Rupestris Stem Pitting Research Articles

РЕАЛИЗАЦИЯ ПРИОРИТЕТНЫХ НАПРАВЛЕНИЙ НАУЧНО-ТЕХНИЧЕСКОЙ ДЕЯТЕЛЬНОСТИ «ВННИИВиВ «МАГАРАЧ» РАН» В ОБЛАСТИ ВИНОГРАДАРСТВА В 2023 ГОДУ

Research is presented that contributes to an increase in the production of domestic grape and wine products, including in the system of organic farming. The object of research is grapes of native, classical and breeding varieties. The research was carried out on the basis of the Center for collective use of the Ampelographic collection «Magarach», as well as in industrial plantations of the Crimea according to generally accepted and original methods. Characteristics of 50 varieties for the database, 4 sources of valuable traits were obtained, genotyping of wild grapes was performed, 99 allele variants were identified. Optimal concentrations of substances for the development of proembryogenic calluses and cells in suspension cultures were selected. The influence of biologically active substances on the development of heart shaped and torpedo shaped embryos has been established. The obtained 6 transgenic lines of the Podarok Magaracha variety were adapted to in vivo conditions to assess their cold resistance and frost resistance. In the vegetative collection of plants in vitro, samples are maintained under conditions of active and slow growth. An aseptic culture of 14 grape varieties was obtained. The molecular diagnosis of the latent form of phytopathogens of plant material after the recovery procedures was carried out. The biovar Agrobacterium tumefaciens was identified by the method of molecular diagnostics. During molecular diagnostics, the Rupestris stem pitting virus was detected in the samples. New knowledge has been gained about the dynamics of changes in the quality indicators of grapes depending on the variety and region of cultivation against the background of a complex of agro-climatic parameters and indices used to isolate terroirs. Varietal-rootstock combinations have been identified. The formation of datasets has continued in order to train neural networks for the detection of harmful organisms and pathologies of the development of grape plants. The technology of organic viticulture production for autochthonous varieties and varieties of the Magarach Institute breeding has been tested. The technology of storing table grapes based on the use of calcium-containing preparations has been optimized. For the first time, an information technology of cross-platform integration has been developed for the implemented hardware and software complex for photo-fixation and neural network detection of the number of pests in specialized «traps».

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Arbuscular Mycorrhizal Fungi Induce Changes of Photosynthesis-Related Parameters in Virus Infected Grapevine.

The negative effects of viruses and the positive effects of arbuscular mycorrhizal fungi (AMF) on grapevine performance are well reported, in contrast to the knowledge about their interactive effects in perennial plants, e.g., in grapevine. To elucidate the physiological consequences of grapevine-AMF-virus interactions, two different AMF inoculum (Rhizophagus irregularis and 'Mix AMF') were used on grapevine infected with grapevine rupestris stem pitting virus, grapevine leafroll associated virus 3 and/or grapevine pinot gris virus. Net photosynthesis rate (AN), leaf transpiration (E), intercellular CO2 concentration (Ci) and conductance to H2O (gs) were measured at three time points during one growing season. Furthermore, quantum efficiency in light (ΦPSII) and electron transport rate (ETR) were surveyed in leaves of different maturity, old (basal), mature (middle) and young (apical) leaf. Lastly, pigment concentration and growth parameters were analysed. Virus induced changes in grapevine were minimal in this early infection stage. However, the AMF induced changes of grapevine facing biotic stress were most evident in higher net photosynthesis rate, conductance to H2O, chlorophyll a concentration, total carotenoid concentration and dry matter content. The AMF presence in the grapevine roots seem to prevail over virus infection, with Rhizophagus irregularis inducing greater photosynthesis changes in solitary form rather than mixture. This study shows that AMF can be beneficial for grapevine facing viral infection, in the context of functional physiology.

First report of grapevine red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) infecting grapevine (Vitis vinifera L.) in Portugal.

Grapevine Red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) are relatively recently described grape viruses that respectively belong to the genera Maculavirus and Marafivirus in the family Tymoviridae [1]. Owing to their rather recent description, still limited information on their biology, on their molecular variability and on their geographic distribution is available. Both viruses are apparently completely or largely asymptomatic in European grapevine and have likely been overlooked in a wide range of situations (Martelli, 2014). According to sequences in GenBank, GRGV has been identified in Asia (Iran, Japan, China), the Americas (USA, Brazil) and Europe (Spain, France, Slovenia, Hungary, Czech Republic and Germany). GRVFV has been reported from the same countries but also in Oceania (New Zealand, Australia) and from a range of other countries including India, Pakistan and South Korea for Asia, Canada for North America and Switzerland, Slovakia, Italy and Russia for Europe. Evidence for the presence of GRGV and GRVFV in grapevine plants from northern Portugal (variety(ies) unknown) was obtained through the bioinformatic analysis [2] of RNASeq Illumina data obtained from phloem scrapings from five grapevine samples collected in different plots in 2016 [3]. Following grapevine genome substraction, contigs assembly and Blast-based contigs annotation using CLC Genomics Workbench, two plants, #4 and #5b, yielded contigs representing near complete GRGV genomes. The plant #4 contig integrated 474 reads (0.15% of reads for an average coverage of 10.1x) while the corresponding values for the contig for plant #5b are 2185 reads (2.4% of total reads) for a coverage of 47.2x. The two GRGV contigs show 91.4% nucleotide (nt) identity and the closest GRGV full genome sequence in GenBank, MZ451067 from Canada, shares respectively 98.9% and 91.6% nt identity with them. The near complete genome contigs have been deposited in GenBank (ON603917 and ON603918). Simultaneously, two near full length genomic contigs for GRVFV were identified from plant #5b and have also been deposited in GenBank (ON603919 and ON603920). These contigs show 84.4% nt identity to each other and were respectively assembled from 4643 (5.2% of total reads) and 5326 reads (6.0% of total reads) for respective average coverages of 102.3x and 117.3x. The closest full GRVFV genome in GenBank is MZ027155 from the USA, with 84.3-85.3% nt identity. Confirmation of the presence of GRVG and GRVFV in the doubly infected plant #5b was achieved by specific RT-PCR assays. A published assay [4] was used for GRGV and primers GRVFV-Cp-F 5'AAYCCTGTCACHCTCCACTG3' and GRVFV-Cp-R 5'TTCATGGTGGTGCCDGTGAG3' (Tm 55°C) were used for GRVFV. The obtained 447nt GRGV amplicon showed a single difference with the HTS contig while the 218 nt GRVFV amplicon showed 3 mutations as compared to one of the HTS contigs. The different grapevines had initially been sampled because they showed relatively poor and stunted growth but besides GRVFV and/or GRGV the HTS analysis indicated that they were also infected by hop stunt viroid, grapevine yellow speckle viroid 1, grapevine rupestris stem pitting virus, plus respectively a novel nepovirus (plant #4) and grapevine leafroll-associated virus 2 and grapevine Pinot gris virus (plant #5b) so that the results reported here do not shed novel light on the potential pathogenicity of GRGV or GRVFV. To the best of our knowledge, this is the first report of GRGV and GRVFV in Portugal.

Occurrence of Nine Grapevine Viruses in Commercial Vineyards of Mendoza, Argentina

Grapevine is a widely grown fruit crop that is seriously affected by different viruses, reducing grape yield and quality, as well as threatening profitability. Vineyard disease management requires accurate identification of viral infections. This study aimed to survey the presence of ten grapevine viruses in four geographic sites in the Mendoza province of Argentina. Two hundred twenty-three composite cane samples from 1060 plants of six cultivars were collected from 26 blocks distributed across 11 vineyards. The cane samples were screened by RT-PCR for the following viruses: grapevine leafroll-associated viruses 1-4 (GLRaV 1, 2, 3, and 4), grapevine fanleaf virus (GFLV), grapevine fleck virus (GFkV), grapevine virus A (GVA) and B (GVB), grapevine rupestris stem pitting associated virus (GRSPaV), and arabis mosaic virus (ArMV). The results showed an uneven occurrence of viruses through the sampled regions, with GRSPaV being prevalent (71.1%), followed by GFLV (28.9%), GFkV (20.6%), and GLRaV-2 (14.7%). GVB was not detected. This study revealed a moderate prevalence of viruses associated with economically impactful diseases in the vineyards surveyed.

Grapevine rupestris stem pitting virus: a new pathogen of grapevine in Serbia

Grapevine rupestris stem pitting virus: a new pathogen of grapevine in Serbia

First Report of Grapevine Virus L Infecting Grapevine in Southeast France.

Grapevine virus L (GVL) is a recently described vitivirus (family Betaflexiviridae) with a positive-sense single-stranded RNA genome. It has so far been reported from China, Croatia, New-Zealand, the United States and Tunisia (Debat et al. 2019; Diaz-Lara et al. 2019; Alabi et al. 2020; Ben Amar et al. 2020). It has significant genetic variability (up to 26% of nucleotide divergence between isolates) and the existence of four phylogroups has been proposed (Alabi et al. 2020). In the frame of a project investigating the possible links between grapevine trunk diseases and grapevine virome, viral high throughput sequencing (HTS)-based testing was performed on symptomatic and asymptomatic grapevines collected in July 2019 in vineyards of four areas in France (Bourgogne, Charentes, Gard, Gironde) corresponding to five cultivars of Vitis vinifera (Cabernet franc, Cabernet Sauvignon, Chardonnay, Sauvignon, Ugni blanc). Total RNAs were purified from powder of 105 trunk wood samples using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, Saint-Quentin-Fallavier, France) and RNA-seq libraries were prepared using Zymo-Seq RiboFree Total RNA Library Prep Kit (Ozyme, Saint Cyr l'Ecole, France). HTS was performed on a S4 lane of Illumina NovaSeq 6000 using a paired-end read length of 2x150 bp. The trimmed sequence reads obtained from Chardonnay plants CH30-75M (99.9 M) and CH37-19S (114 M) from a vineyard in Gard were analyzed using CLC Genomics Workbench v21 (Qiagen, Courtaboeuf, France) and revealed complex mixed infections. Besides contigs representing a complete GVL genome (average scaffold coverage: 6,197x and 2,970x, respectively), contigs from grapevine rupestris stem pitting virus (1,697x ; 1,124x), grapevine virus A (82x ; 95x), grapevine pinot gris virus (1,475x ; 866x), grapevine leafroll-associated virus 3 (5,122x ; 1,042x), hop stunt viroid (13,783x ; 29,514x) and grapevine yellow speckle viroid 1 (690x ; 1158x) were also identified. Plant CH37-19S was also co-infected by grapevine rupestris vein feathering virus (164x). The GVL contigs integrated respectively 320,000 and 152,000 reads (corresponding to 0.32% and 0.11% of filtered/trimmed reads, respectively). The GVL genomic sequences from each sample (7,616 nt) have been deposited in GenBank (Accession nos. OK042110 and OK042111, respectively). The two contigs are nearly identical (99.9% nt identity) and share respectively 97.5% and 95.9% with GVL-KA from the USA (MH643739) and GVL-RS from China (MH248020), the closest isolates present in GenBank. To confirm the presence of GVL, the original grapevines were resampled in the field and total RNAs were extracted as described above from cambial scrappings and leaves. Total RNAs were used for RT-PCR tests using primers targeting a 279-bp fragment corresponding to the 3' end of the coat protein gene and part of the nucleic acid binding protein gene (Debat et al. 2019). The Sanger-derived sequences from the amplicons shared 100% nt identities with the corresponding sequences of the HTS assembled genomes, confirming the presence of GVL in both tissues of both grapevine samples. To our knowledge, this represents the first report of the occurrence of GVL in vineyards in France. Given the complex mixed infection present in the two analyzed grapevines, no conclusions can be drawn on the pathogenicity of GVL. Further efforts are needed to better understand GVL distribution and its potential pathogenicity to grapevine. References Alabi, O J., et al. 2020. Arch. of Virol. 165:1905-1909. Ben Amar, A., et al. 2020. Plant disease 104:3274. Debat, H., et al. 2019. Eur J Plant Pathol. 155:319. Diaz-Lara, A., et al. 2019. Arch. of Virol. 164:2573. Acknowledgments The authors are grateful to the "Plan National Dépérissement du Vignoble" (Mycovir project) for the financial support.

Prevalence of Virus Infections and GLRaV-3 Genetic Diversity in Selected Clones of Croatian Indigenous Grapevine Cultivar Plavac Mali.

The cultivar Plavac Mali (Vitis vinifera L.), the most important indigenous red grapevine cultivar in Croatia, was tested for the presence of 16 grapevine viruses. Thirty-five samples from the collection vineyard were tested for the presence of grapevine leafroll-associated viruses-1, -2, and -3 (GLRaV-1, GLRaV-2 and GLRaV-3, respectively), grapevine fanleaf virus (GFLV), arabis mosaic virus (ArMV), grapevine virus-A (GVA), -B (GVB), -G (GVG), -H (GVH), -I (GVI), -J (GVJ), grapevine fleck virus (GFkV), grapevine rupestris stem pitting associated virus (GRSPaV), and grapevine pinot gris virus (GPGV) by reverse transcription–polymerase chain reaction (RT-PCR). Furthermore, standard PCR was conducted for grapevine badnavirus 1 (GBV-1) and grapevine red blotch virus (GRBV). Mixed infections were most common and GLRaV-3, the most abundant virus found in 85.71% of the vines tested, was further molecularly characterised. Different genomic variants of the heat shock protein homologue (HSP70h) were separated by cloning, detected by single-strand conformation polymorphism (SSCP) analysis, sequenced, and phylogenetically analysed. The presence of phylogenetic groups I and II was only confirmed. This study demonstrates the high virus infection rate of Plavac Mali vines and the heterogeneity of GLRaV-3 present nowadays in a collection vineyard.

DETECTION OF VIRUSES OF THE RUGOSE WOOD COMPLEX ON VINEYARDS OF THE ODESSA REGION

DETECTION OF VIRUSES OF THE RUGOSE WOOD COMPLEX ON VINEYARDS OF THE ODESSA REGION

Effects of shoot tip size on in vitro regeneration and virus elimination of grapevine cv. superior seedless

In this study, we investigate the relation between the explant size and the success of virus elimination in ‘Superior Seedless’ grape variety. Plants were tested by prior to thermotherapy and in vitro culture by using Double Antibody Sandwich-Enzyme-Linked Immunosorbent Assay (DAS-ELISA) and Reverse Transcription-Polymerase Chain Reaction (RT-PCR) and verified as infected by different viruses (Grapevine leafroll associated virus -1+3, Grapevine leafroll associated virus -4 Strains, Grapevine rupestris stem pitting associated virus). Different size of shoot tip explants (0.1-0.5-1-5-10 mm) were excised and cultured on MS medium supplemented with 1 mgl-1 BA. All of the explants bigger than 0.1 mm 100% regenerated while 70% of the 0.1 mm explants showed complete regeneration and turned into a whole plant. Plants regenerated from 10 mm shoot tip explants have all three viruses (GLRaV-1+3, GLRaV-4 strains and GRSPaV) as founded in mother plant. Plants regenerated from 5 mm explants have two of them (GLRaV-1+3, GLRaV-4 strains) and plants regenerated from 1 mm explants have one (GLRaV-1+3). Plants regenerated from 0.1 mm explants were found completely virus-free.

Predominance and Diversity of GLRaV-3 in Native Vines of Mediterranean Croatia.

Sixteen grapevine cultivars from Mediterranean Croatia were surveyed for the presence of 10 of the most economically important grapevine viruses. The presence of Grapevine fanleaf virus (GFLV), Arabis mosaic virus (ArMV), Grapevine leafroll associated virus-1, -2, and -3 (GLRaV-1; GLRaV-2 and GLRaV-3), Grapevine virus A (GVA) and B (GVB), Grapevine fleck virus (GFkV), Grapevine rupestris stem pitting associated virus (GRSPaV), and Grapevine Pinot gris virus (GPGV) were tested by reverse transcription polymerase chain reaction (RT-PCR) and enzyme-linked immunosorbent assay (ELISA). All 71 analyzed clones were positive for the presence of one or more viruses. The most abundant one, detected in almost 95% of samples was GLRaV-3. In most of cases it was reported in mixed infections with GVA, GRSPaV, and GPGV. Virus genomes of GLRaV-3 infected vines were further characterized molecularly in order to determine their genetic diversity. Different genomic variants of heat shock 70 protein homologue (HSP70h) were identified by single-strand conformation polymorphism (SSCP) and sequenced. Sequence analysis confirmed their clustering into phylogenetic group I and/or phylogenetic group II. This study emphasizes the wide virus heterogenicity in Mediterranean vines and the predominant presence of GLRaV-3 phylogenetic groups I and II, either individually or in combination.

First Report of grapevine red globe virus in grapevines in Washington State.

Grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) has been reported in grapevines (Vitis spp.) from Italy, Greece, France, China, Spain and Germany and in California, U.S.A. (Sabanadzovic et al. 2000; Cretazzo et al. 2017; Fan et al. 2016; Ruiz-Garcia et al., 2018). During surveys of grapevine nurseries, a total of 241 composite samples, each consisting of four petioles from mature leaves/vine from five asymptomatic grapevines, from 33 grapevine (Vitis vinifera) cultivars were collected. Total RNA isolated from these samples using Spectrum Total RNA isolation kit (Sigma-Aldrich, St. Louis, MO) was subjected to high-throughput sequencing (HTS) on an Illumina HiSeq2500 or Novaseq 6000 platforms in paired-end mode (Genomics Core Facility, Huntsman Cancer Institute, Utah University, Salt Lake City, UT). After trimming raw reads based on quality and ambiguity, the paired-end quality reads of approximately 120 (HiSeq) or 145 (Novaseq) base pair (bp) length were assembled de novo into a pool of contigs (CLC Genomics workbench 12). These contigs were subjected to BLASTn analysis against the nonredundant virus database from GenBank (http://www.ncbi.nlm.nih.gov/blast). A total of 49 contig sequences, ranging from 200 to 1645 bp in length with an average coverage ranging up to 418.7, aligning with GRGV genome were detected in cvs. Aglianico, Cabernet franc, Pinot gris and Riesling. BLASTn analysis of contigs greater than 500 bp length showed sequence identity between 88.5% and 95% with corresponding GRGV sequences reported from other countries. These results indicated the presence of genetically distinct isolates of GRGV. HTS data also revealed coinfection of GRGV in all samples with one or more of the following virus and/or viroids: grapevine rupestris stem pitting associated virus, grapevine rupestris vein feathering virus, hop stunt viroid or grapevine yellow speckle viroid-1. To further confirm infection by GRGV, total RNA was extracted from two asymptomatic Pinot gris vines previously tested positive in HTS using Spectrum Total RNA isolation kit and subjected to reverse transcription-PCR using primers specific to the replicase polyprotein gene of the virus (RG4847F: 5'-TGGTCTGTTGTTCGCATCTT-3' and RG6076R: 5' CGGAAGGGGAAGCATTGATCT-3', Cretazzo et al., 2017). Sequence analysis of the approximately1,250 bp amplicons (accession number MT749359) showed 91.2 % nt sequence identity with corresponding sequence of GRGV isolate from Brazil (KX828704.1). To our knowledge, this is the first report of GRGV in Washington State. Together with the report of the occurrence of GRGV in California (Sabanadzovic et al. 2000), these/span> results indicate wide geographical distribution of the virus. Although GRGV can cause asymptomatic infections in grapevines (Martelli et al. 2002), the economic importance of GRGV as single or coinfections with other viruses needs to be examined to assess the potential significance of the virus to grape production and grapevine certification programs.

First report of grapevine rupestris vein feathering virus in grapevine in Australia.

Grapevine rupestris vein feathering virus (GRVFV; tentative genus Marafivirus; family Tymoviridae ) was first detected from a Greek grapevine (Vitis vinifera), with asteroid mosaic-like symptoms (El Beaino et al. 2001; Ghanem-Sabanadzovic et al. 2003) and was also infected with grapevine fleck virus. GRVFV has been detected in the United States, South Africa, Canada, Spain, China, New Zealand, Brazil, Germany, Korea, Slovakia, Hungary and Pakistan (Cho et al. 2018; Mahmood et al. 2019).Transmission vectors are currently unknown. In 2018, nine grapevine samples were collected between May to July in South Australia (SA) and Western Australia (WA) (Table S1), were analysed by high-throughput sequencing (HTS) to characterise grapevine viruses in Australian vineyards. Total RNA or double stranded RNA was extracted from grapevine canes using RNeasy 96 QIAcube HT kit (Qiagen) with MacKenzie buffer (MacKenzie et al. 1997) or using CF-11 (Balijja et al. 2008). Libraries were prepared using the NEBNext® Ultra II RNA library Prep Kit (NEB) or TruSeq® Stranded mRNA Prep kit (Illumina) with Ribo-Zero®gold plant kit for ribosomal depletion (Illumina, San Diego, CA). Libraries were sequenced using Illumina Miseq (SA) or Hiseq (WA) technology with 2x300 (SA) or 2x100 (WA) paired end reads which were trimmed using Trim Galore! (0.4.0) or BBmap (38.20), respectively. De novo assembly, using the SPAdes (version 3.12.0) genome assembler with default settings, resulted in twelve near full length GRVFV genomes (6713-6737nt), eight sequences from the WA samples and four from the SA samples. WA samples 171 and 178 and SA sample BV each had two distinct GRVFV molecular variants. Variants 171-1 and 171-2 (GenBank accessions MT084811, MT084812) from sample 171 shared 83.39% nucleotide (nt) identity. Variants 178-1 and 178-2 (MT084813, MT084814) from sample 178 shared 83.54% nt identity. Variants BV6799 and BV8822 (MN974274, MN974275) from sample BV shared 82.85% nt identity. Only one GRVFV sequence was obtained from all other samples. The genome of SA isolate LC1 (MN974273) was confirmed by RT-PCR amplification and Sanger sequencing of overlapping genome regions. Tissue from the infected LC1 isolate has been deposited into the Victorian plant pathogen reference collection (VPRI accession No. 43698). When the genomes of all Australian isolates were compared, they had 78.94% to 94.37 % nt identity with each other. The SA isolates LC1, BV8822, BV6799, and SEL-L (MN974276), and the WA isolates 172 (MT084807), 179 (MT084808), 180 (MT084809), and 182 (MT084810) were most closely related to the Swiss isolate CHASS (KY513702; 82.87% to 85.46% nt identity). The WA isolates 171-1, 171-2, 178-1 and 178-2 were most closely related to the New Zealand isolate Ch8021 (MF000325; 83.21% to 93.87%). Grapevine leafroll-associated virus 1 (GLRaV-1), GLRaV-3, GLRaV-4 (strain 6 and 9), grapevine virus A, grapevine rupestris stem pitting associated virus, grapevine yellow speckle viroid 1 and hop stunt viroid were also identified in the sequencing data. This is the first report of GRVFV in Australia. All WA samples were collected during dormancy and symptoms were not observed. Sample LC1 from SA had Shiraz disease, the other SA samples were asymptomatic, and none had asteroid mosaic-like symptoms. Further research is required to determine its distribution and association with disease in Australia.

Divergent molecular and growth responses of young \u201cCabernet Sauvignon\u201d (Vitis vinifera) plants to simple and mixed infections with Grapevine rupestris stem pitting-associated virus

Grapevine rupestris stem pitting associated virus (GRSPaV) is one of the most widely distributed viruses; even so, little is known about its effect on Vitis vinifera. To provide new insights, the effects of single and mixed GRSPaV infections on the V. vinifera cultivar “Cabernet Sauvignon” were studied by evaluating growth parameters, such as measurements of the total plant length, the number and distance of internodes and the number of leaves per shoot. In addition, parameters relating to gas exchange, i.e., the stomatal conductance, net photosynthetic rate, internal CO2 concentration and leaf transpiration, were also assessed. All the measurements were performed in one- and two-year-old plants with a single GRSPaV infection or mixed infections of GRSPaV and Grapevine fanleaf virus (GFLV). The results show that the plant phytosanitary status did not significantly alter the growth and gas exchange parameters in one-year-old plants. However, in two-year-old plants, single GRSPaV infections increased shoot elongation, which was accompanied by the overexpression of genes associated with the gibberellic acid response pathway. The gas exchange parameters of these plants were negatively affected, despite exhibiting higher LHCII gene expression. Plants with mixed infections did not have modified growth parameters, although they presented a greater reduction in the primary photosynthetic parameters evaluated with no change in LHCII expression. The results presented here confirm the co-evolution hypothesis for V. vinifera and GRSPaV during the early stages of plant development, and they provide new evidence about the effects of GRSPaV and GFLV co-infections on the “Cabernet Sauvignon” cultivar.

The occurrence of grapevine rugose wood disease in Algeria

Rugose wood disease constitutes one of the major grapevine disease complexes causing significant economic damage worldwide. It is widely distributed in all grapevine growing areas of the world and comprised of four individual syndromes, which may be caused by different viruses. These syndromes are Corky bark, LN 33 stem grooving, Kober stem grooving and Rupestris stem pitting (RSP). The present study focuses on the prevalence of three viruses associated with rugose wood complex (RWC) in Algeria. Field inspections and collection of symptomatic samples were conducted on autumn 2012 in the table wine and autochthone accession in the western and central regions of Algeria. A total of 202 samples were tested by RT-PCR using specific primers for Grapevine virus A (GVA), Grapevine virus D (GVD) and Grapevine rupestris stem pitting associated virus (GRSPaV). The results of RT-PCR indicated the presence of the viruses GVA, GVD and GRSPaV with 68,81% (139 out of 202 infected samples) total average infection rate. The results also indicated the predominance of GRSPaV compared to the prevalence of GVA and GVD with an infection rate of 57,92% vs. 36,63% (74 out of 202) and 2,97% (6 out of 202), respectively. Mixed infections of these three viruses were not observed in any of the samples analysed, however the mixed infection of GVA and GRSPaV was noted with a high rate of 26.73%. The grapevine cultivars; Kings Rubi, Carignan and Mersguerra were the most infected, while the Alicante Bouschet cultivar presented the lowest infection rate. To the best of our knowledge, the present study reports for the first time on the presence of GVD in Algeria.

First Report of Grapevine Geminivirus A in Vitis in New Zealand

Grapevine geminivirus A (GGVA), a member of the family Geminiviridae, was originally described from the United States on Vitis vinifera, cultivars Black Beet and Nagano Purple, imported from Korea (Al Rwahnih et al. 2017). Since its initial characterization, GGVA has also been reported from the United States, China, and Korea in diverse Vitis spp. (Al Rwahnih et al. 2017; Fan et al. 2017; Jo et al. 2016). The transmission of GGVA by means of a vector and the economic impact of this virus are still unknown. In 2016, a small-scale, untargeted virus survey was done to assess the efficacy of high-throughput sequencing of small RNA (sRNA). Leaf samples from 20 vines were collected from the New Zealand Winegrowers’ germplasm collection, Lincoln, New Zealand. During the survey, GGVA was identified in an asymptomatic sample of Vitis vinifera, an interspecific cross Seibel 7052 (VID 280). sRNA was extracted using a mirVana miRNA Isolation Kit (Thermo Fisher Scientific). A library was prepared using the TruSeq Small RNA Sample Prep Kit (Illumina) and sequenced with 50-bp single-end reads (small RNA-Seq) on an Illumina HiSeq2000 at the Beijing Genomics Institute (Hong Kong), and a total of 32.6 million reads was obtained. When the reads were mapped to the reference sequence of GGVA (GenBank accession no. KX618694), 163,611 reads were assembled with a mean coverage level of 1,183× across the genome, yielding a near complete 2,902-nt GGVA genome sequence. Mapping was done using Bowtie2 (version 2.2.4) (Langmead and Salzberg 2012). Three viruses (grapevine leafroll-associated virus 2, grapevine rupestris stem pitting associated virus, and grapevine asteroid mosaic associated virus) and one viroid (hop stunt viroid) were also detected in this sample using the YABI Virus Surveillance and Diagnosis (VSD) toolkit (Barrero et al. 2017). The grapevine was resampled in July 2018, and the full genome was amplified by PCR using two abutting primers, 23-1F/2R (Fan et al. 2017). BLAST analysis of the sequence obtained (2,905 nt; GenBank accession no. MK690474) showed 99% nt similarity to the full genome of GGVA isolate Tamar (GenBank accession no. KX618694). The virus was detected in only one vine out of 20 (from 12 different cultivars) sequenced by sRNA-Seq from the same germplasm collection. Twenty additional grapevine samples from the South Island tested negative for GGVA by a species-specific PCR using the primers V1-F1/1R (Fan et al. 2017). To the best of our knowledge, this is the first report of GGVA in New Zealand.

First Report of Grapevine virus T in Grapevine in Germany

Grapevine virus T (GVT) is a putative new member of the genus Foveavirus, family Betaflexiviridae, recently found to infect grapevine (Jo et al. 2017). In 2012, grapevine leaves from a Pinot Gris cultivar from the Rhineland-Palatinate area in Germany showing fanleaf-like symptoms were collected and analyzed by high-throughput sequencing of siRNAs using TrueSeq Illumina technology on a HiSeq 1000 system. Data analysis was performed using Geneious software and showed the presence of Arabis mosaic virus, grapevine rupestris stem pitting associated virus, and hop stunt viroid. Considering the great and continuous updating of the available viral sequences, a new analysis of the data mentioned above was performed in 2017. The BlastN and BlastX analysis of the 3,004 contigs assembled de novo by the Geneious software revealed the presence of 65 contigs between 47 and 227 nucleotides long related to GVT, with a nucleotide identity ranging between 81.5 and 93.8%. Mapping of the 7,485,280 Illumina reads using GVT isolate Cho (GenBank accession no. NC_035203) allowed the recovery of 94.6% of the viral sequence, scattered along the genome. To confirm the presence of GVT in German vineyards, primers were designed to specifically amplify by reverse-transcription polymerase chain reaction a fragment of 968 bp encompassing the coat protein (CP) gene, GVT-CP-F 5′-GTGAAAGGGGTGTGGTCCTC-3′ and GVT-CP-R 5′-CAGCGAACATTTGCCCTGTC-3′. A 968-bp fragment was successfully amplified, cloned into the plasmid pJET1.2, and sequenced (GenBank accession no. MG825613) from one of a total of 60 samples randomly collected from different grapevine-growing areas in Rhineland-Palatinate. BlastN analysis of the German isolate revealed 86% nucleotide sequence identity to the corresponding region of the GVT isolate Cho. To our knowledge, this is the first report of GVT in Germany. The incidence and relevance of GVT in German vineyards remain to be determined, because it was found in the latter case on an asymptomatic Riesling cultivar, while being found at first as a mixed infection on a symptomatic Pinot Gris cultivar.

Phylogenetic analysis of viruses in Tuscan Vitis vinifera sylvestris (Gmeli) Hegi.

The health status of the native grapevine Vitis vinifera subsp. sylvestris (Gmeli) Hegi in natural areas in Europe has received little attention. A survey was carried out on wild grapevines in Tuscany (Italy), where isolates of the Grapevine rupestris stem pitting virus (GRSPaV), Grapevine leafroll-associated virus 1 and 3 (GLRaV-1 and GLRaV-3) and Grapevine virus A (GVA) were detected. The complete coat protein (CP) region of these isolates was sequenced to investigate the relationship of the viral variants from Tuscan wild grapevines with isolates from different geographical origins. According to the phylogenetic analyses, GLRaV-1 and GLRaV-3 isolates from Tuscan wild grapevines clustered with isolates from cultivated grapevines with nucleotide sequence identities ranging from 66% to 87% and from 72.5% to 99% respectively, without any correlation between the distribution and geographical origin. Conversely, GRSPaV and GVA isolates clustered together with other Italian isolates from V. vinifera with nucleotide sequence identities ranging from 71.14% to 96.12% and from 73.5% to 92%, respectively. Our analysis of the whole amino acid sequences revealed a high conservation level for the studied proteins explained by a selective pressure on this genomic region, probably due to functional constraints imposed on CP, such as specific interactions with cellular receptors in the insect vectors necessary for successful transmission. In addition, analyses of genetic recombination suggest no significant point mutations that might play a significant role in genetic diversification. The dN/dS ratio also estimated a low number of non-silent mutations, highlighting the purifying selective pressure. The widespread distribution of the Rugose wood complex (GRSPaV and GVA associated disease) in comparison with the Grapevine Leafroll associated viruses (GLRaV-1 and -3) could explain the major geographical correlation found for the viral variants detected in Tuscany.

Elimination of Grapevine leafroll associated virus-3, Grapevine rupestris stem pitting associated virus and Grapevine virus A from a Tunisian Cultivar by Somatic Embryogenesis and Characterization of the Somaclones Using Ampelographic Descriptors.

Prospecting of local grapevine (Vitis vinifera L.) germplasm revealed that Tunisia possesses a rich patrimony which presents diversified organoleptic characteristics. However, viral diseases seriously affect all local grapevine cultivars which risk a complete extinction. Sanitation programs need to be established to preserve and exploit, as a gene pool, the Tunisian vineyards areas. The presence of the Grapevine leafroll associated virus-3 (GLRaV-3), Grapevine stem pitting associated virus (GRSPaV) and Grapevine virus A (GVA), were confirmed in a Tunisian grapevine cultivar using serological and molecular analyses. The association between GRSPaV and GVA viruses induces more rugose wood symptoms and damages. For this reason the cleansing of the infected cultivar is highly advisable. Direct and recurrent somatic embryos of cv. ‘Hencha’ were successfully induced from filament, when cultured on Chée and Pool (1987). based-medium, enriched with 2 mg 1−1 of 2,4-dichlorophenoxyacetic acid and 2.5 mg 1−1 of Thidiazuron, after 36 weeks of culture. After six months of acclimatization, RT-PCR carried on 50 somaplants confirmed the absence of GVA, GRSPa-V as well as GLRaV-3 viruses in all somaplants. Ampelographic analysis, based on eight OIV descriptors, was carried out on two years acclimated somaplants, compared to the mother plant. Results demonstrated that the shape and contours of 46 somaclones leaves are identical to mother plant leaves and four phenotypically off-type plants were observed. The healthy state of 100% ‘Hencha’ somaclones and the high percentage of phenotypically true-to-type plants demonstrate that somatic embryogenesis is a promising technique to adopt for grapevine viruses elimination.

First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia...