records of sheath rot disease in rice. The predominant genus was Phoma (75%) followed by Epicoccum (18.75%). The pathogenicity caused by E. sorghinum was particularly severe and significantly different from the symptoms caused by other isolates, resulting in a mean lesion length of 167.7 mm and a disease severity of 55.7%. These findings suggest that E. sorghinum is the most important rice pathogen in the region. Our results have identified the most predominant and pathogenic fungal species associated with sheath rot disease in the region. Importantly, this study marks the first report of sheath rot‐causing fungi identified in rice using the ITS rDNA‐sequencing technique in Ethiopia. Therefore, this research may contribute to the development of fungal disease management strategies in rice and provide evidence to initiate a rice breeding program focused on developing sheath‐rot‐resistant rice varieties.

First Report of Fusarium Root Rot of Tobacco Caused by Fusarium fujikuroi in Guangdong Province, China.

From March to June 2022, Fusarium tobacco root rot broke out in Shaoguan Guangdong Province, China, affecting approximately 15% of tobacco production fields, with an incidence of 24% to 66%. In the early stage, the lower leaves showed chlorosis, and the roots became black. In the later stage, the leaves became browned and withered, the root cortices were broken and shed, and only a small number of roots were left. Eventually, the entire plant died. Six diseased plant samples (cv. yueyan 97) from Shaoguan (113.8°E, 24.8°N) were collected as test materials. The diseased root tissues (4×4 mm) were surface-sterilized using 75% ethanol for 30 s and 2% NaOCl for 10 min, rinsed 3 times with sterile water and incubated for 4 days on potato dextrose agar (PDA) medium at 25 °C. Fungal colonies were subcultured on fresh PDA, grown for the next 5 d and purified by single-spore separation. Eleven isolates with similar morphological characteristics were obtained. Their colonies were white and fluffy, and the bottoms of the culture plates were pale pink after 5 days of incubation. The macroconidia were slender, slightly curved and measured 18.54~45.85 µm×2.35~3.84 µm (n=50), with 3 to 5 septa. The microconidia were oval or spindle shaped, with one to two cells, and measured 5.56~16.76 µm×2.32~3.86 µm (n=50). Chlamydospores were absent. Such characteristics are typical of the genus Fusarium (Booth C, 1971). The SGF36 isolate was chosen for further molecular analysis. The TEF-1α and β-tubulin genes (Pedrozo et al.2015) were amplified. Based on a phylogenetic tree (neighbor-joining method and 1,000 bootstrap values) obtained using multiplex alignments of concatenations of these two genes from 18 Fusarium species, SGF36 was grouped into a clade with Fusarium fujikuroi strain 12-1 (MK443268.1/MK443267.1) and F. fujikuroi isolate BJ-1 (MH263736.1/MH263737.1). To further identity the isolate, five additional gene sequences (rDNA-ITS (OP862807.1), RPB2, histone 3, calmodulin, and mitochondrial small subunit) (Pedrozo et al.2015), were subjected to BLAST searches in GenBank, and the results indicated that they were most similar to F. fujikuroi sequences, with sequence identities greater than 99%. The phylogenetic tree obtained using six genes except mitochondrial small subunit gene showed that SGF36 was grouped together with four F. fujikuroi strains to form a single clade. Pathogenicity was determined by the inoculation of wheat grains with fungi in potted tobacco plants. The SGF36 isolate was inoculated onto sterilized wheat grains, which were then incubated at 25 °C for 7 d. Thirty wheat grains with fungi were added to 200 g of sterilized soil, which was then mixed well and placed into pots. One six-leaf-stage tobacco seedling (cv. yueyan 97) was planted in each pot. A total of 20 tobacco seedlings were treated. Another 20 control seedlings were treated with wheat grains without fungi. All seedlings were placed in a greenhouse at 25 °C with 90% relative humidity. After 5 d, the leaves of all inoculated seedlings showed chlorosis, and the roots became discolored. No symptoms were observed in the controls. The fungus was reisolated from symptomatic roots and confirmed to be F. fujikuroi based on the TEF-1α gene sequence. No F. fujikuroi isolates were recovered from control plants. F. fujikuroi was previously reported to be associated with rice bakanae disease (Ram et al., 2018), soybean root rot (Zhao et al., 2020) and cotton seedling wilt (Zhu et al., 2020). To our knowledge, this is the first report of F. fujikuroi causing root wilt on tobacco in China. The identification of the pathogen may help to establish appropriate measures for controlling this disease.

Prevalence and pathogenicity of fungi associated with grapevine trunk diseases in Jordan

Grapevines (Vitis vinifera) are important fruit producers in Jordan, and grapevine trunk diseases (GTDs) are suspected to cause problems in many Jordanian vineyards. This study aimed to estimate GTDs incidence and severity in selected vineyards, and to isolate and identify the causal agents associated with GTDs in this country. Field surveys were carried out and representative samples of diseased vines showing GTDs symptoms were collected to isolate and identify the causal organisms. Molecular analyses of DNA sequences of the Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) were used to confirm the morphological identifications of the fungal isolates. GTDs were present in all the surveyed vineyards. Mean GTD incidence was 44% across all the fields evaluated, ranging from 9 to 69% in individual vineyards. Disease severity ranged from 52–74% (mean = 62%) across all vineyards and locations. A total of 325 fungal isolates were recovered from infected grapevines. The most prevalent pathogens identified were those associated with Botryosphaeria dieback, including Diplodia seriata, Lasiodiplodia theobromae and Neofusicoccum parvum, followed by the Esca disease pathogens Phaeoacremonium parasiticum, P. aleophilum, P. rubrigenum, and Fomitiporia spp. Ilyonectria liriodendri and I. spp., known to be associated with black foot of grapevines, were also isolated. Plant pathogens causing vascular wilts and root rots, including Fusarium proliferatum, F. oxysporum, Verticillium spp., and Rhizoctonia solani, were also identified from diseased plant samples, and were found in mixed infections with GTDs pathogens. Most of the identified pathogens, except those associated with vascular wilt and root rot, are reported for the first time in Jordan. Results of this study indicate that GTDs are widespread in Jordan, and that there is urgent need to adopt a “national strategy” for GTD management in this country.

CoffeeNet: A deep learning approach for coffee plant leaves diseases recognition

Coffee is regarded as the highest consumed drink around the globe and has accounted as a major source of income in the regions where it is cultivated. To meet the coffee marketplace's requirements around the globe, cultivators must boost and analyze its cultivation and quality. Several factors like environmental changes and plant diseases are the major hindrance to increasing the yield of coffee. The development in the field of computer vision has facilitated the earliest diagnostic of diseased plant samples, however, the incidence of various image distortions i.e., color, light, size, orientation changes, and similarity in the healthy and diseased portions of examined samples are the major challenges in the effective recognition of various coffee plant leaf infections. The proposed work is focused to overwhelm the mentioned limitations by proposing a novel and effective DL model called the CoffeeNet. Explicitly, an improved CenterNet approach is proposed by introducing spatial-channel attention strategy-based ResNet-50 model for the computation of deep and disease-specific sample characteristics which are then classified by the 1-step detector of the CenterNet framework. We investigated the localization and cataloging outcomes of the suggested method on the Arabica coffee leaf repository which contains the images captured in the more realistic and complicated environmental constraints. The CoffeeNet model acquires a classification accuracy number of 98.54%, along with an mAP of 0.97 that is presenting the usefulness of our technique in localizing and categorizing various sorts of coffee plant leaf disorders.

Multilocus Sequence Analysis and Detection of Copper Ion Resistance of Xanthomonas phaseoli pv. manihotis Causing Bacterial Blight in Cassava.

Cassava (Manihot esculenta Crantz) is an important tropical tuber crop around the world. Cassava bacterial blight, caused by Xanthomonas phaseoli pv. manihotis, is a key disease that influences cassava production worldwide. Between 2008 and 2020, 50 X. phaseoli pv. manihotis strains were isolated from diseased plant samples or acquired from China, Uganda, Cambodia, Colombia, Malaysia, and Micronesia. Using multilocus sequence analysis, the genetic diversity of X. phaseoli pv. manihotis strains was evaluated. A neighbor-joining phylogenetic dendrogram was constructed based on partial sequences of five housekeeping genes (atpD-dnaK-gyrB-efp-rpoD). The strains clustered into three groups whose clusters were consistent with atpD and RpoD gene sequences. Group I contained 46 strains from China, Uganda, Cambodia, and Micronesia, and the other two groups were comprised of strains from Colombia and Malaysia, respectively. The resistance of all these strains to copper ion (Cu2+) was determined, the minimal inhibitory concentration was between 1.3 and 1.7 mM, and there was no significant difference between strains from different geographic region. During genome annotation of the X. phaseoli pv. manihotis strain CHN01, homologous gene clusters of copLAB and xmeRSA were identified. The predicted amino acid sequences of two gene clusters were highly homologous with the copper-resistant protein from Xanthomonas strains. CopLAB and xmeRSA were amplified from all these strains, suggesting that the regulation of copper resistance is associated with two distinct metabolic pathways. CopLAB and xmeRSA were highly conserved among strains from different geographic regions, possibly associated with other conserved function.

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) μm, body width (BW) = 433.73 ±12.84 (343.71-551.61) μm, stylet length = 15.64 ± 1.45 (10.86-28.26) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) μm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) μm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) μm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) μm, BW = 33.60 ± 0.79 (30.21-36.52) μm, stylet length = 23.63 ± 0.78 (20.14-26.37) μm, DGO = 3.04 ± 0.09 (2.69-3.38) μm, spicule length = 25.72 ± 0.57 (23.97-28.33) μm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) μm, BW = 15.14 ± 0.26 (13.91-16.66) μm, stylet length = 13.44 ± 0.29 (10.96-14.60) μm, DGO = 2.13 ± 0.18 (1.22-3.10) μm, tail length = 57.46 ± 4.89 (38.85-101.33) μm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) μm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

Leaf spot on Alocasia macrorrhizos caused by Fusarium asiaticum in Sichuan, China.

Alocasia macrorrhizos (Giant elephant's ear), a perennial herb in the Araceae family, is native to South Asia and the Asia-Pacific (Takano, et al. 2012). It is cultivated as a medicinal and ornamental plant, and has a considerable economic importance in China. In September 2020, a severe infection of unknown leaf spot disease was observed on these plants at the Sichuan Agricultural University, Sichuan, China. The leaf spots first appeared as yellow dots. As these lesions expanded, they became circular to oval and light brown with darker brown edges. Around the lesions, the leaf tissue was chlorotic, thereby creating a yellow halo. When the infection became severe, spots merged into larger irregular lesions. Eventually, the diseased leaves senesced and dried. To identify the pathogen, five leaf samples of diseased plants were collected, and symptomatic tissues were surface-disinfected with 75% ethanol for 30 s followed by 3% NaCl solution for 30 s. Samples were rinsed three times in sterilized water, placed on potato dextrose agar (PDA), and incubated at 25°C ± 1°C in the dark. The colony grown on PDA was white (3 days), the center was brown (5 days), turned pink to dark red (8 days) with fluffy aerial mycelium and pigmentation with age. Ten pure cultures were inoculated into carnation leaf agar (CLA) medium and incubated at 25°C in an incubator (12 h for one light-dark cycle). In CLA medium, pathogen produced hyaline, sickle-shaped, macroconidia with 3 to 5 septa, and an average size of 30 to 50 × 4 to 5 µm (n = 30) macroconidia but no microconidia in 10 days. Chlamydospores were spherical to subspherical (5.4 to 13.8 µm). Morphological characteristics of the all isolates were consistent with the description of the Fusarium asiaticum (Leslie and Summerell 2006). To validate this identification, RNA polymerase II (RPB2) (Liu et al. 1999), translation elongation factor (EF-1) (Geiser et al. 2004), and β-tubulin (TUB2) gene region of five isolates were amplified and sequenced (O' Donnell et al. 2015; White et al. 1990). The sequence of one representative isolate (ZL10) sequence was submitted to GenBank (ON215729, ON215730, and ON215731). The NCBI BLAST identified the top hits, 100%, 100%, and 99.87% for RPB2, EF, and TUB gene sequences, respectively, all indicating to Fusarium asiaticum. Pairwise matched of RPB2 and EF genes by MycoBank Fusarium MSIL showed the top hit rate of 100% for F. asiaticum (MH582120 and MH582249). For Koch's postulate and pathogenicity test, spore suspensions (1 × 10^7 conidia/ml) collected from PDA and CLA cultures with 0.05% Tween 80 buffer were used to inoculate with a spray bottle on leaves of a one year old A. macrorrhizos plants. Two leaves of each plant (20 pots in total) were inoculated with the spore suspension (approximately 2000 µl per leaf). An equal number of control leaves were applied with water and 0.05% Tween 80 buffer. Twenty days later, the inoculated plants showed similar symptoms to those of the original diseased plants while the controls remained asymptomatic. Fusarium asiaticum was reisolated from the infected leaves and confirmed using morphological characteristics and DNA sequence analysis. The pathogenicity test was repeated three times with similar results. This first report raises awareness of a new leaf spot disease infecting a commercial A. macrorrhizos in China. It provides an insight for a need of systematic survey identifying current spread, disease origin, and ultimately developing disease management strategies. Funding: Funding was provided by Sichuan Agricultural University Subject Dual Support Program (Grant No. 2121993055). Funding was provided by Deyang Science and Technology Bureau (Sichuan Province) for key R&D projects in agriculture and rural areas (Grant No. 2021NZ048). Funding was provided by the Sichuan Provincial Department of science and technology for the Sichuan Provincial Science and technology project for connecting and Promoting Rural Revitalization (Grant No, 2022ZHXC0007) References： Geiser, D. M., et al. 2004. Eur. J. Plant Pathol. 110:473. https://doi.org/10.1023/B:EJPP.0000032386.75915.a0 Crossref, ISI, Google Scholar Leslie, J. F., and Summerall, B. A., eds. 2006. Page 176 in The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA. https://doi.org/10.1002/9780470278376 Liu, Y. J., et al. 1999. Mol. Biol. Evol. 16:1799. https://doi.org/10.1093/oxfordjournals.molbev.a026092 O'Donnell, K., and Cigelnik, E. 1997. Mol. Phylogenet. Evol. 7:103. https://doi.org/10.1006/mpev.1996.0376 Takano K T, et al. 2012, Plant Bio., 14(4). https://doi.org/10.1111/j.1438-8677.2011.00541.x.

Effect of Shade on the Severity of Moko (Ralston Solanacearum) on Guineo (Musa Balbisiana ABB)

The cultivation of Musaceae (Musaceae) in Nicaragua has been an area of good profitability and acceptable production rates, representing a promising product in the department of Rivas and in some areas of the country. This crop has been threatened by this disease (Moko) that affects the plant and its fruits. This research was conducted from March 2014 to March 2015, in a Taungya system, to describe the main symptoms of damage and calculate the incidence, severity and ABCPE (Area Under the Disease Progress Curve). Sampling was carried out every fifteen days; for the rapid field test, samples of diseased or symptomatic plants of the causal agent were taken and eliminated; the pathogen data was collected through visual monitoring in the field; the laboratory diagnosis was carried out at the Institute of Agricultural Protection and Health (IPSA). As a result of the study, Ralstonia solanacearum associated with the guineo crop was identified as a pathogen of economic importance. The severity of this causal agent reflected a similar behavior in the guineo (8%) and oak (9%) blocks, followed by cedro, pochote and caoba in ranges of 13% to 19%. In the Melina and Teca experimental blocks, vascular wilt symptoms occurred in percentages of 24% to 26% with a pathogen advance per day R²=0.05 per day.

First report of a ‘Candidatus Phytoplasma australasia’‐related strain (16SrII‐D) associated with crown choking of areca palm in India

Areca palm (Areca catechu) is an economically important crop that is grown primarily in South Asia and South India, mainly in the states of Karnataka, Kerala and Maharashtra. With 0.73 million hectares cultivated and 1.2 million tonnes produced, India ranks first in world areca nut production. The state of Karnataka alone accounts 80% of annual production in India. During January 2021, crown choking symptoms (locally named “Hidimundige”), which resemble phytoplasma symptoms were observed on areca palm plantations. The highest disease incidence (50%) was recorded in Ajjarani, Sirsi Taluk and Uttara Kannda, followed by 30% in Haralakatta, Channagiri Taluk, Davanagere, Kelaginuru and Honnavara Taluk, in the district of Uttara Kannada (Karnataka state). The lowest disease incidence was 1% for the Dakashina Kannada and Tumkur districts in Karnataka.The most prominent symptom in infected palms was short, dark green leaves with a wavy leaf lamina. Leaflets failed to unfold properly leading to a bunchy top or witches’ broom appearance, and became crinkled and brittle. Reduced internodal length, drying of inflorescences and tapering of stem at the apex were also recorded. The roots became black, crinkled and brittle, and a pinkish or brownish discoloration was observed in the phloem. Affected plants failed to produce new leaves and existing leaves fell leading to a bare stem and death of the plant in quick succession (Figs. 1-3). About 80–100% of the plants died in affected areas. Seven leaf samples were collected from diseased palms growing in the Zonal Agricultural & Horticultural Research Station, Keladi Shivappa Nayaka University of Agricultural and Horticultural Sciences in Shivamogga, Karnataka (Latitude: 13° 55' 47.748“. Longitude: 75° 34' 5.1636”) during March 2022. Typical phytoplasma pleomorphic bodies lacking cell walls were seen in the sieve tube cells of leaf midrib sections from diseased areca palms, when examined by transmission electronic microscopy (Spurr, 1969) at the Sri Sai Histology Center, Hyderbad India (Fig. 4). The phytoplasma cell sizes ranged from 500 - 2000 nm. Seven leaf and three inflorescence samples from diseased palms and two leaf samples from asymptomatic palms were collected from the same location. Total DNA was extracted by the CTAB method and subjected to direct PCR using primers P1 (Deng & Hiruki, 1991) and P7 (Schneider et al., 1995) and nested PCR with R16F2n/R16R2 primers (Gundersen & Lee, 1996) that amplify the phytoplasma 16S rRNA gene. The expected direct (1.8 Kb) and nested (1.25 Kb) PCR products were obtained from all the diseased plant samples and positive reference controls but not from the symptomless plants. The R16F2n/R2 PCR products were cloned and sequenced directly at Biokart Pvt. Ltd., Karnataka, India, and the sequence deposited in GenBank (Accession No. ON606488). The R16F2n/R2 sequence was subjected to BLAST analysis and showed the highest nucleotide identity (99.92%) with 16SrII phytoplasma isolates, ‘Candidatus Phytoplasma aurantifolia’ (MT555412, MT555411) identified in Croton bonplandianus in Maharashtra, India. Virtual RFLP analysis of the R16F2n/R2 sequence with iPhyClassifier yielded an RFLP pattern identical to that of the 16Sr group II, subgroup D (Y10097) with a similarity coefficient of 1.00. Phylogenetic analysis (MEGA 7.0.18) using the neighbour-joining algorithm with selected phytoplasma reference strains confirmed that the areca palm phytoplasma clustered within the clade of phytoplasma strains of the 16SrII group (Fig. 5). In India, the cultivation of areca nut is mostly limited to the states of Assam, Karnataka and Kerala, and palms in these areas are affected by a yellowing disease named yellow leaf disease (YLD). YLD is one of the most important diseases of this palm species (Nambiar, 1949) and it is associated with the 16SrXI phytoplasma group, ‘Ca. P. oryzae’. (Chaithra et al., 2014). ‘Ca. P. aurantifolia’ is known to infect several plant species in India (Rao et al., 2017). However, this is the first report of a ‘Ca. P. aurantifolia’- related strain causing crown choking of Areca catechu in India. The impact of crown choking on areca nut yield, the geographic distribution of the disease and its epidemiological implication in India are currently under investigation.

Morphological and Molecular Identification of Fungi Associated with Sesame Diseased Plants of the Three Agroclimatic Zones of Burkina Faso

Sesame is Burkina Faso’s second essential agricultural export after cotton. It’s consequently a supply of income for producers and foreign exchange for the country. However, sesame production is characterized by low average yields of about 538 kg·ha-1 at the farmer’s field as compared to the potential yield of the improved varieties (1500 - 2000 kg·ha-1). Fungal diseases are some of the major constraints to sesame production in Burkina Faso. The present study contributes to the development of means to control pathogenic fungi of this crop, which are responsible for significant losses. The objective is to identify the fungi associated with diseased sesame plant samples. To this end, 149 samples of diseased sesame plants were collected from different production sites located in three agro-climatic zones of the country. The analysis of the samples according to the blotting paper method, based on the morphological characteristics of the fungi, allowed the identification of 18 genera with prevalence rates from 2.68% to 97.98%. The most frequently identified genera were Macrophomina (97.98%), Cercospora (86.57%), Fusarium (85.23%), Phoma (62.41%) and Colletotrichum (61.07%). The results also showed a variable distribution of fungi according to the agro-climatic zone with the predominance of Macrophomina in all three zones. Molecular identification by DNA sequencing of 120 isolates belonging to the different fungi detected allowed the identification of 25 species of which the most representative were Macrophomina phaseolina, Cercospora sesami, Corynespora cassiicola, Alternaria simsimi, Alternaria porri, Fusarium oxysporum, F. fujikuroi, F. equiseti, Colletotrichum capsici, and C. gloesporiodes. The present study showed that diseased sesame plants collected from different production sites in Burkina Faso housed several species of fungi. The fungi presence in diseased plants indicates the need to inform and raise the stakeholders’ awareness about the phytosanitary problems of sesame, but also to develop effective and appropriate control methods against these crop pathogens in Burkina Faso.

¿Cómo tomar muestras?

Abstract This factsheet for farmers in Nicaragua provides information on how to collect samples of diseased plants to take to the plant clinics. It includes photos as examples of samples of damaged plants parts. FUNICA, Global Plant Clinic

POST-HARVEST DISEASES IN INDRALAYA DISTRICT, SOUTH SUMATRA

The agricultural sector, especially in Indonesia, is always faced with problems from various factors that can reduce the productivity of a plant. One of these factors is the presence of attacks from plant-disturbing organisms. The method used in this research is by using a purposive sampling method. Samples of diseased plants were observed and taken for observation in the Phytopathology Laboratory, Plant Protection Study Program, Faculty of Agriculture, Sriwijaya University. From the observations that have been made, it was found that many chili plants were attacked by Colletotrichum Rot disease Erwinia caratovora in carrots, anthracnose in oranges and bananas, anthracnose in mangoes, and papayas. Many postharvest diseases found in plants in Indralaya are caused by pathogens in the form of fungi and bacteria.

First Report of Fusarium Sheath Rot of Rice Caused by Fusarium incarnatum-equiseti Species Complex in the United States.

Fungal diseases, including sheath rot (Sarocladium oryzae), cause significant losses of yield and milling quality of rice (Oryza sativa). In August 2021, symptoms like sheath rot were observed on 20% of rice plants (cv. Presidio) in 1-hectare field in Eagle Lake, Texas. Initial lesions occurred on the upper flag leaf sheaths and were oblong or irregular oval, with gray to light brown centers, and a dark reddish-brown diffuse margin. Lesions enlarged, coalesced, and covered a large area of the sheath. Infection led to panicle rot with kernels turning dark brown. Unlike sheath rot, sheath infection also led to inside culm infection with irregular dark brown lesions. Infected tissue pieces were sterilized with 1% NaOCl for 2 min, followed by 75% ethanol for 30 s, washed in sterile H2O three times, air dried and incubated on PDA at 27℃. Fungal isolates were obtained from 15 diseased plant samples and their singled-spored fungal colonies were whitish, loosely floccose and produced light yellow pigmentation. On carnation leaf agar, macroconidia were slightly curved and tapered at the ends, with 3 to 5 septa, and measured 17.5 to 34.3 × 3.1 to 5.0 µm. Microconidia were ovoid, usually with 0 to 1 septum and were 4.0 to 15.5 × 2.5 to 4.5 µm. Spherical shaped chlamydospores were produced in chain. These morphological characteristics were consistent to those described for Fusarium incarnatum-equiseti species complex (O'Donnell et al. 2009), including F. incarnatum (Wang et al. 2021) and F. equiseti (Avila et al. 2019). For molecular identification, DNA of a representative isolate was extracted and ITS, LSU, and EF1 of the fungus were amplified using the primers of ITS1/ITS4 (Wang et al. 2014), D1/D2 domain region of LSU (Fell et al. 2000), and EF1 (Wang et al. 2014), respectively, and sequenced. The ITS sequence (OL344049) was 99.61% identical to F. incarnatum-equiseti species complex (FD_01692) in Fusarium-ID database and 99.61% identical to F. equiseti (LC514690, KY523100, MW016539) and F. incarnatum (MH979697) in NCBI database. The LSU sequence (OK559512) was 98.77% similar to F. equiseti (MN877913, MN368509) and F. incarnatum (MH877332, MH877326); the EF1 sequence (OK570044) was 99.27% similar to F. equiseti (MK278902) in NCBI database. A phylogenetic analysis based on the concatenated nucleotide sequences grouped this isolate in the F. incarnatum-equiseti species complex clade at 100% bootstrap support. To evaluate pathogenicity, a conidial suspension of 1 x 106 conidia/ml or sterilized water (the controls) was injected into the sheaths and young panicles of three rice plants (cv. Presidio) at boot. Treated plants were maintained in a greenhouse at 25 to 30℃. After 3 weeks, typical symptoms, like those observed in the field, developed on the inoculated plants but not on the controls. The same fungus was consistently re-isolated from the diseased plants. To our knowledge, this is the first report of Fusarium sheath rot caused by F. incarnatum-equiseti species complex in rice in the U. S. F. incarnatum-equiseti species complex has been reported to be associated with panicle infection in wild rice (O. latifolia) in Brazil (Tralamazza et al. 2021). F. incarnatum has also been reported to cause panicle rot in China (Wang et al. 2021). F. proliferatum has been reported to cause Fusarium sheath rot in India (Prabhukarthikeyan et al. 2021) and the U. S. (Cartwright et al. 1995). This research demonstrates the potential of different pathogens being involved in causing sheath rot of rice.