Root-knot Nematode Meloidogyne Hapla Research Articles

Efficiency of the fungi isolated from the tomato rhizosphere to control the north root-knot nematode Meloidogyne hapla Chitwood 1949

Abstract Background In the South of Russia, due to the large acreage of tomato crops (Solanum lycopersicum Mill.), there is an acute problem of plant protection against the obligate endoparasitic of the root system Meloidogyne hapla Chitwood 1949. The aim of this study was to assess the nematicidal activity of fungal strains isolated from the rhizosphere of tomato plants infected with root-knot nematodes (RKN) (Meloidogyne spp.). Results After conducting route surveys, 10 soil samples were selected from the rhizosphere of tomato plants affected by RKN. Fifteen isolates of fungi belonging to different species were isolated from the soil samples. The species composition of the isolated fungal strains was determined: Metarhizium anisopliae IG01, Penicillium citrinum IG02, Trichoderma harzianum IG03, Aspergillus niger IG04, Trichoderma ghanense IG05, Trichoderma harzianum IG06, Trichoderma atroviride IG07, Aspergillus awamori IG08, Trichoderma atroviride IG09, Paramyrothecium roridum IG10, Trichoderma atroviride IG11, Trichoderma hamatum IG12, Beauveria bassiana IG13, Aspergillus ochraceus IG14, Purpureocillium lilacinum IG15. After initial screening in the laboratory, strains with the greatest nematicidal activity and safe for humans were selected: M. anisopliae ИГ01, T. harzianum IG03, T. ghanense IG05, T. atroviride IG07, T. atroviride IG09. The mortality rate of RKN when using these fungal strains varied from 79.4 ± 1.8 to 93.9 ± 3.1%. In the greenhouse, the fungal strains M. anisopliae IG01, T. harzianum IG03, T. ghanense IG05, T. atroviride IG07, T. atroviride IG09 showed high results in reducing the number of galls on the roots of tomato plants, and their biological efficacy was 71.4–83.0%. Conclusion Work on the study of the nematicidal activity of fungi, in vitro and in vivo, allows us to conclude that strains isolated from the rhizosphere of plants can be effective in combating the north RKN (M. hapla). In the future, it is planned to establish the compatibility of M. anisopliae IG01, T. harzianum IG03, T. ghanense IG05, T. atroviride IG07, T. atroviride IG09 with each other and selecting the ratios of the studied strains to obtain mixtures to create an effective biological nematicide.

Impact of Vineyard Fallow Practices on Reducing Meloidogyne hapla Population Densities

The northern root-knot nematode (Meloidogyne hapla) is a common plant-parasitic nematode in northern grape production regions. This nematode induces small galls on roots, which restricts water and nutrient uptake, resulting in poor vine establishment or exacerbated decline in stressed vines. A study was conducted to explore the impacts of site management practices on M. hapla population densities following removal of wine grape (Vitis vinifera) vineyards in Washington State. Soil was collected from 38 fields, M. hapla second-stage juvenile densities in soil were determined, and to assist in identifying M. hapla in potentially low-population density samples, an eight week-long tomato (Solanum lycopersicum) bioassay was conducted. Vineyard managers also provided information on site management techniques. Of the 20 total management techniques and combinations explored (e.g., fallow duration, cover crops, mowing, irrigation, herbicide applications), only one component resulted in lower M. hapla population densities: duration of vine-free period. A duration of at least one-year post vineyard removal showed a decline in M. hapla population densities in the sampled former vineyard sites. These results suggest that a fallow period could be useful as a non-chemical management tool for M. hapla in vineyard replant soils. However, consideration of additional site management factors such as weed management, soil series and amendments, interim crop planting, and irrigation or accumulated rainfall that may support M. hapla development is necessary.

Wild strawberry Fragaria vesca as potential source for phytonematode resistance

AbstractPhytonematode infections are a major constraint to agriculture and can cause pre-harvest losses of up to one-third of the crop in affected fields. With increasing restrictions on the use of chemical pesticides due to environmental and human hazards, and increasing nematode pressure due to climate change, soil degradation and agricultural intensification, more sustainable ways to manage such plant pests are needed to meet the growing demand for food. Therefore, the reproduction of thermophilic Meloidogyne spp. was evaluated in comparison with that of the northern root-knot nematode Meloidogyne hapla on the wild strawberry Fragaria vesca vs. semperflorens cv. Alexandria, a potential source of resistance to nematode infection. M. hapla showed a high reproductive rate in F. vesca, while the thermophilic Meloidogyne species tested showed significant lower reproductive rates. This suggests that F. vesca vs. semperflorens cv. Alexandria, although not resistant to the nematode species tested, could be used in a management system to down-regulate nematode pressure. In addition, this study helps to reinforce the importance of crop wild relatives in the search for resistance traits to support a more sustainable agriculture.

Biological enhancement of the cover crop Phacelia tanacetifolia (Boraginaceae) with the nematophagous fungus Pochonia chlamydosporia to control the root-knot nematode Meloidogyne hapla in a succeeding tomato plant

Root-knot nematodes cause global economic losses in a wide range of crops. We investigated the potential of seed coatings of the cover crop Phacelia tanacetifolia (Boraginaceae) when inoculated with the nematophagous fungus Pochonia chlamydosporia (Hypocreales: Clavicipitaceae) to protect subsequently grown tomato plants from root galling caused by the root-knot nematode Meloidogyne hapla (Tylenchida: Meloidogynidae). Therefore, seeds of P. tanacetifolia were coated with P. chlamydosporia blastospores and planted in M. hapla-infested pots. After 50 days of growth in infested soil, M. hapla eggs were extracted from P. tanacetifolia roots and quantified. Tomato plants grown in the remaining soil served as bioindicator of M. hapla infestation as expressed by the gall index. Results showed that seed coating of P. tanacetifolia with P. chlamydosporia (290 ± 51 CFU per seed) reduced the number of M. hapla eggs up to 95.6% in comparison to untreated controls. Pochonia chlamydosporia as blastospore suspension (5·108 blastospores per 600 ml soil) reduced the number of M. hapla eggs by up to 75.5%. Additionally, tomato plants grown for 50 days in substrates previously planted with P. tanacetifolia seeds coated with P. chlamydosporia showed a significantly lower gall index than plants grown in untreated pots. In conclusion, biological enhancement of P. tanacetifolia by seed coating with P. chlamydosporia successfully reduced M. hapla and thus provides an additional tool in the management of this nematode. The method still has potential for further improvement such as increasing blastospore viability within the seed coating by optimized formulation technology.

Characterizing microbial communities associated with northern root-knot nematode (Meloidogyne hapla) occurrence and soil health.

The northern root-knot nematode (Meloidogyne hapla) causes extensive damage to agricultural crops globally. In addition, M. hapla populations with no known genetic or morphological differences exhibit parasitic variability (PV) or reproductive potential based on soil type. However, why M. hapla populations from mineral soil with degraded soil health conditions have a higher PV than populations from muck soil is unknown. To improve our understanding of soil bio-physicochemical conditions in the environment where M. hapla populations exhibited PV, this study characterized the soil microbial community and core- and indicator-species structure associated with M. hapla occurrence and soil health conditions in 15 Michigan mineral and muck vegetable production fields. Bacterial and fungal communities in soils from where nematodes were isolated were characterized with high throughput sequencing of 16S and internal transcribed spacer (ITS) rDNA. Our results showed that M. hapla-infested, as well as disturbed and degraded muck fields, had lower bacterial diversity (observed richness and Shannon) compared to corresponding mineral soil fields or non-infested mineral fields. Bacterial and fungal community abundance varied by soil group, soil health conditions, and/or M. hapla occurrence. A core microbial community was found to consist of 39 bacterial and 44 fungal sub-operational taxonomic units (OTUs) across all fields. In addition, 25 bacteria were resolved as indicator OTUs associated with M. hapla presence or absence, and 1,065 bacteria as indicator OTUs associated with soil health conditions. Out of the 1,065 bacterial OTUs, 73.9% indicated stable soil health, 8.4% disturbed, and 0.4% degraded condition; no indicators were common to the three categories. Collectively, these results provide a foundation for an in-depth understanding of the environment where M. hapla exists and conditions associated with parasitic variability.

Volatile Organic Compounds of Bacillus velezensis GJ-7 against Meloidogyne hapla through Multiple Prevention and Control Modes.

The Bacillus velezensis GJ-7 strain isolated from the rhizosphere soil of Panax notoginseng showed high nematicidal activity and therefore has been considered a biological control agent that could act against the root-knot nematode Meloidogyne hapla. However, little was known about whether the GJ-7 strain could produce volatile organic compounds (VOCs) that were effective in biocontrol against M. hapla. In this study, we evaluated the nematicidal activity of VOCs produced by the fermentation of GJ-7 in three-compartment Petri dishes. The results revealed that the mortality rates of M. hapla J2s were 85% at 24 h and 97.1% at 48 h after treatment with the VOCs produced during GJ-7 fermentation. Subsequently, the VOCs produced by the GJ-7 strain were identified through solid-phase micro-extraction gas chromatography mass spectrometry (SPME-GC/MS). Six characteristic VOCs from the GJ-7 strain fermentation broth were identified, including 3-methyl-1-butanol, 3-methyl-2-pentanone, 5-methyl-2-hexanone, 2-heptanone, 2,5-dimethylpyrazine, and 6-methyl-2-heptanone. The in vitro experimental results from 24-well culture plates showed that the six volatiles had direct-contact nematicidal activity against M. hapla J2s and inhibition activity against egg hatching. In addition, 3-methyl-1-butanol and 2-heptanone showed significant fumigation effects on M. hapla J2s and eggs. Furthermore, all six of the VOCs repelled M. hapla J2 juveniles in 2% water agar Petri plates. The above data suggested that the VOCs of B. velezensis GJ-7 acted against M. hapla through multiple prevention and control modes (including direct-contact nematicidal activity, fumigant activity, and repellent activity), and therefore could be considered as potential biocontrol agents against root-knot nematodes.

Northern root-knot nematode Meloidogyne hapla Chitwood, 1949 infecting Kiwi fruit (Actinidia chinensis) in Bageshwar district of Uttarakhand state

Northern root-knot nematode Meloidogyne hapla Chitwood, 1949 infecting Kiwi fruit (Actinidia chinensis) in Bageshwar district of Uttarakhand state

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Atractylodes lancea in Hubei Province, China.

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 μm (578.75 - 902.65 μm), maximum body width (W) = 471.97 ± 70.95 μm (318.7 - 586.3 μm), stylet length = 15.18 ± 0.96 μm (13.52 - 17.04 μm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 μm (2.60 - 3.80μm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 μm (375.3 - 552.5 μm), stylet length =12.59 ± 1.39 μm (10.5 - 16.8 μm), tail length= 53.35 ± 1.55 μm (51.8 - 54.9 μm), hyaline tail terminus =11.45 ± 0.65 μm (10.2 - 12.1 μm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

Mutation-driven evolution of antibacterial function in an ancestral antifungal scaffold: Significance for peptide engineering.

Mutation-driven evolution of novel function on an old gene has been documented in many development- and adaptive immunity-related genes but is poorly understood in immune effector molecules. Drosomycin-type antifungal peptides (DTAFPs) are a family of defensin-type effectors found in plants and ecdysozoans. Their primitive function was to control fungal infection and then co-opted for fighting against bacterial infection in plants, insects, and nematodes. This provides a model to study the structural and evolutionary mechanisms behind such functional diversification. In the present study, we determined the solution structure of mehamycin, a DTAFP from the Northern root-knot nematode Meloidogyne hapla with antibacterial activity and an 18-mer insert, and studied the mutational effect through using a mutant with the insert deleted. Mehamycin adopts an expected cysteine-stabilized α-helix and β-sheet fold in its core scaffold and the inserted region, called single Disulfide Bridge-linked Domain (abbreviated as sDBD), forms an extended loop protruding from the scaffold. The latter folds into an amphipathic architecture stabilized by one disulfide bridge, which likely confers mehamycin a bacterial membrane permeability. Deletion of the sDBD remarkably decreased the ability but accompanying an increase in thermostability, indicative of a structure-function trade-off in the mehamycin evolution. Allosteric analysis revealed an interior interaction between the two domains, which might promote point mutations at some key sites of the core domain and ultimately give rise to the emergence of antibacterial function. Our work may be valuable in guiding protein engineering of mehamycin to improve its activity and stability.

Herbivory modifies plant symbiont number and impact on host plant performance in the field.

Species interactions are a unifying theme in ecology and evolution. Both fields are currently moving beyond their historical focus on isolated pairwise relationships to understand how ecological communities affect focal interactions. Additional species can modify both the number of interactions and the fitness consequences of each interaction (i.e., selection). Although only selection affects the evolution of the focal interaction, the two are often conflated, limiting our understanding of the evolution of multispecies interactions. We manipulated aboveground herbivory on the legume Medicago lupulina in the field and quantified its effect on number of symbionts and the per-symbiont impact on plant performance in two belowground symbioses: mutualistic rhizobia bacteria (Ensifer meliloti) and parasitic root-knot nematodes (Meloidogyne hapla). We found that herbivores modified the number of rhizobia nodules, as well as the benefit per nodule. However, each effect was specific to a distinct herbivory regime: natural herbivory affected nodule number, whereas leafhoppers (Cicadellidae) weakened the per nodule benefit. We did not detect any effect of herbivory on nematode gall number or the cost of infection. Our data demonstrate that distinguishing between symbiont number from the fitness consequences of symbiosis is crucial to accurately infer how pairwise interactions will evolve in a community.

Development of Loop-Mediated Isothermal Amplification Assay for Rapid Detection and Analysis of the Root-Knot Nematode Meloidogyne hapla in Soil

Soil analysis is crucial for estimating the risk of crop damage by the root-knot nematode Meloidogyne hapla. Here, we developed an analysis assay based on Loop-mediated Isothermal Amplification (LAMP). The LAMP primers were verified for specificity against 10 different nematode species. A manual soil DNA extraction, referred to as SKMM, was developed and compared with a FastDNA kit followed by DNA purification. DNA was extracted with both methods from artificially inoculated soils as well as from naturally infested soil collected from farm fields. The primers exclusively amplified DNA from M. hapla with both colorimetric and real-time LAMP. The detection limit was 193 gene copies and 0.0016 juveniles (12 pg µL−1) per reaction. DNA concentrations and purity (A260/A230) were significantly higher using the SKMM procedure compared with the kit. From the field samples collected in 2019, DNA was amplified from 16% of samples extracted with SKMM and from 11% of samples using the kit. Occurrence of M. hapla DNA was confirmed in soil samples from two out of six field soils in 2020 using both real-time LAMP and qPCR. In conclusion, the developed real-time LAMP is a fast and specific assay for detection and quantification of M. hapla DNA in soil.

The soil microbiome increases plant survival and modifies interactions with root endosymbionts in the field.

Evidence is accumulating that the soil microbiome—the community of microorganisms living in soils—has a major effect on plant traits and fitness. However, most work to date has taken place under controlled laboratory conditions and has not experimentally disentangled the effect of the soil microbiome on plant performance from the effects of key endosymbiotic constituents. As a result, it is difficult to extrapolate from existing data to understand the role of the soil microbiome in natural plant populations. To address this gap, we performed a field experiment using the black medick Medicago lupulina to test how the soil microbiome influences plant performance and colonization by two root endosymbionts (the mutualistic nitrogen‐fixing bacteria Ensifer spp. and the parasitic root‐knot nematode Meloidogyne hapla) under natural conditions. We inoculated all plants with nitrogen‐fixing bacteria and factorially manipulated the soil microbiome and nematode infection. We found that plants grown in microbe‐depleted soil exhibit greater mortality, but that among the survivors, there was no effect of the soil microbiome on plant performance (shoot biomass, root biomass, or shoot‐to‐root ratio). The soil microbiome also impacted parasitic nematode infection and affected colonization by mutualistic nitrogen‐fixing bacteria in a plant genotype‐dependent manner, increasing colonization in some plant genotypes and decreasing it in others. Our results demonstrate the soil microbiome has complex effects on plant–endosymbiont interactions and may be critical for survival under natural conditions.

Deciphering bacteria associated with a pre-parasitic stage of the root-knot nematode Meloidogyne hapla in nemato-suppressive and nemato-conducive soils

Nematode-suppressive soils are characterized by the ability of soil microbial communities to reduce populations of plant-parasitic nematodes (PPN) either directly or by inducing systemic resistance in plants. Various microorganisms have been recognized as antagonists of PPN in suppressive soils using culture-dependent and culture-independent methods. However, the associations that PPN form with microorganisms in nematode-conducive soils have been poorly studied. Here we drenched tomato rhizospheres with microbial suspensions from nine different soils and followed their effects on plant growth and root invasion of the infective second-stage juveniles (J2) of the northern root-knot nematode species Meloidogyne hapla. Based on the number of invaded J2, four soils were determined as nematode-suppressive, while five soils were categorized as nematode-conducive. To reveal bacteria attached to the J2 cuticle in soils with varying suppressiveness, we incubated J2 in suspensions from three suppressive and three conducive soils, and analyzed J2-attached bacteria using amplicon sequencing of the V3-V4 region of 16S rRNA gene. Our results suggest that the soil origin had a major effect on the composition of J2-attached bacteria, while the highest bacterial abundance and richness were observed on J2 from two suppressive soils. In addition, the highest number of indicator amplicon sequence variants (ASVs) was associated with J2 in two suppressive soils, but they had a very distinct bacterial profile. Further studies are needed to resolve the complexity of nemato-microbial interactions in soil and to determine the exact function of nematode-attached microorganisms in suppressive and conducive soils and their role in nematode suppression and protection.

First report of northern root-knot nematode, Meloidogyne hapla (Chitwood, 1949) on strawberry in Turkey.

Strawberry is one of the most economically important crops worldwide. Several species of plant-parasitic nematodes have been reported to be pathogenic on strawberries, among them the northern root-knot nematode (Meloidogyne hapla), which considered to be strawberry most important nematode pest worldwide. In August 2019, strawberry growers at Silifke (Mersin, Turkey) identified nematode-like symptoms on strawberry roots and infected seedlings were brought to the nematology laboratory at of Mersin University for diagnostics. Roots were separated into small pieces and nematode extraction was performed by a modified Baermann funnel method and identified under the microscope. DNA was extracted from individual nematodes using Worm Lysis Buffer(WLB (+)). The species-specific SCAR markers (JMV1, JMV2, and JMVhapla) yielded a 440 bp band specific to M. hapla. The 28S rRNA gene region, obtained using the general primers D2\\D3, sequence was analysed from. The analyzed sequence was 100% identicle to M. hapla. The gene sequences were deposited into GenBank database with accession numbers MN897751 and MN895037. Both morphological and molecular diagnostic methods confirmed that the strawberry plants collected in Silifke were infested with M. hapla. To our best knowledge this is the first report of plant-parasitic nematode species M. hapla infecting strawberry in Turkey. Currently, the adverse effect of RKN on strawberry production in the region is unknown to strawberry growers.

Population dynamics of Hemicycliophora conida as affected by different temperatures and absence of hosts

Summary The effects of temperature and absence of a host plant on the population dynamics of the sheath nematode, Hemicycliophora conida, were studied under glasshouse conditions. Regarding temperature, population dynamics of H. conida on tomato ‘Moneymaker’ were monitored weekly over a period of 12 weeks. In the first experiment, with an average temperature of 21.4°C, population growth of H. conida continuously increased over time from an initial density of 106 nematodes (100 ml soil)−1 to a final density of 820 nematodes (100 ml soil)−1, resulting in a reproduction rate of 7.7. The time required to complete one generation was 6.5 weeks or 598 temperature degree days at 8°C base temperature (TDD8). A second experiment showed that the development of H. conida on tomato was faster at 22.1°C than at 19.0°C. At 22.1°C, one generation was completed after 6 weeks (= 588 TDD8) compared to 8 weeks (=634 TDD8) at 19.0°C. The higher temperature also resulted in a higher reproduction rate (93 at 22.1°C vs 7.8 at 19.0°C). In the absence of a host plant, the population density of H. conida decreased over time. However, this natural decline was less pronounced than for the root-knot nematode Meloidogyne hapla. In the first experiment, the population density of H. conida decreased within 18 weeks by 89.5%, while M. hapla was already no longer detectable 12 weeks after inoculation. In the second experiment, H. conida decreased by 98.2% within 16 weeks compared to 99.98% for M. hapla.

Bacteria isolated from the cuticle of plant-parasitic nematodes attached to and antagonized the root-knot nematode Meloidogyne hapla

Plant-parasitic nematodes are associated with specifically attached soil bacteria. To investigate these bacteria, we employed culture-dependent methods to isolate a representative set of strains from the cuticle of the infective stage (J2) of the root-knot nematode Meloidogyne hapla in different soils. The bacteria with the highest affinity to attach to J2 belonged to the genera Microbacterium, Sphingopyxis, Brevundimonas, Acinetobacter, and Micrococcus as revealed by 16S rRNA gene sequencing. Dynamics of the attachment of two strains showed fast adhesion in less than two hours, and interspecific competition for attachment sites. Isolates from the cuticle of M. hapla J2 attached to the lesion nematode Pratylenchus penetrans, and vice versa, suggesting similar attachment sites on both species. Removal of the surface coat by treatment of J2 with the cationic detergent CTAB reduced bacterial attachment, but did not prevent it. Some of the best attaching bacteria impaired M. hapla performance in vitro by significantly affecting J2 mortality, J2 motility and egg hatch. Most of the tested bacterial attachers significantly reduced the invasion of J2 into tomato roots, suggesting their beneficial role in soil suppressiveness against M. hapla.

How Low Can They Go? Plant-Parasitic Nematode Distribution in a Washington Vineyard

Summary Goals: To map the distribution of two plant-parasitic nematode species, the northern root-knot nematode Meloidogyne hapla and the dagger nematode Xiphinema spp., in a Washington State winegrape vineyard slated for replanting. These nematode species can reduce vineyard longevity and weaken or kill young vines. Knowing how these nematodes are spatially distributed in soil can improve implementation of management strategies. Key Findings: Northern root-knot nematode and dagger nematode had distinctly different distributions within the soil profile. Northern root-knot nematode was concentrated near the vine rows and drip-irrigation lines, in the upper 61 cm (24 inches) of the soil profile. This is reflective of its life strategy, in which association with fine roots and areas of moisture is essential. Dagger nematode was relatively evenly distributed at all distances from the vine row, and significant populations were found down to the deepest sampling depth of 122 cm (48 inches). This demonstrates that it can survive readily on hosts other than grape and can parasitize root types that are not parasitized by northern root-knot nematode. Impact and Significance: This work provides evidence for how and why nematode management practices may differ in their efficacy. Dagger nematodes were distributed throughout the sampled area and were found at depths that most fumigation efforts cannot reach. This increases the likelihood that dagger nematodes will recolonize treated areas, but this may take time as they move upward from deep in the soil. Root-knot nematodes may be more easily controlled via chemigation or fumigation, as their distribution corresponds to shallower areas with high fine root biomass wetted by drip irrigation.

Development of a Species-Specific PCR for Detection and Quantification of Meloidogyne hapla in Soil Using the 16D10 Root-Knot Nematode Effector Gene.

The Northern root-knot nematode (Meloidogyne hapla) is an important soilborne pathogen of numerous agricultural crops in temperate regions. Accurate detection and quantification is vital to supporting informed pest management decisions. However, traditional methods of manual nematode extraction and morphology-based identification are time-consuming and require highly specialized training. Molecular methods may expand the diagnostician's toolkit beyond those methods that rely on this disappearing specialized skillset. However, molecular assays targeting the internal transcribed spacer region may lead to inaccurate results because of intraspecific variability. The Meloidogyne spp. effector gene 16D10 was assessed as a target for a SYBR Green I quantitative PCR (qPCR) assay for detection and quantification of M. hapla. M. hapla-specific qPCR primers were developed and evaluated for specificity against five M. hapla isolates and 14 other plant-parasitic nematodes. A standard curve was generated by relating the quantification cycle (Cq) to the log of M. hapla population densities artificially introduced into soil. The influence of soil inhibitors on quantitative amplification was assessed by generating a dilution series from DNA extracted from pure nematode cultures and inoculated soil. Extracts from soil produced significantly higher Cq values than those produced from pure culture extracts. The utility of the qPCR was evaluated using soil samples collected from three naturally infested potato fields, resulting in a significant positive relationship between populations estimated using qPCR and populations derived from manual counting. The qPCR developed in this study provides a useful method for detecting and quantifying M. hapla in soil and demonstrates the utility of effector genes in plant-parasitic nematode diagnostics. The ability to use effector genes as targets for qPCR and other molecular detection and quantification methods may open additional avenues of novel research and support development of improved species-level diagnostics.

Evaluation of suitable reference genes for gene expression analysis in the northern root-knot nematode, Meloidogyne hapla.

The northern root-knot nematode (Meloidogyne hapla) is a critical pathogen with a wide host range. Quantitative real-time polymerase chain reaction (qRT-PCR) has been used to elucidate gene expression and function of M. hapla. Suitable reference genes are required to ensure accurate results of qRT-PCR for normalising gene expression. Eleven candidate reference genes of M. hapla were selected to evaluate gene expression stability under different conditions. The stability of candidate reference genes was ranked using RefFinder analysis, and the optimal number of reference genes was recommended with geNorm. Notably, the most stable reference genes were SDHA, Mdh, and RpS6 for all samples; SDHA and RpS6 were particularly stable during development stage treatments, whereas Mdh and RpS6 were appropriate for temperature and inorganic compound treatments. In contrast, the least stable reference genes were Actin1 during development stages and all other treatments, GAPDH for temperature treatments, and α-Tub for inorganic compound treatments. One target gene, Mh-Hsp90, was used to verify the selection of reference genes, results showed Mdh and RpS6 could be used as suitable reference genes for M. hapla, and Mdh plus RpS6 were better. Our finding contributes to further work on gene transcription analysis in M. hapla.

Anaerobic Soil Disinfestation to Manage Soilborne Diseases in Muck Soil Vegetable Production Systems.

Anaerobic soil disinfestation (ASD) was evaluated as a tool for managing the root-knot nematode Meloidogyne hapla in lettuce (Lactuca sativa) and clubroot disease, caused by Plasmodiophora brassicae, in mustard greens (Brassica juncea) produced on Ohio muck soils in Huron and Stark Counties. In two consecutive years of field trials, wheat bran (20.2 Mg ha-1), molasses (10.1 Mg ha-1), and wheat bran (20.2 Mg ha-1) plus molasses (10.1 Mg ha-1) were assessed as ASD carbon sources and compared with nonamended controls. Data were collected from plants grown in the field and from plants grown in field-treated soils in growth chamber-based post-ASD bioassays. Anaerobic conditions developed in ASD-treated soils in both trial years, as indicated by polyvinyl chloride pipes painted with an iron oxide paint. Soil pH did not decrease during ASD at the Huron County site of the mustard greens clubroot trials in either trial year but soil pH decreased significantly during ASD in Stark County soils treated with ASD with either wheat bran or wheat bran plus molasses compared with control soils in both trial years. Impacts of ASD on plant biomass were inconsistent in direct field measurements; however, significantly higher biomasses were observed in lettuce and mustard greens grown in bioassay soils collected from plots treated with ASD with wheat bran-based amendments compared with plants grown in soils from control plots. Based on direct field measurements and bioassays, the use of ASD with any carbon source led to significant reductions in root-knot nematode galling on lettuce compared with controls. Reductions in clubroot severity in mustard greens following ASD were less consistent; however, significant reductions in clubroot severity were observed in the field in one trial year and in both years of bioassays. The results of these studies indicate that ASD is a promising tool for managing soilborne diseases in muck soil vegetable production systems.