Roots Of Zea Mays Research Articles

Zeaamine, a new amine from roots of Zea mays and its cytotoxic activity against CT26 and SW480 cell lines

A new amine, zeaamine (1), along with nine known compounds (2-10), were isolated from the roots of Zea mays. Among these, compound 2 was first isolated from this plant, and compound 3 was first isolated from the roots. In the current investigation, the cytotoxicity against CT26 and SW480 cells of the compounds were evaluated. Zeaamine (1) exhibited moderately affected CT26 and SW480 cells with IC50 values of 17.91 and 10.21 µM.

Two New Alkaloids from Roots of Zea mays and Their Cytotoxic Activity against Hep3B and SW480 Cells.

Two undescribed alkaloids, along with seven known compounds, were isolated from the roots of Zea mays (RM). Their chemical structures were elucidated based on extensive analyses of HR-ESI-MS, 1D and 2D NMR, and CD spectra. Two new alkaloids exhibited moderate inhibition of Hep3B (IC50 values of 11.7±2.4 and 14.2±3.6 μM) and SW480 cells (IC50 values of 33.4±8.2 and 47.3±5.8 μM) compared to that of the positive control compound, Oxaliplatin, IC50 value of 8.4±1.7 and 45.8±5.6 μM, respectively.

Regulation of salt tolerance in the roots of Zea mays by L-histidine through transcriptome analysis.

Soil salinization is an important worldwide environmental problem and the main reason to reduce agricultural productivity. Recent findings suggested that histidine is a crucial residue that influences the ROS reduction and improves the plants' tolerance to salt stress. Herein, we conducted experiments to understand the underlying regulatory effects of histidine on maize root system under salt stress (100 mM NaCl solution system). Several antioxidant enzymes were determined. The related expressed genes (DEGs) with its pathways were observed by Transcriptome technologies. The results of the present study confirmed that histidine can ameliorate the adverse effects of salt stress on maize root growth. When the maize roots exposed to 100 mM NaCl were treated with histidine, the accumulation of superoxide anion radicals, hydrogen peroxide, and malondialdehyde, and the content of nitrate nitrogen and ammonium nitrogen were significantly reduced; while the activities of superoxide dismutase, peroxidase, catalase, nitrate reductase, glutamine synthetase, and glutamate synthase were significantly increased. Transcriptome analysis revealed that a total of 454 (65 up-regulated and 389 down-regulated) and 348 (293 up-regulated and 55 down-regulated) DEGs were observed when the roots under salt stress were treated with histidine for 12 h and 24 h, respectively. The pathways analysis of those DEGs showed that a small number of down-regulated genes were enriched in phytohormone signaling and phenylpropanoid biosynthesis at 12 h after histidine treatment, and the DEGs involved in the phytohormone signaling, glycolysis, and nitrogen metabolism were significantly enriched at 24 h after treatment. These results of gene expression and enzyme activities suggested that histidine can improve the salt tolerance of maize roots by enriching some DEGs involved in plant hormone signal transduction, glycolysis, and nitrogen metabolism pathways.

Highlighting Mycorrhizal Structures in Roots of Zea mays L.


 Agriculture is one of the key economic activities designed to provide food for a growing population. It is expected that 21st-century agriculture will try to reduce the number of fertilizers by using microorganisms, in this category arbuscular mycorrhizas representing a complex set of benefits for plants and ecosystem services. The aim of this paper is to identify the mycorrhizal structures present in the roots of Zea mays. The objectives of the research are: i) are mycorrhizae natively present in the corn root and have a constant presence from the first stages of plant development? and ii) what kind of colonization pattern is characteristic of these roots? Maize has prominent fasciculate roots, and due to its intense branching capacity provides increased biological support for the establishment of mycorrhizal symbionts. Within the fungal structures highlighted, the most prominent were arbuscules and vesicles. Arum-type arbuscules were mostly observed, Paris-type arbuscules being less common in this species. Vesicles have a low frequency in the root cortex. They are present only in the early stages of plant development. Vesicular-arbuscular mycorrhizae are present in the root of the Zea mays plant with a constant presence, without major fluctuations.

Maizediterpene D from the roots of Zea mays L. alleviates hydrogen peroxide induced oxidative stress and improves cell survival by activation of TrkB/IGF-1R crosstalk pathways

The ent-kaurane diterpenoid enriched fraction (EDEF) of maize root was isolated and purified, and 10 compounds, including 4 ent-kaurane diterpenoids, were isolated and identified. We evaluated their neuroprotective properties in vitro for the first time using an H2O2-induced oxidative damage model in SH-SY5Y cells. The results showed that pretreatment with maizediterpene D, a new ent-kaurane diterpenoid isolated from the EDEF, significantly attenuated H2O2-induced apoptosis by improving cell survival, reducing ROS production and increasing mitochondrial membrane potential. Mechanistically, the neuroprotective effect of maizediterpene D was confirmed to be related to the dual activation of IGF-1R and BDNF/TrkB crosstalk pathways. Our findings suggest that the EDEF and its active constituent maizediterpene D had good neuroprotective properties and could serve as potential candidates for the development of therapeutic drugs for oxidative stress-related diseases.

Comparative organization of tubulin microtubules in root cells of Zea mays (Poaceae) and Beta vulgaris (Chenopodiaceae s. str. / Amaranthaceae s. l.) under the influence of clinorotation

In order to identify the mechanism of functioning of the tubulin cytoskeleton, we have investigated the impact of clinorotation on cortical microtubules organization in the process of cell differentiation in growth zones of plant roots of Zea mays and Beta vulgaris. The similar organization of cortical and endoplasmic microtubules’ network in both species is noted. Clinorotation did not significantly change the organization of microtubules in meristem cells and the central elongation root zone. However, in the distal elongation zone of roots, both Z. mays and B. vulgaris expressed deviations of individual microtubules from the ordered transverse organization (at an angle greater than 45º). This deviation of the microtubules is likely caused by clinorotation and results in discoordination of root growth under these conditions. In addition, it has been found that the scope of destruction of the MT network by taxol in the root cells of both species is not dependent on clinorotation.

Ascophyllum nodosum Biostimulant Improves the Growth of Zea mays Grown Under Phosphorus Impoverished Conditions.

Phosphorous is one of the major limiting factors determining plant growth. Current agricultural practices mainly rely on the use of chemical fertilizers posing threat to the ecosystem. In this study, the application of an Ascophyllum nodosum extract (ANE) in phosphorous (P)-limited conditions improved the fresh and dry weight of shoots and roots of Zea mays. ANE-treated Z. mays grown under P-limited conditions showed a higher P content than the control. ANE activated simultaneous responses, at multiple levels, in Z. mays grown under P-limited conditions as seen from the regulation of gene expression at the whole-plant level to specific biochemical responses on a subcellular level. ANE-supplemented Z. mays grown under P-limited conditions also showed reduced electrolyte leakage and lipid peroxidation by an improved membrane stability. ANE treatment reduced P-limitation-induced oxidative damage in Z. mays by reducing H2O2 and accumulation. Furthermore, ANE also induced the accumulation of the total contents of soluble sugars, amino acids, phenolics, and flavonoids. Gene expression analysis suggested that ANE differentially modulated the expression of P-starvation responsive genes involved in metabolic, signal transduction, and developmental pathways in Z. mays. ANE also modulated the expression of genes involved in sugar, lipid, and secondary metabolism. Thus, this study illustrated the role of ANE in improving the productivity of Z. mays, an important crop, in P-limited conditions. Furthermore, it sets the framework to increase agricultural productivity in nutrient deficient soils using a sustainable, eco-friendly strategy.

Influence of graphene on the multiple metabolic pathways of Zea mays roots based on transcriptome analysis.

Graphene reportedly exerts positive effects on plant root growth and development, although the corresponding molecular response mechanism remains to be elucidated. Maize seeds were randomly divided into a control and experimental group, and the roots of Zea mays L. seedlings were watered with different concentrations (0–100 mg/L) of graphene to explore the effects and molecular mechanism of graphene on the growth and development of Z. mays L. Upon evaluating root growth indices, 50 mg/L graphene remarkably increased total root length, root volume, and the number of root tips and forks of maize seedlings compared to those of the control group. We observed that the contents of nitrogen and potassium in rhizosphere soil increased following the 50 mg/L graphene treatment. Thereafter, we compared the transcriptome changes in Z. mays roots in response to the 50 mg/L graphene treatment. Transcriptional factor regulation, plant hormone signal transduction, nitrogen and potassium metabolism, as well as secondary metabolism in maize roots subjected to graphene treatment, exhibited significantly upregulated expression, all of which could be related to mechanisms underlying the response to graphene. Based on qPCR validations, we proposed several candidate genes that might have been affected with the graphene treatment of maize roots. The transcriptional profiles presented here provide a foundation for deciphering the mechanism underlying graphene and maize root interaction.

Мікротрубочки цитоскелету у формуванні індукованої аеренхіми адвентивних коренів Zea mаys (Poaceae)

Мікротрубочки цитоскелету у формуванні індукованої аеренхіми адвентивних коренів Zea mаys (Poaceae)

Evaluation of Metaxylem Vessel Histogenesis and the Occurrence of Vessel Collapse during Early Development in Primary Roots of Zea mays ssp. mexicana: A Result of Premature Programmed Cell Death?

Root apical meristem histological organization in Zea mays has been carefully studied previously. Classical histology describes its system as having a “closed organization” and a development of xylem that conforms to predictable rules. Among the first cell types to begin differentiation are late-maturing metaxylem (LMX) vessels. As part of a larger study comparing domestic maize root development to a wild subspecies of Z. mays (teosinte), we encountered a metaxylem development abnormality in a small percentage of our specimens that begged further study, as it interrupted normal maturation of LMX. Primary root tips of young seedlings of Zea mays ssp. mexicana were fixed, embedded in appropriate resins, and sectioned for light and transmission electron microscopy. Longitudinal and serial transverse sections were analyzed using computer imaging to determine the position and timing of key xylem developmental events. We observed a severe abnormality of LMX development among 3.5% of the 227 mexicana seedlings we screened. All LMX vessel elements in these abnormal roots collapsed and probably became non-functional shortly after differentiation began. Cytoplasm and nucleoplasm in the abnormal LMX elements became condensed and subdivided into irregularly-shaped “macrovesicles” as their cell walls collapsed inward. We propose that these seedlings possibly suffered from a mutation that affected the timing of the programmed cell death (PCD) that is required to produce functional xylem vessels, such that autolysis of the cytoplasm was prematurely executed, i.e., prior to the development and lignification of secondary walls.

Effect of purified alkaline phosphatase from Bacillus licheniformis on growth of Zea mays L.

Some soil microbes have the capability to solubilize mineral phosphate into organic phosphorous and used as biofertilizer to improve crop productivity in agricultural field. In this study, phosphate solubilization assay was carried out onto media plates containing calcium phsophate precipitated nutrient agar media for bacterial strains like Bacillus megaterium MTCC 453, Bacillus subtilis MTCC 1134, Bacillus licheniformis MTCC 2312, Pseudomonas aeruginosa MTCC 424, Escherichia coli MTCC 570. Among these bacterial strains, B. licheniformis MTCC 2312 showed largest clear zone of phosphate solubilzation and maximum activity of alkaline phosphatase. The enzyme alkaline phosphatase was purified from B. licheniformis MTCC 2312 with purification fold 3.52 and specific activity 295.89 Unit/mg protein using DEAE-sepharose chromatography. This enzyme showed molecular weight as 60 KD, thermostability upto 50?C, pH stability up to 8.5 and Michaelis constant (Km) and maximum activity (Vmax) as 2.30 mM and 2223 U/ml respectively. The lyophilized powder of this enzyme was further supplemented with media components for the growth of Zea mays for carrying tissue culture experiment. The sterilized soil supplemented with alkaline phosphatase improved the total height, dry weight, % phosphate content in the stem and root of Zea mays by 3.07, 3.15, 2.35 and 1.76 fold respectively compared to control set. This enzyme could be used at large extent as effective biofertilizer for the agricultural industry.

Antiproliferative ent-kaurane diterpenoids isolated from the roots of Zea mays L.

Four new ent-kaurane diterpenoid maizediterpenes A-D (1–4), along with fourteen known compounds were isolated from the roots of Zea mays (maize). Compounds 7, 15, 16 were isolated from this genus for the first time. The planar structures of the new compounds were determined by extensive analysis of their NMR and HR-ESI-MS spectra, and the absolute configurations were established on the basis of specific rotation in association with calculated ECD spectra. Compounds 2, 6 and 18 showed significant antiproliferative effects against five human cancer cell lines (A549, MDA-MB-231, SK-Hep-1, SNU638, HCT116) with IC50 values ranging from 1.99 ± 0.41 μM to 15.18 ± 1.17 μM.

Zeasesquiterpene A-E, new sesquiterpenes from the roots of Zea mays

Zeasesquiterpene A-E (1–5), five new sesquiterpenes with two cyclohexanes, were isolated from the roots of Zea mays. Their structures were elucidated on the basis of 1D and 2D NMR spectral data and ECD analysis. A plausible biosynthetic pathway for the compounds (1–6) were hypothesized. All isolated compounds were screened for cytotoxicities against five human cancer cell lines (A549, MDA-MB-231, SK-Hep-1, SNU638 and HCT116) in vitro by MTT assay. Compound 4 showed potential cytotoxic activities against A549 (14.3 μΜ) and SNU638 (9.7 μΜ). By contrast, compound 1 exhibited moderate cytotoxicity to the four human cancer cell lines (A549, SK-Hep-1, SUN638 and HCT116), and the IC50 values are from 19.5 μΜ to 22.5 μΜ.

Growth is required for perception of water availability to pattern root branches in plants

Water availability is a potent regulator of plant development and induces root branching through a process termed hydropatterning. Hydropatterning enables roots to position lateral branches toward regions of high water availability, such as wet soil or agar media, while preventing their emergence where water is less available, such as in air. The mechanism by which roots perceive the spatial distribution of water during hydropatterning is unknown. Using primary roots of Zea mays (maize) we reveal that developmental competence for hydropatterning is limited to the growth zone of the root tip. Past work has shown that growth generates gradients in water potential across an organ when asymmetries exist in the distribution of available water. Using mathematical modeling, we predict that substantial growth-sustained water potential gradients are also generated in the hydropatterning competent zone and that such biophysical cues inform the patterning of lateral roots. Using diverse chemical and environmental treatments we experimentally demonstrate that growth is necessary for normal hydropatterning of lateral roots. Transcriptomic characterization of the local response of tissues to a moist surface or air revealed extensive regulation of signaling and physiological pathways, some of which we show are growth-dependent. Our work supports a "sense-by-growth" mechanism governing hydropatterning, by which water availability cues are rendered interpretable through growth-sustained water movement.

Oxidative enzymes activity during abiotic and biotic stresses in Zea mays leaves and roots exposed to Cu, methyl jasmonate and Trigonotylus caelestialium.

The activities of antioxidative enzymes, i.e. superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and guaiacol peroxidase (GPX), in the leaves and roots of Zea mays L. plants exposed to abiotic (methyl jasmonate, MJ, or/and copper, Cu) and biotic (Trigonotylus caelestialium) factors were examined. The contribution of MJ as a signal molecule in the defense mechanism against abiotic and biotic stresses was studied. All plants were cultivated hydroponically and divided into three groups: not treated by abiotic factors (control), treated by MJ only (MJ) and by MJ and Cu (MJ+Cu) and in each group half of the plants were exposed to T. caelestialium attack. The enzymatic activities of SOD, CAT, APX, and GPX in the leaves were higher in the insect-treated than non-insect-treated control plants, but lower in both MJ+Cu- or MJ- and insect-treated plants. In the roots, the enzyme activities were elevated in all insect-treated plants with the highest rise in MJ+Cu, in comparison with the MJ-treated plants. The results showed that MJ and MJ+Cu were efficient in reducing the activity of the antioxidative enzymes in the leaves under the insect influence by elevating enzyme activity in the roots.

Fluorescence microscopy as a tool for visualization of metal-induced oxidative stress in plants

Various fluorescence reagents are often used for the detection of oxidative stress, but more extensive comparison in the same study is rather rare. We tested five ROS-related and two non-ROS-related reagents in the roots of Zea mays germinated and growing in 1 or 100 µM cadmium-enriched solution. Namely, “general” ROS (CellROX Deep Red reagent and 2′,7′-dichlorodihydrofluorescein diacetate), hydrogen peroxide (Amplex UltraRed), superoxide radical (dihydroethidium), hydroxyl radical/peroxynitrite (aminophenyl fluorescein), nitric oxide (1,2-diaminoanthraquinone), and glutathione/-SH (monochlorobimane) indicators were tested. Both Cd doses stimulated signal of various ROS often extensively compared to control and mainly H2O2 differed between 1 and 100 µM Cd. Signal of ROS was clearly visible in exodermis and vascular tissue through which cadmium is transported via transpiration stream. CellROX Deep Red reagent gives bright and clear signal on the root cross sections. The standard spectrophotometry (detection of H2O2 and superoxide) did not reveal differences between control and 1 µM Cd, indicating that fluorescence microscopy is more sensitive to detect low change in oxidative balance. Nitric oxide and glutathione/-SH signal was less different between control and Cd treatments, indicating their contribution to metal tolerance. Cd accumulation and translocation and the use of reagents under the excess of other metals are also discussed.

Rhizobium zeae sp. nov., isolated from maize (Zea mays L.) roots.

A bacterial strain designated CRZM18RT was isolated from a root of Zea mays in Spain. The analysis of the 16S rRNA gene sequence showed that this strain belongs to the genus Rhizobium, with Rhizobium cellulosilyticum ALA10B2T and Rhizobium yantingense H66T being the most closely related species with 98.3 and 97.9 % sequence similarity, respectively. The analysis of the concatenated recA and atpD genes showed that strain CRZM18RT forms a cluster with these species and also with Rhizobiumsmilacinae PTYR-5T, but the recA and atpD genes of strain CRZM18RT were phylogenetically distant, with identities lower than 90 and 96 %, respectively. DNA-DNA hybridization analysis showed mean relatedness of 43, 22 and 38 % with respect to R. cellulosilyticum ALA10B2T, R. yantingense LMG 28229T and R. smilacinae LMG 27604T. Phenotypic characteristics also differed from those of the most closely related species of the genus Rhizobium. The major fatty acids were those from summed feature 8 (C18 : 1ω6c/C18 : 1ω7c) and C16 : 0. Based on the genotypic, chemotaxonomic and phenotypic data obtained in this study, we propose to classify strain CRZM18RT in a novel species named Rhizobium zeae sp. nov. (type strain CRZM18RT=LMG 29735T=CECT 9169T).

Characterization of moaC and a nontarget gene fragments of food‐borne pathogen Alcaligenes sp. JG3 using degenerate colony and arbitrary PCRs

AbstractAlcaligenes faecalis, is an opportunistic, pathogenic, Gram‐negative, food‐borne bacterium appearing to be of public health importance due to its resistance to common antibiotics and frequent involvement in nosocomial infections and water contamination. Yet, the Betaproteobacterium showed potential benefit in fat degradation of food waste. It is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. In this study, a degenerate colony and an arbitrary PCR‐based methods were involved in gene isolation steps. We designed a pair of degenerate primers to detect moaC (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) and two gene specific primers to amplify 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) ends of glpD of strain JG3 using degenerate colony and arbitrary PCR methods, respectively. The developed degenerate colony PCR resulted amplification of targeted 421‐bp DNA, while the set arbitrary PCR resulted in non‐targeted 436‐bp DNA. Deduced amino acid analysis showed that both sequences shared 94% amino acid similarity with molybdenum cofactor biosynthesis (MoaC) of Pseudomonas stutzeri and benzoate membrane transporter (BenE) of A. faecalis, respectively.Practical applicationsIt is suggested that pterin‐based Molybdenum cofactor (Moco) biosynthesis involving moa gene is related with the pathogenesis of several Gram‐negative bacteria, while in addition to lipase genes, glycerol coding genes including glpD are involved in effective degradation of fat waste. However, information about these genes in pathogenic, food‐borne, Gram‐negative Alcaligenes sp. JG3 bacterium originated from root of Zea mays is barely found. A pair of degenerate primers (GMF: 5′‐ATCGGCATCACCAACCAGC‐3′ and GMR: 5′‐TGTCGATGGTGCCGAAGC‐3′) designed in this study could detect 421‐bp moaC gene fragment using degenerate colony PCR, while another pair of gene specific primers 5′ (5′‐TGATGAATGTTCCGTTGCGCTGCC‐3′) and 3′ (5′‐GACCTGCAGGCATGCAAGCTCGGC‐3′) aiming to amplify ends of glpD of Alcaligenes sp. JG3 detected a nontargeted, 436‐bp benE gene of the strain using an arbitrary PCR method.

Effect of chelating agents on phytoextraction of Ni from contaminated Soil by Zea mays

The effects of application of CDTA, (CA), DTPA, NTA and FYM on the growth of Zea mays and its Ni uptake and accumulation were investigated using the pot-culture experiments. Application of chelating agents decreased the dry matter yield of roots of Zea mays while, higher values of dry matter yield (11.35 g pot-1) was observedin case of FYM sewage sludge amended soil at 80 days after sowing. FYM addition was found beneficial as compared to control (Ni90). Dry matter yield of shoots of Zea mays increased over control due to application of CDTA and FYM. The highest value of dry matter yield of shoot (86.05 g pot-1) was observed in case of CDTA withsewage sludge amended soil at 80 days after sowing. Whereas reverse trend was observed in NTA, CA and DTPA treated soils. Chelating agents enhanced the Ni uptake by both roots and shoots, higher values of Ni uptake by roots (3415.44 ?g pot-1 ) and shoots (10104.98 ?g pot-1 ) Was observed in NTA and CDTA treated soil after 80 days of sowing in amended as compared to sewage sludge unamended soil. Application of CDTA followed by NTA was found more effective in enhancing the Ni uptake by Zea mays roots and shoots than any other chelating agents at both the growth stages. The chelating agents are found useful in enhancing phytoextractability of Ni by Zea mays. Hence, marginally Ni contaminated soil may be remediated by adding chelating agents.

Grasses suppress shoot-borne roots to conserve water during drought

Many important crops are members of the Poaceae family, which develop root systems characterized by a high degree of root initiation from the belowground basal nodes of the shoot, termed the crown. Although this postembryonic shoot-borne root system represents the major conduit for water uptake, little is known about the effect of water availability on its development. Here we demonstrate that in the model C4 grass Setaria viridis, the crown locally senses water availability and suppresses postemergence crown root growth under a water deficit. This response was observed in field and growth room environments and in all grass species tested. Luminescence-based imaging of root systems grown in soil-like media revealed a shift in root growth from crown-derived to primary root-derived branches, suggesting that primary root-dominated architecture can be induced in S. viridis under certain stress conditions. Crown roots of Zea mays and Setaria italica, domesticated relatives of teosinte and S. viridis, respectively, show reduced sensitivity to water deficit, suggesting that this response might have been influenced by human selection. Enhanced water status of maize mutants lacking crown roots suggests that under a water deficit, stronger suppression of crown roots actually may benefit crop productivity.