Routine Ophthalmic Examination Research Articles

A mutated CRYGD associated with congenital coralliform cataracts in two Chinese pedigrees.

To investigate the causal gene mutation and clinical characteristics for two Chinese families with autosomal dominant congenital coralliform cataract. Two Chinese pedigrees with congenital cataract were investigated. Routine ophthalmic examinations were performed on all patients and non-affected family members. Peripheral blood samples were collected, and the genomic DNAs were extracted. The coding regions of proband's DNAs were analyzed with cataract gene panel. The identified mutation was amplified by polymerase chain reaction, and automated sequencing was performed in other members of two families to verify whether the mutated gene was co-segregated with the disease. Congenital coralliform cataract was inherited in an autosomal dominant mode in both pedigrees. For each family, more than half of the family members were affected. All patients presented with severe visual impairment after birth as a result of bilateral symmetric coralliform lens opacification. An exact the same defect in the same gene, a heterozygous mutation of c.70C>A (p. P24T) in exon 2 of γD-crystallin gene, was detected in both probands from each family. Sanger sequencing analysis demonstrated that the mutated CRYGD was co-segregated in these two families. A c.70C>A (p. P24T) variant in CRYGD gene was reconfirmed to be the causal gene in two Chinese pedigrees. It is known that mutated CRYGD caused most of the congenital coralliform cataracts, suggesting that the CRYGD gene is associated with coralliform congenital cataract.

Safety and efficacy of topically administered netarsudil-latanoprost fixed dose combination (FDC; Rocklatan™) in normal and glaucomatous dogs with ADAMTS10-open-angle glaucoma (ADAMTS10-OAG).

The aim of the study was to evaluate safety and efficacy of topically administered 0.02% netarsudil-0.005% latanoprost fixed-dose combination (FDC) (Rocklatan™; Aerie Pharmaceutical) in normal and glaucomatous dogs with ADAMTS10-open-angle glaucoma (ADAMTS10-OAG). Five normal and five glaucomatous beagle dogs with ADAMTS10-OAG were the study animals. In each dog, left (OS) or right eye (OD) was randomly selected for netarsudil-latanoprost FDC treatment. Contralateral eyes served as latanoprost-treated controls. The study was divided into four consecutive study periods: following a 4-day baseline period, two sequential 8-day study periods followed with once daily (q24h) and twice daily (q12h) treatments and ending with a washout period. Efficacy was measured by diurnal intraocular pressure (IOP) and pupil diameter. Safety was assessed by routine ophthalmic examination, gonioscopy, and pachymetry. Differences in least square means of quantitative outcome measures were compared between FDC and latanoprost treatments by using the linear Gaussian model. Baseline IOPs were 13.6±0.7mmHg (mean ± SEM) in normal and 28.3±1.4mmHg in OAG-affected dogs. There was a significant decrease in mean diurnal IOP following FDC administration in both normal (q24h: -2.1mmHg; q12h: -4.1mmHg) and glaucomatous dogs (q24h: -14.2mmHg; q12h: -17.7mmHg; p<.0001). There was no significant difference in the treatment effect when comparing FDC to latanoprost. Both FDC and latanoprost administration resulted in similarly significant pupil constriction (p<.0001). The FDC administration was well-tolerated but resulted in conjunctival hyperemia. Once or twice daily administration of netarsudil-latanoprost FDC (Rocklatan™) and latanoprost was equally effective in lowering IOP in normal and OAG-affected dogs. There was no netarsudil-related added treatment effect.

Clinical Outcomes After Phacoemulsification With Implantation of Trifocal and Toric Trifocal Intraocular Lenses.

To evaluate the visual and refractive outcomes, visual quality, patient satisfaction, and spectacle independence after phacoemulsification with bilateral implantation of a diffractive trifocal intraocular lens (IOL). The study sample comprised 36 consecutive patients (72 eyes). Twenty-three (64%) patients underwent refractive lens exchange and 13 (36%) underwent cataract surgery. Exclusion criteria included previous ocular surgery, corneal higher order aberrations of greater than 0.4 µm, angle kappa of greater than 0.6 mm, and corneal astigmatism of greater than 5.00 diopters (D). All eyes were targeted for emmetropia. A toric IOL was used in 35 (48.6%%) eyes with corneal astigmatism of greater than 1.00 D. Uncorrected distance visual acuity (UDVA) and distance-corrected visual acuity were measured at 4 m and 80 and 40 cm. Patients underwent routine ophthalmic examination for 6 months postoperatively. Patient satisfaction was assessed with a subjective questionnaire at 6 months postoperatively. A P value of less than .05 was statistically significant. At 6 months postoperatively, the mean manifest refractive spherical equivalent was -0.01 ± 0.51 D. Binocular UDVA at 4 m and 80 and 40 cm was -0.02 ± 0.10, -0.07 ± 0.11, and 0.08 ± 0.10 logMAR, respectively. Binocular defocus curves presented two peaks of -0.07 and -0.02 logMAR for 0.00 and -2.00 D defocus, respectively. The Objective Scatter Index score decreased significantly in the cataract group and increased significantly in the refractive lens exchange group (P < .05, both cases). All patients were satisfied or very satisfied with the postoperative outcome. Bilateral implantation of a diffractive trifocal IOL resulted in good visual performance at all distances with high patient satisfaction and spectacle independence at 6 months postoperatively. [J Refract Surg. 2021;37(6):372-379.].

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome.

To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

P69 Intra-ocular pressure measurement in eye casualty: Which is the Fairest of Them All?

IntroductionA survey completed by junior doctors who routinely run eye casualty clinics identified Goldmann applanation tonometry (GAT) as the single most time-consuming element of a standard consultation. IOP can be measured with a range of devices in the eye clinic. By identifying the most accurate and time efficient method we can save time in consultations as well as provide better outcomes for the patient.PurposeTo compare four tonometry techniques: Goldmann applanation tonometer(GAT), Non-contact tonometer(NCT), Tonopen(TP) and Icare tonometer(ICT) to determine the most accurate and efficient method.Method20 subjects presenting in the casualty eye clinic were used in the study ranging between 36-75 years. Once undergoing routine ophthalmic examination from the same clinician, IOP was recorded with all devices. Three readings were taken before calculating an average value and time taken for each device for each patient. No patients were excluded from the study.ResultsThe average IOP with GAT, NCT, TP and ICT was 8.5 ± 2.7, 10.3 ± 4.2, 8.6 ± 3.1, and 8.4 ± 4.5 mmHg, respectively. The average time taken with GAT, NCT, TP and ICT was 56, 132, 38 and 23 seconds, respectively. There was no significant difference in IOP measured by GAT and TP and ICT however, NCT (10.3 mm Hg, P < 0.01) measured significantly higher IOPs compared to GAT.ConclusionWhen compared to Goldmann applanation tonometer, Icare was the most accurate and efficient method. While Tonopen was fairly accurate some patients were unable to tolerate it. NCT was significantly slower compared to other devices.

The long-term observation in Chinese children with monocular myelinated retinal nerve fibers, myopia and amblyopia.

BackgroundThe syndrome of monocular myelinated retinal nerve fibers (MRNF), myopia and amblyopia threatens visual development of infants and young children. The efficacy of part-time occlusion therapy remains controversial, and the long-term prognosis of the syndrome remains unclear.MethodsTen children (4.40±2.22 years, 4 boys and 6 girls) with monocular MRNF, myopia and amblyopia were recruited. Both the affected eyes (treatment group) and the fellow eyes (control group) underwent routine ophthalmic examinations, including AL, cycloplegic refraction, best-spectacles-corrected distance visual acuity (BSCDVA), cover test, simultaneous perception, corneal curvature, anterior segment and fundus examinations. Refractive error was corrected by either spectacles or rigid gas permeable (RGP) contact lenses. Part-time occlusion therapy was employed for amblyopia treatment. The retinal characteristics were examined only on the final visit with a Fourier-domain optical coherence tomography (FD-OCT). The speed of myopia progression and axial elongation were calculated. Statistical analysis was performed using SPSS 20 software. Cut-off P values were 0.05.ResultsOn the final visit, six children had normal simultaneous perception but three had strabismus. The mean AL and spherical equivalent (SE) values of the affected eyes were 28.05±1.59 mm and −12.60±4.20 D, respectively, while those of the fellow eyes were 23.67±1.13 mm and −0.66±1.99 D, respectively. AL and SE were significantly different over time and between groups (P<0.0001), but no time*group interaction effect (P>0.05) was observed. The differences in the corneal curvature, mean speed of myopia progression, axial elongation, foveal thickness and parafoveal thickness between the two groups were not significant (P>0.05). However, the perifoveal thickness in the affected eyes was significantly higher than that of the control eyes (P=0.047). In the treatment group, the occlusion dosage positively correlated with the final BSCDVA (R=0.764, P=0.016) but did not correlate with the speed of myopia progression or axial elongation (both P values >0.05).ConclusionsThe affected eyes have longer AL, severer myopia and thicker perifoveal retina when compared with the fellow eyes. Both the affected and the fellow eyes have similar speed of myopia progression as well as that of axial elongation.

Validation of Artificial Intelligence Algorithm in the Detection and Staging of Diabetic Retinopathy through Fundus Photography: An Automated Tool for Detection and Grading of Diabetic Retinopathy.

PURPOSE:Diabetic retinopathy (DR) is one of the leading causes of vision loss globally, and early detection plays a significant role in the prognosis. Several studies have been done on the single field fundus photography and artificial intelligence (AI) in DR screening using standardized data sets in urban outpatient settings. This study was carried out to validate AI algorithm in the detection of DR severity using fundus photography in real-time rural setting.METHODS:This cross-sectional study was carried out among 138 patients who underwent routine ophthalmic examination, irrespective of their diabetic status. The participants were subjected to a single field color fundus photography using nonmydriatic fundus camera. The images acquired were processed by AI algorithm for image quality, presence and refer ability of DR. The results were graded by four ophthalmologists. Interobserver variability between the four observers was also calculated.RESULTS:Of the 138 patients, 26 patients (18.84%) had some stage of DR, represented by 47 images (17.03%) positive for signs of DR. All 26 patients were immoderate or severe stage. About 6.5% of the images were considered as not gradable due to poor optical quality. The average agreement between pairs of the four graders was 95.16% for referable DR (RDR). The AI showed 100% sensitivity in detecting DR while the specificity for RDR was 91.47%.CONCLUSION:AI has shown excellent sensitivity and specificity in RDR detection, at par with the performance of individual ophthalmologists and is an invaluable tool for DR screening.

Evaluation of Personality Features and Mental State of Keratoconus Patients.

Objectives:Keratoconus (KCN) is a disorder that usually appears during adolescence and progressively reduces visual acuity. KCN may lead to differences in personality features as a result of vision loss and the numerous clinical examinations and treatment methods used from a young age. The aim of this study was to better understand the psychological characteristics of KCN patients and to define possible correlations between corneal topographic parameters and psychological state.Methods:A total of 59 KCN cases were included in the study group and were compared with 65 age- and sex-matched healthy individuals. All of the participants underwent a routine ophthalmic examination that included corrected distance visual acuity (CDVA), biomicroscopy, and fundoscopy. The KCN patients were evaluated busing Scheimpflug corneal topography. Psychiatric evaluations were performed using the Eysenck Personality Questionnaire Revised-Short Form (EPQ), the Self-Confidence Scale, the Maudsley Obsessive-Compulsive Inventory (MOCI), and the Beck Depression Inventory (BDI).Results:The mean age of the case and control groups was 23.98±5.7 years and 25.82±5.4 years, respectively. The KCN cases had significantly higher EPQ neuroticism subscale scores; higher MOCI subscale scores, with the exception of the doubting subscale; and higher BDI scores. Analysis of the KCN duration revealed a positive correlation with the checking and slowness subscales of the MOCI, however, there was no significant correlation between the psychometric scale scores, corneal topographic parameters, and CDVA.Conclusion:A substantially asymmetrical course and a relatively long period for KCN to result in severe vision loss might explain the lack of correlations between psychological parameters and visual acuity. Nonetheless, the apparent effect of vision loss on emotional distress cannot be disregarded; the day-to-day progressive loss of visual acuity and multiple, costly interventions may initiate or contribute to a depressive mood in KCN patients. A vicious depressive cycle and the exhaustion of long-term coping mechanisms might be underlying factors for the higher neuroticism scores seen among KCN patients. Both the personality traits and mental state of KCN patients demonstrate distinguishing properties; clinicians working with these patients should consider their mental state in addition to other factors in order to achieve better treatment outcomes.

The value and implementation of routine ophthalmic examination in the era of HAART.

BackgroundThe high prevalence of ocular manifestations (OMs) in patients with human immunodeficiency virus (HIV) infection and chronic diseases such as diabetes has become a global health issue. However, there is still a lack of an appropriate ophthalmic diagnostic procedure for the early detection of OMs in this population, leading to the risk of an irreversible visual impairment that substantially affects the quality of life of these patients.MethodsThe Guangzhou HIV Infection Study was a retrospective study that enrolled hospitalised HIV-infected patients in Guangzhou between January 2005 and December 2016, period corresponding to the highly active antiretroviral therapy (HAART) era in China. We collected data on OMs, systemic diseases, hospitalisation, and demographic characteristics. We classified the patients into 3 groups according to the ophthalmic examination mode they underwent: the non-ophthalmologist examination group (patients hospitalised in 2005–2011 who were only treated by infectious disease physicians), the on-demand ophthalmic examination group (patients hospitalised in 2012–2013 who were referred for a consultation with an ophthalmologist), and the routine ophthalmic examination group (patients hospitalised in 2014–2016 who routinely underwent standard ophthalmic examinations). Binary logistic regression models were used to investigate the factors related to OMs.FindingsA total of 8,743 hospitalised HIV-infected patients were enrolled. The prevalence of detected OMs were 1.5% in the non-ophthalmologist examination group, 1.9% in the on-demand ophthalmic examination group, and 12.8% in the routine ophthalmic examination group. The odds of detection of OMs were highest in the routine ophthalmic examination group (adjusted odds ratio [aOR]=9.24, [95%CI, 6.51–13.12], compared to the non-ophthalmologist examination group). The detection of all types of OMs increased substantially, with keratitis, retinitis and vascular abnormalities increased the most (by 15.8–20.0 times). In the routine examination group, patients who were older than 50 years, males, with medical insurance, and were not resident in Guangzhou, had higher odds to have OMs. Several systemic diseases also increased the odds of OMs, with the highest odds among patients with a cytomegalovirus infection (aOR=5.59, [95%CI, 4.12–7.59]). Patients with retinitis, retinopathy and conjunctivitis had higher odds of having a CD4+ T cell counts less than 200 cells/μL compared to the patients that did not have these referred OMs.InterpretationThe implementation of a routine ophthalmic examination has improved the odds of OM detection by approximately 9 times and increased the diagnosis rates of all types of OMs. Therefore, we encourage all HIV-infected patients to undergo regular ophthalmic examinations. Patients with OMs, especially retinopathy and retinitis, need to be evaluated for immune function (such as CD4+ T cell counts) and systemic diseases.

Central Visual Field Sensitivity With and Without Background Light Given to the Nontested Fellow Eye in Glaucoma Patients.

This study showed the difference of monocular visual sensitivity between with and without background light given to the nontested fellow eyes in glaucoma patients. Monocular sensitivity measurements of the worse eyes with fellow eye's background light conditions should carefully be considered when assessing the impact of functional impairment in glaucoma patients. The purpose of this study was to investigate the difference between monocular sensitivities measured with and without background light given to the nontested fellow eye in glaucoma patients using a new perimeter named "imo." In this cross-sectional study, we examined 102 eyes of 51 patients (mean age, 65.1±14.9 y) with open-angle glaucoma who were affected with at least 1 significant point in the central 10 degrees. We conducted a routine ophthalmic examination and visual field testing using the Humphrey Field Analyzer 24-2 and 10-2 programs. The eyes were assigned to "better" and "worse" categories based on the visual acuity and central visual thresholding. Subsequently, we compared the central visual sensitivities with and without background light given to the nontested fellow eye. The mean sensitivity (MS) in the central 5 points of the visual field of the worse eyes was better when measured with background light than without background light (P=0.037) given to the nontested fellow eye. No significant difference was seen among the MS in the visual field of the better eyes. After dividing the patients into low (n=25) and high sensitivity (n=26) groups, only the low sensitivity group in worse eyes had higher MS with background light than without background light (P<0.05) given to the nontested fellow eye. Monocular sensitivities measured with background light given to the nontested fellow eye were higher than those without background light in the worse eye group of glaucoma patients. Monocular MS measurements of the worse eyes with fellow eye's background light conditions and their related indices should thus carefully be considered when assessing the impact of functional impairment in glaucoma patients.

Modified Four-Point Scleral Suture Fixation Technique for Repositioning a Dislocated Intraocular Lens in the Absence of Capsule Support

Purpose. To study the efficacy of a modified four-point fixation technique for the repositioning of a dislocated intraocular lens (IOL) with four eyelets in the absence of capsule support. Methods. Four patients with dislocated four-eyelet hydrophilic acrylic IOLs (Akreos AO60) were enrolled. The modified technique combined four-point fixation with intrascleral sutures and suture burying. The technique minimized the limbus incision to 1 mm with no externalization of the IOL or its haptics. Follow-ups included routine ophthalmic examinations, corneal endothelial cell counts, and measurement of IOL tilt and decentration (measured using Pentacam® HR images). Results. The IOLs were successfully repositioned in all cases. After a mean follow-up period of 19.75 ± 7.85 months (range: 8 to 24 months), the patients’ best-corrected vision acuity (BCVA (LogMAR), before: 0.63 ± 0.36, after: 0.58 ± 0.43, P = 0.604 ) and intraocular pressure (pre 13.35 ± 0.85 mmHg, post 14.80 ± 2.03 mmHg, P = 0.150 ) remained unchanged. Corneal endothelium density decreased about 6.84 ± 2.97%. In all cases, the IOL was well positioned during the follow-up. At the final visit, the average IOL tilt was 1.36 ± 0.35° horizontally and 1.31 ± 0.14° vertically. The average IOL decentration was 0.23 ± 0.12 mm horizontally and 0.18 ± 0.13 mm vertically. Conclusions. With this modified technique, dislocated IOLs with four-eyelets could be treated safely with favorable outcomes.

Secondary in-the-bag Intraocular Lens Implantation in Aphakic Eyes After Vitrectomy and Silicone Oil Tamponade for Rhegmatogenous Retinal Detachment.

To describe a novel technique for capsular bag reopening and secondary in-the-bag intraocular lens (IOL) implantation in aphakic eyes after vitreoretinal surgery and intraocular tamponade. We enrolled 14 eyes of 14 patients who underwent primary vitreoretinal surgery with silicone oil tamponade for rhegmatogenous retinal detachment between September 2018 and September 2019. The novel technique was used for capsular bag reopening and foldable single-piece IOL implantation. Patients were followed up at least 24 weeks with routine ophthalmic examinations, corneal endothelial cell density, and IOL tilt and decentration measurement. The procedure was successfully completed in 13 cases; in one case, because of posterior capsular tear, the IOL was implanted with ciliary sulcus fixation. After a mean follow-up of 48.8 ± 14.8 (range, 24.9-65.9) weeks, the best-corrected visual acuity (before 20/76 Snellen, 0.63 ± 0.23 logarithm of the minimum angle of resolution equivalent and after 20/35 Snellen, 0.32 ± 0.32 logarithm of the minimum angle of resolution equivalent; P = 0.001) and spherical equivalent (before +8.22 ± 4.08, after -2.39 ± 1.77 D; P < 0.001) improved, intraocular pressure (before 15.93 ± 4.40, after 16.25 ± 4.25 mmHg; P = 0.743) remained unchanged. The IOL was well centered with a mean horizontal and vertical tilt of 0.5070 ± 0.3319° and 0.4652 ± 0.3465°, respectively, and decentration of 0.1705 ± 0.1334 mm and 0.1712 ± 0.1576 mm, respectively. With this technique, capsular bag reopening and secondary in-the-bag IOL implantation could be achieved in most cases with satisfactory visual outcome and IOL position.

Co-relation of Myopia with the Use of Smart Phones and Outdoor Activities

Purpose: To determine the frequency of myopia among children and to find out the role of smart phone usage and outdoor activities in myopia development and progression.&#x0D; Study Design: Descriptive cross-sectional study.&#x0D; Place and Duration of Study: Ophthalmology department DHQ-UTH Gujranwala, from January 2019 to June 2019.&#x0D; Methods: After approval from the hospital ethical committee and informed consent from each participant, a descriptive cross-sectional study was carried out with a sample size of 250 patients. Patients of either gender between 4 – 14 years of age using smart phones for ≥ 2 hours daily and found to have refractive error were included in this study. Routine ophthalmic examination was carried out, data was recorded on proforma, and daily usage of smart phones and weekly outdoor activity in hours along with school grade, family history and previous history of using refractive glasses was also determined and documented. Data was analyzed using SPSS v.20&#x0D; Results: 250 patients were included in this study, out of which 142 (56.8%) were male and 108 (43.2%) were female. Mean age was 10.1 ± 2.45 years. Mean outdoor activity was 0.95 ± 0.98 hours per week while mean daily smart phone usage was 2.89 ± 0.93 hours. Pearson correlation coefficient for daily smart phone usage and UCVA was +0.297 (0.3) which showed a positive moderate association between two variables while the value obtained for UCVA and weekly outdoor activity was – 0.51 that depicted a negative strong association.&#x0D; Conclusions: In conclusion, myopia occurrence is higher among smart phone users showing a moderate positive correlation while outdoor activities reduce myopia prevalence and progression depicting strong negative correlation.&#x0D; Key Words: Refractive Errors, Myopia, Visual acuity, Smartphone.

Management of retinitis pigmentosa by Wharton\u2019s jelly-derived mesenchymal stem cells: prospective analysis of 1-year results

PurposeThe aim of the study was to investigate annual structural and functional results, and their correlation with inheritance pattern of retinitis pigmentosa (RP) patients who were treated with Wharton’s jelly-derived mesenchymal stem cells (WJ-MSCs).Material and methodsThis prospective, sequential, open-label phase-3 clinical study was conducted at Ankara University Faculty of Medicine, Department of Ophthalmology, between April 2019 and May 2020. The study included 34 eyes from 32 retinitis pigmentosa patients of various genotypes who were enrolled in the stem cells clinical trial. The patients were followed for 12 months after the WJ-MSCs transplantation into subtenon space and evaluated with consecutive examinations. Genetic mutations were investigated using a retinitis pigmentosa panel sequencing method consisting of 90 genes. All patients underwent a complete routine ophthalmic examination with best corrected visual acuity, optical coherence tomography angiography, visual field, and full-field electroretinography. Quantitative data obtained from baseline (T0), 6th month (T1), and 12th month (T2) examinations were compared.ResultsAccording to timepoints at T0, T1, and T2: The mean outer retinal thickness was 100.3 μm, 119.1 μm, and 118.0 μm, respectively (p = 0.01; T0 < T1, T2). The mean horizontal ellipsoid zone width were 2.65 mm, 2.70 mm, and 2.69 mm respectively (p = 0.01; T0 < T1, T2). The mean best corrected visual acuity (BCVA) were 70.5 letters, 80.6 letters, and 79.9 letters, respectively (p = 0.01; T0 < T1, T2). The mean fundus perimetry deviation index (FPDI) was 8.0%, 11.4%, and 11.6%, respectively (p = 0.01; T0 < T1, T2). The mean full-field flicker ERG parameters at T0, T1, and T2: amplitudes were 2.4 mV, 5.0 mV, and 4.6 mV, respectively (p = 0.01; T0 < T1, T2). Implicit time were 43.3 ms, 37.9 ms, and 38.6 ms, respectively (p = 0.01; T0 > T1, T2). According to inheritance pattern, BCVA, FPDI, ERG amplitude, and implicit time data improved significantly in autosomal dominant (AD) and in autosomal recessive (AR) RP at 1 year follow-up (pAD = 0.01, pAR = 0.01; pAD = pAR > pX-linked). No ocular or systemic adverse events related to the surgical methods and/or WJ-MSCs were observed during the 1 year follow-up period.ConclusionSubtenon transplantation of WJ-MSCs was found to be effective and safe in the treatment of RP during the first year, similar to the sixth month’s results. In autosomal dominant and autosomal recessive inheritance of RP, regardless of the genetic mutations, subtenon administration of WJ-MSCs can be considered an effective and safe option without any adverse effect for slowing or stopping the disease progression.Trial registrationClinicalTrials.gov, NCT04224207. Registered 8 January 2020

Optomap ultrawide field imaging for detecting peripheral retinal lesions in 1725 high myopic eyes before implantable collamer lens surgery.

Identifying peripheral retinal lesions in high myopia patients before implantable collamer lens (ICL) surgery by nonmydriatic Optomap ultrawide field imaging. To investigate specificity and sensitivity of nonmydriatic Optomap ultrawide field imaging for detecting peripheral retinal lesions in high myopia patients before ICL surgery. Hospital-based, cross-sectional study. A total of 1725 high myopic eyes of 897 ICL surgery candidates were included in this study. Patients with high myopia were scheduled for routine ophthalmic examination before ICL implantation. Nonmydriatic Optomap ultrawide field imaging was applied for detecting potential peripheral retinal lesions before ICL surgery. Presence of peripheral retinal lesions. Of 1725 eyes, 344 (19.94%) had peripheral retinal lesions in total; 75 (4.35%) eyes had holes/tears; 313 (18.14%) eyes had peripheral retinal degenerations. Sensitivity of Optomap for detecting peripheral retinal holes/tears and degenerations were 57.33% (95% confidence interval [CI]: 45.38-68.69) and 65.18% (95% CI: 59.61-70.45). Specificity for peripheral retinal holes/tears and degenerations were 99.58% (95% CI: 99.13-99.83) and 99.08% (95% CI: 98.43-99.51), respectively. A total of 22.70% (32/141) of omitted peripheral retinal lesions under Optomap needed intervention. Longer axial length (odds ratio [OR]: 1.16, P < .01), more severe refractive error (OR: 1.05, P < .01) and older age (OR: 1.03, P < .01) were proved to be risk factors for peripheral retinal degenerations in high myopes. Optomap ultrawide field imaging is a reliable adjunctive tool with high specificity and moderate sensitivity for identifying and recording peripheral retinal lesions in high myopes in preoperative examination. Nonmydriatic Optomap could not entirely replace Goldmann three-mirror contact lens in detecting peripheral retinal lesions in high myopia ICL candidates.

Modified Intrascleral Fixation for Repositioning the Dislocated Single-Piece, Rigid PMMA Intraocular Lens.

To describe a modified intrascleral fixation technique for repositioning single-piece rigid polymethyl methacrylate intraocular lenses (IOLs). Four patients with dislocated IOLs were enrolled. Surgical modifications included using ≤1-mm scleral incision for haptic externalization, placing the IOL haptic placement in scleral tunnels, and using 8-0 absorbable sutures. Patients were followed up for 6 months with routine ophthalmic examinations, corneal endothelial cell counts, and ultrasound biomicroscopy (UBM). The mean follow-up time was 13.5 ± 5.45 months. The IOL was well centered and the spherical refraction improved (+10.25 ± 2.21 vs. -0.81 ± 1.59 D, P < 0.05), whereas the best-corrected visual acuity (pre 20/43 Snellen, 0.42 ± 0.33 logarithm of the minimum angle of resolution equivalent and post 20/36 Snellen, 0.31 ± 0.22 logarithm of the minimum angle of resolution equivalent; P = 0.235), intraocular pressure (pre 13.8 ± 3.21, post 13.55 ± 5.14 mmHg), corneal endothelium density (pre 2,423.8 ± 279.6/mm 2 , post 2,280.25 ± 350.7/mm 2 ), and total astigmatism (pre -1.94 ± 0.43, post -1.69 ± 0.59 D) remained unchanged. The average horizontal and vertical IOL tilt was 0.33 ± 0.22° and 0.81 ± 0.38°, respectively. Intraocular lens decentration was 0.10 ± 0.03 mm horizontally and 0.13 ± 0.06 mm vertically. The modified intrascleral fixation technique shows encouraging midterm results in patients with dislocated single-piece, rigid polymethyl methacrylate IOLs. Larger samples and longer follow-up are required to confirm the outcomes of this technique.

COVID-19: Precautionary Guidelines for Ophthalmologists.

Several coronaviruses can infect humans, and the globally endemic human coronaviruses, HCoV-229E (human coronavirus 229E), HCoV-NL63 (human coronavirus NL63), and others, tend to cause mild respiratory diseases. The zoonotic Middle East respiratory syndrome coronavirus (MERS-CoV) and severe acute respiratory syndrome coronavirus type1 (SARS-CoV-1) have high fatality rates. In December 2019, the World Health Organization (WHO) was notified by Chinese authorities about an outbreak of pneumonia before the causative organism was identified in January 2020 as a novel coronavirus family. The WHO refers to the virus as coronavirus disease 2019 (COVID-19). Within several weeks, the outbreak has become an emergency, and many countries have since been affected. The method of transmission is not yet fully known but is thought to be mainly respiratory. Healthcare providers, particularly ophthalmologists, are at high risk of a COVID-19 infection through unprotected contact with eye secretions during routine ophthalmic examinations that involve the use of direct ophthalmoscopy and slit-lamp examinations, which are usually performed in a setting that allows for close doctor-patient contact. In light of these, specific measures are needed from an ophthalmic point of view to control the COVID-19 outbreak and to protect health care providers.

Management of retinitis pigmentosa by Wharton\u2019s jelly derived mesenchymal stem cells: preliminary clinical results

PurposeThe aim of this study is to determine if umbilical cord Wharton’s jelly derived mesenchymal stem cells implanted in sub-tenon space have beneficial effects on visual functions in retinitis pigmentosa patients by reactivating the degenerated photoreceptors in dormant phase.Material and methodsThis prospective, open-label, phase-3 clinical trial was conducted between April of 2019 and October of 2019 at Ankara University Faculty of Medicine, Department of Ophthalmology. 32 RP patients (34 eyes) were included in the study. The patients were followed for 6 months after the Wharton’s jelly derived mesenchymal stem cell administration, and evaluated with consecutive examinations. All patients underwent a complete routine ophthalmic examination, and best corrected visual acuity, optical coherens tomography angiography, visual field, multifocal and full-field electroretinography were performed. The quantitative results were obtained from a comparison of the pre-injection and final examination (6th month) values.ResultsThe mean best corrected visual acuity was 70.5 letters prior to Wharton’s jelly derived mesenchymal stem cell application and 80.6 letters at the 6th month (p = 0.01). The mean visual field median deviation value was 27.3 dB before the treatment and 24.7 dB at the 6th month (p = 0.01). The mean outer retinal thickness was 100.3 μm before the treatment and 119.1 μm at 6th month (p = 0.01). In the multifocal electroretinography results, P1 amplitudes improved in ring1 from 24.8 to 39.8 nv/deg2 (p = 0.01), in ring2 from 6.8 to 13.6 nv/deg2 (p = 0.01), and in ring3 from 3.1 to 5.7 nv/deg2 (p = 0.02). P1 implicit times improved in ring1 from 44.2 to 32.4 ms (p = 0.01), in ring2 from 45.2 to 33.2 ms (p = 0.02), and in ring3 from 41.9 to 32.4 ms (p = 0.01). The mean amplitude improved in 16 Tds from 2.4 to 5.0 nv/deg2 (p = 0.01) and in 32 Tds from 2.4 to 4.8 nv/deg2 (p = 0.01) in the full-field flicker electroretinography results. Full field flicker electroretinography mean implicit time also improved in 16 Tds from 43.3 to 37.9 ms (p = 0.01). No ocular or systemic adverse events related to the two types of surgical methods and/or Wharton’s jelly derived mesenchymal stem cells itself were observed during the follow-up period.ConclusionRP is a genetic disorder that can result in blindness with outer retinal degeneration. Regardless of the type of genetic mutation, sub-tenon Wharton’s jelly derived mesenchymal stem cell administration appears to be an effective and safe option. There are no serious adverse events or ophthalmic / systemic side effects for 6 months follow-up. Although the long-term adverse effects are still unknown, as an extraocular approach, subtenon implantation of the stem cells seems to be a reasonable way to avoid the devastating side effects of intravitreal/submacular injection. Further studies that include long-term follow-up are needed to determine the duration of efficacy and the frequency of application.Trial registrationSHGM56733164. Redistered 28 January 2019 https://shgm.saglik.gov.tr/organ-ve-doku-nakli-koordinatorlugu/56733164/203 E.507.

Corneal biomechanics in different age groups.

To report on the corneal biomechanical characteristics, namely the corneal hysteresis (CH), corneal resistance factor (CRF), as well as the intraocular pressure (IOP) goldman compensated (IOPg), and the cornea compensated (IOPcc), using the ocular response analyzer (ORA) in different age groups in a cohort of normal individuals from the second decade to the seventh decade and beyond. The study was a cross-sectional survey conducted on 997 eyes of 508 normal individuals presenting for a routine ophthalmic examination at Alexandria Main University Hospital in Alexandria University, Alexandria, Egypt. The study subjects were age stratified into decades (10-20, 21-30, 31-40, 41-50, > 50) and the ORA parameters (CH, CRF, IOPg, IOPcc) reported and stratified. Correlations were sought between the ORA parameters and the age, gender, and laterality. The study was conducted on 997 (502 right) eyes of 508 (234 males) normal individuals. The mean ± SD ages of the study groups were 14.7 ± 3.2, 25.9 ± 3.0, 35.3 ± 2.8, 44.6 ± 2.9, and 61.1 ± 7.7years. The mean ± SD of the CH in the study groups were 10.9 ± 2.4, 9.8 ± 1.5, 9.8 ± 1.4, 9.7 ± 1.7, and 9.5 ± 1.6mmHg and of the CRF were 10.9 ± 2.4, 9.5 ± 1.7, 9.4 ± 1.8, 9.6 ± 1.9, and 9.6 ± 1.8mmHg. A statistically significant negative correlation was found between age and each of CH and CRF. IOPcc demonstrated a fairly constant trend in the different age groups whereas IOPg demonstrated an initial decline followed by a gradual rise over time. The corneal biomechanical properties CH and CRF decrease with age. IOPg and IOPcc change minimally with age.

Safety and efficacy of topically administered netarsudil (Rhopressa™) in normal and glaucomatous dogs with ADAMTS10-open-angle glaucoma (ADAMTS10-OAG).

To evaluate safety and efficacy of topically administered 0.02% netarsudil ophthalmic solution (Rhopressa™; Aerie Pharmaceutical) in normal and glaucomatous dogs with ADAMTS10-open-angle glaucoma (ADAMTS10-OAG). Five normal and 5 glaucomatous Beagle dogs with ADAMTS10-OAG. In each dog, left or right eye was randomly selected for netarsudil treatment. Contralateral eyes were sham-treated with balanced salt solution (BSS). Following a 1-week baseline period, dogs were treated once daily (q24h) during week 2, and twice daily (q12h) during week 3; week 4 served as washout period. Efficacy was measured by diurnal intraocular pressure (IOP) and pupil diameter. Safety was assessed by routine ophthalmic examination, gonioscopy, and pachymetry. Differences in least square means of quantitative outcome measures were compared between netarsudil and BSS sham-treated eyes by linear Gaussian model. Baseline IOPs were 18.5±0.5mmHg (mean±SEM) in normal and 27.8±1.0mmHg in OAG dogs. Even though mean IOPs were lower in netarsudil- vs sham-treated eyes, the overall differences were neither significant nor clinically relevant, regardless of treatment frequency (q24h-normal: sham 16.4±1.1mmHg vs treatment 15.6±1.0mmHg; q24hr-OAG: sham 25.8±2.3mmHg vs. treatment 25.7±2.4mmHg; q12hr-normal: sham 15.4±0.8mmHg vs. treatment 14.4±0.8mmHg; q12hr-OAG: sham 26.3±1.7mmHg vs. treatment 25.4±1.8mmHg). Netarsudil administration was well tolerated but resulted in significant, moderate-to-severe conjunctival hyperemia (P<.001). Once or twice daily administration of netarsudil resulted in marginal and clinically irrelevant IOP decreases in normal and OAG-affected dogs. Except for conjunctival hyperemia, the drug was well tolerated.