RNA Extraction Kits Research Articles

Optimization of RNA extraction protocol from Eucalyptus and Populus species for gene expression studies

ABSTRACT Extraction of high-quality RNA is complicated due to the presence of polysaccharides and polyphenols in woody plant species like Eucalyptus and Populus. To conduct gene expression studies, RNA must be of high quality and intact integrity. Although, RNA extraction kits make the process quick and easy but they might not consistently provide high-quality RNA from Eucalyptus and Populus. Therefore, the primary objective of this work is to optimize a repeatable and systematic CTAB method for RNA extraction of high quality from Populus and Eucalyptus leaves. According to the study results, the optimized CTAB approach is more suitable for these plant species than RNA extraction kits. The agarose gel electrophoresis demonstrated that the RNA samples retained their integrity due to the presence of distinct 28S and 18S rRNA bands. Additionally, the RNA integrity number was found to be between 7.2 and 8.0. As indicated by the A260/A280 ratios, the optimized method’s RNA extraction yielded minimal levels of polysaccharide and polyphenol contamination. For Eucalyptus, the absorbance values ranged from 1.98 to 1.99 while for Populus it was 1.97 to 1.98. Similarly, the A260/230 ratios, which represent the second indicator of nucleic acid purity, were found to be 2.01 to 2.08 and 2.02 to 2.09 for Eucalyptus and Populus, respectively. The high-quality RNA was shown to be appropriate for use in further processes, such as cDNA synthesis, gene amplification, and real-time quantitative PCR (RT-qPCR).

The role of mir-214-5p and mir-548-5p expressions in endometriosis.

Endometriosis is a benign gynecological disease that affects about 1% of all women and up to 15% of women of childbearing age. To date, none of the proposed theories exhaustively explain the pathophysiology of the disease or the associated clinical manifestations. As part of efforts to introduce new methods for the early and non-invasive diagnosis of endometriosis, this project investigated changes in the expression of miR-214-5p and miR-548-5p in ectopic and eutopic tissue compared to normal endometrial tissue. Forty-five samples (15 eutopic, 15 ectopic and 15 healthy controls) from women referred to Shahid Sadoughi Hospital (Yazd, Iran). RNA extraction was performed using an RNA extraction kit, and cDNA was synthesized. Two-step qRT-PCR was performed according to the manufacturer's instructions. GraphPad Prism 8 software and Two-Way ANOVA test were used to compare fold-change expression. The results indicate a significant down-regulation of miR-214-5p expression levels (P-value < 0.05) and an increase in miR-548-5p expression levels (P-value < 0.05) in endometriosis samples compared to those in control tissues. miR-214-5p and miR-548-5p may regulate the pathogenesis of endometriosis. The down-regulation of miR-214-5p in people with endometriosis compared to healthy individuals may indicate its suppressive role. The upregulation of miR-548-5p could confirm the oncogenic role of this microRNA in endometriosis. The development of new therapeutic strategies targeting these miRNAs could be promising in the treatment of this disease.

A novel ionic liquid-based approach for DNA and RNA extraction simplifies sample preparation for bacterial diagnostics

DNA- and RNA-based diagnostics play a pivotal role in accurately detecting and characterizing health-relevant bacteria, offering insights into bacterial presence, viability and treatment efficacy. Herein, we present the development of a novel extraction protocol for both DNA and RNA, designed to enable simple and rapid molecular diagnostics. The extraction method is based on the hydrophilic ionic liquid (IL) 1-ethyl-3-methylimidazolium acetate and silica-coated magnetic beads. First, we developed an IL-based cell lysis protocol for bacteria that operates at room temperature. Subsequently, we established a magnetic bead purification procedure to efficiently and reproducibly extract DNA and RNA from the IL-lysates. The IL not only lyses the cells, but also facilitates the adsorption of nucleic acids (NAs) onto the surface of the magnetic beads, eliminating the need for a chaotropic binding buffer and allowing for purification of NAs without significant effort and materials required. Lastly, we combined the cell lysis step and the purification step and evaluated the novel IL-based extraction method on periopathogenic bacterial cultures, comparing it to commercial DNA and RNA extraction kits via (RT)-qPCR. In comparison to the reference methods, the IL-based extraction protocol yielded similar or superior results. Furthermore, costs are lower, required materials and equipment are minimal and the process is fast (30 min), simple and automatable. These characteristics favour the developed method for use in routine and high-throughput testing as well as in point-of-care, on-site and low-resource settings, thereby advancing the field of molecular diagnostics.Graphical

Total RNA Extraction from Starchy Rice Endosperm.

RNA extraction is a critical step in gene expression analysis. While numerous RNA extraction kits are commercially available, most kits cannot be utilized for RNA extraction from rice endosperm that contains abundant starch. Here, I describe a three-step RNA extraction from rice starchy endosperm. The process involves phenol/chloroform extraction, ethanol precipitation, and lithium chloride precipitation. This method yields an abundant and high-quality total RNA even from a single starchy endosperm.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

B-217 Effective Diagnostic Platform and Method to Differentiate the Infectious From Non-Infectious Viruses With Nucleic Acid Detection Workflow

Abstract Background While qPCR has demonstrated high sensitivity, specificity, and ability to deliver reliable quantitative data in clinical samples, such results do not differentiate between infectious and non-infectious viral particles. In view of the principle of the qPCR method itself, the amplification detects the nucleic acid (DNA/RNA) of the virus, not the virus itself. In many cases, it is still possible to detect DNA/RNA fragments from dead viruses in recovered patients, while they are not infectious anymore. This will lead to prolonged quarantine period or treatment for the patients, which could cause great psychological pressure to the patients and increased healthcare burden. Therefore, an effective detection method that can discriminate viable and inviable pathogens is of great significance. Methods SARS-CoV2 viral RNA, SARS-CoV-2 viruses, or clinical samples with SARS-CoV2 infection were diluted in Delta MTM (Molecular Transport Media) to the respective testing concentrations. The samples were incubated with intercalating dye (PMAxx 100nM) with or without Triton X-100 for 10 min. The mixture was then exposed to the photo-activation device for 5-15 min (@ temperature below 37° C). The samples were then subjected to the standard nucleic acid extraction &amp; purification steps with Qiagen viral RNA extraction kit. The extracted RNA was subjected to amplification with SARS-CoV2 Resolute 2.0 &amp; Fortunate 2.1 assays on BioRAD CFX96. Results The viability PCR (vPCR) efficiency was almost 100% for all SARS-CoV2 RNA input tested suggesting that without viral membrane protection, PMAxx dye effectively bound to the naked RNA after photoactivation process, and the bound RNA was not able to be amplified. The vPCR efficiency was further enhanced with addition of surfactant Triton X-100 suggesting the improved permeability of dye through the viral envelope facilitated the PMAxx binding to the nucleic acid. COVID19 positive clinical samples with viral load ≈ Ct 30 treated with or without PMAxx and photo-activation procedures showed distinctive ΔCt value ranging from 9.27±0.18 to 15.01±0.14. The Ct after dye treatment were all non-numeric (non-detectable) if cut-off Ct sets @ 42.0, indicating the complete inhibition after vPCR pretreatment. Since the clinical samples were undergone heat-inactivation pre-treatment, the result shown here indicating that all samples were non-infectious, which was consistent with the samples tested. Conclusions We developed an effective viability PCR detection method and proprietary vPCR device, which was specifically designed for effective dye photo-activation. In addition, the method takes less than 15 min and could be integrated into the existing standard nucleic acid extraction and amplification workflow. Comparing to the standard PCR test result, this method could provide the information not only on the positivity of the tested pathogen, but also its viability, which could be very essential information for public surveillance and diagnostic decisions for healthcare providers.

Evaluation of commercial RNA extraction kits for long-read metatranscriptomics in soil

Metatranscriptomic analysis of the soil microbiome has the potential to reveal molecular mechanisms that drive soil processes regulated by the microbial community. Therefore, RNA samples must be of sufficient yield and quality to robustly quantify differential gene expression. While short-read sequencing technology is often favoured for metatranscriptomics, long-read sequencing has the potential to provide several benefits over short-read technologies. The ability to resolve complete transcripts on a portable sequencing platform for a relatively low capital expenditure makes Oxford Nanopore Technology an attractive prospect for addressing many of the challenges of soil metatranscriptomics. To fully enable long-read metatranscriptomic analysis of the functional molecular pathways expressed in these diverse habitats, RNA purification methods from soil must be optimised for long-read sequencing. Here we compare RNA samples purified using five commercially available extraction kits designed for use with soil. We found that the Qiagen RNeasy PowerSoil Total RNA Kit performed the best across RNA yield, quality and purity and was robust across different soil types. We found that sufficient sequencing depth can be achieved to characterise the active community for total RNA samples using Oxford Nanopore Technology, and discuss its current limitations for differential gene expression analysis in soil studies.

Investigation of SARS-CoV-2 release in fecal specimens of discharge COVID-19 patients

Abstract Objectives The presence of live SARS-CoV-2 viruses in the fecal specimens and the positive results for SARS-CoV-2 RNA in gastrointestinal samples after respiratory specimens had become negative indicate that there may be a risk of transmission of the disease not only through the respiratory tract but also through the fecal-oral route. The study aim is to determine the time period that the SARS-CoV-2 virus remains in the fecal specimens of discharged COVID-19 patients to reveal the time interval in which the risk of transmission continues. Methods In 65 patients hospitalized with a COVID-19 diagnosis, the viral RNA was isolated from the supernatant of the stool sample using CVXTM viral RNA extraction kit. The extracted RNAs from the stool samples were detected using a commercial RT-PCR method. Results Positive results were obtained in the stool samples in eight of sixty-five patients and the presence of SARS-CoV-2 in these patients was detected for up to three weeks. Conclusions By determining the residence time of SARS-CoV-2 virus in stool samples of discharged COVID-19 patients, the time interval during which the possibility of transmission risk continues has been revealed. The findings of the study could prove beneficial in comprehending the risks of transmission and translating them into preventative measures.

Comparison of Different Reverse Transcriptase-Polymerase Chain Reaction-Based Methods for Wastewater Surveillance of SARS-CoV-2: Exploratory Study.

Many countries have applied the wastewater surveillance of the COVID-19 pandemic to their national public health monitoring measures. The most used methods for detecting SARS-CoV-2 in wastewater are quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR) and reverse transcriptase-droplet digital polymerase chain reaction (RT-ddPCR). Previous comparison studies have produced conflicting results, thus more research on the subject is required. This study aims to compare RT-qPCR and RT-ddPCR for detecting SARS-CoV-2 in wastewater. It also aimed to investigate the effect of changes in the analytical pipeline, including the RNA extraction kit, RT-PCR kit, and target gene assay, on the results. Another aim was to find a detection method for low-resource settings. We compared 2 RT-qPCR kits, TaqMan RT-qPCR and QuantiTect RT-qPCR, and RT-ddPCR based on sensitivity, positivity rates, variability, and correlation of SARS-CoV-2 gene copy numbers in wastewater to the incidence of COVID-19. Furthermore, we compared 2 RNA extraction methods, column- and magnetic-bead-based. In addition, we assessed 2 target gene assays for RT-qPCR, N1 and N2, and 2 target gene assays for ddPCR N1 and E. Reverse transcription strand invasion-based amplification (RT-SIBA) was used to detect SARS-CoV-2 from wastewater qualitatively. Our results indicated that the most sensitive method to detect SARS-CoV-2 in wastewater was RT-ddPCR. It had the highest positivity rate (26/30), and its limit of detection was the lowest (0.06 gene copies/µL). However, we obtained the best correlation between COVID-19 incidence and SARS-CoV-2 gene copy number in wastewater using TaqMan RT-qPCR (correlation coefficient [CC]=0.697, P<.001). We found a significant difference in sensitivity between the TaqMan RT-qPCR kit and the QuantiTect RT-qPCR kit, the first having a significantly lower limit of detection and a higher positivity rate than the latter. Furthermore, the N1 target gene assay was the most sensitive for both RT-qPCR kits, while no significant difference was found between the gene targets using RT-ddPCR. In addition, the use of different RNA extraction kits affected the result when the TaqMan RT-qPCR kit was used. RT-SIBA was able to detect SARS-CoV-2 RNA in wastewater. As our study, as well as most of the previous studies, has shown RT-ddPCR to be more sensitive than RT-qPCR, its use in the wastewater surveillance of SARS-CoV-2 should be considered, especially if the amount of SARS-CoV-2 circulating in the population was low. All the analysis steps must be optimized for wastewater surveillance as our study showed that all the analysis steps including the compatibility of the RNA extraction, the RT-PCR kit, and the target gene assay influence the results. In addition, our study showed that RT-SIBA could be used to detect SARS-CoV-2 in wastewater if a qualitative result is sufficient.

Point-of-Care Multiplex Detection of Respiratory Viruses.

The COVID-19 pandemic, in addition to the co-occurrence of influenza virus and respiratory syncytial virus (RSV), has emphasized the requirement for efficient and reliable multiplex diagnostic methods for respiratory infections. While existing multiplex detection techniques are based on reverse transcription quantitative polymerase chain reaction (RT-qPCR) and extraction and purification kits, the need for complex instrumentation and elevated cost limit their scalability and availability. In this study, we have developed a point-of-care (POC) device based on reverse transcription loop-mediated isothermal amplification (RT-LAMP) that can simultaneously detect four respiratory viruses (SARS-CoV-2, Influenza A, Influenza B, and RSV) and perform two controls in less than 30 min, while avoiding the use of the RNA extraction kit. The system includes a disposable microfluidic cartridge with mechanical components that automate sample processing, with a low-cost and portable optical reader and a smartphone app to record and analyze fluorescent images. The application as a real point-of-care platform was validated using swabs spiked with virus particles in nasal fluid. Our portable diagnostic system accurately detects viral RNA specific to respiratory pathogens, enabling deconvolution of coinfection information. The detection limits for each virus were determined using virus particles spiked in chemical lysis buffer. Our POC device has the potential to be adapted for the detection of new pathogens and a wide range of viruses by modifying the primer sequences. This work highlights an alternative approach for multiple respiratory virus diagnostics that is well-suited for healthcare systems in resource-limited settings or at home.

Evaluation of a commercial Real Time PCR for clinical samples without RNA extraction for detection of SARS-CoV-2

RT-PCR is the gold standard for diagnosis of COVID-19. All RT-PCR kits are based on RNA extraction from the clinical sample. There was a sudden increase in demand of these kits, both RNA extraction and COVID-19 RT-PCR kits during the pandemic. This sudden spurt in global demand created a situation of shortage of consumables, especially the RNA extraction kits. Hence, this study was carried out to evaluate and compare COVID-19 RT-PCR without RNA extraction step using buffer R3. Sensitivity, specificity and accuracy of RT-PCR kit without RNA extraction were 89.16 %, 100% and 89.6% respectively. This approach saved more than 50 % time compared to the RT-PCR kit with RNA extraction approach allowing enhanced daily sample processing capability. RT-PCR kit without RNA extraction help in managing a greater number of samples, reduces cost and turnaround time.

Penggunaan Metode Quantitative Polymerase Chain Reaction (qPCR) untuk Deteksi Fragmen DNA Babi pada Produk Olahan Daging

Using food ingredients and/or processed food products contaminated with pork, whether unintentionally or intentionally, has become a growing concern and issue. This condition encourages the development of an accurate method for specifically detecting the presence or absence of pork contamination. The research was carried out on two different samples: (1) fresh pork to provide an in-house positive control and (2) samples of pork-based processed meat products (floss, meatballs, corned beef, and sausages), tested using DNA markers. The use of samples originating from processed pork food is to determine the effect of the processing process on DNA fragments and the robustness of the extraction method for the detection process used. The research aimed to detect pork DNA fragments using the quantitative polymerase chain reaction (qPCR) method. The study stages were extracting fresh pork and processed products using an RNA extraction kit, DNA extraction kit, and salt extraction, as well as measuring the purity and concentration of DNA/RNA using a spectrophotometer. The RNA extract was converted into complementary DNA (cDNA), and the DNA extract was analyzed using qPCR with specific primers for pork DNA (Sus scrofa). The results showed that the concentration of RNA and DNA extracts was 71.1–296.025 ng/uL and of various purity. All processed meat product samples and in-house positive controls were amplified in the Ct range of 23–28 ng/uL. In this case, the meat processing had no effect on the DNA of the processed meat products analyzed, so DNA fragments could be detected. DNA qPCR was more time efficient than cDNA qPCR because it did not require an RNA reverse transcription step. Keywords: beta actin, cycle threshold, fresh pork, pork DNA, qPCR

Glia Maturation Factor Beta: A Novel Neuro-Impairment Prediction Factor in Toxoplasmosis.

Toxoplasma gondii, a neurotropic protozoan, infects up one to third of the world population. The parasite can invade a wide variety of nucleated cells but preferably glial cells. Glia maturation factor β (GMFβ), a 17KD protein expressed at high levels in the central nervous system is predominantly related to neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, and Multiple sclerosis. We aimed to determine the expression level of GMFβ and its relation to other pro-inflammatory factors (IL33, SDF1, and CCL2) on T. gondii infected human neuroblastoma cell line. The human neuroblastoma (SK_NMC C535) cell line was infected by 5×106 (1:1 ratio). The supernatant was collected after cell lysis and centrifugation. Total RNA was extracted using the Yekta Tajhiz RNA extraction kit. cDNA was synthesized based on RevertAid First Strand cDNA Synthesis Kit manufacturer's protocol (Parstous, cDNA synthesis kit, Iran). The specificity of each primer pair (GMFβ, IL33, SDF1, and CCL2) was provided by NCBI BLAST. Gene expression level was measured using Real-Time PCR. All experiments were conducted at the Hamadan University of Medical Sciences, western Iran in 2022. The GMFβ increased significantly up to 1.35-fold (P=0.007). The increase in GMFβ expression in neuroblastoma cells was consistent with the increase in pro-inflammatory factors (CCL2 (0.47), IL33 (0.152) and, SDF1 (1.33)). GMFβ upregulation can be a novel indicator of the destruction of nerve cells.

Distribution of SARS-CoV-2 Genomes in Wastewaters and the Associated Potential Infection Risk for Plant Workers in Typical Urban and Peri-Urban Communities of the Buffalo City Region, South Africa.

The presence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in wastewater has been reported in several studies and similar research can be used as a proxy for an early warning of potential Coronavirus disease 2019 (COVID-19) outbreaks. This study focused on profiling the incidence of SARS-CoV-2 genomes in wastewater samples obtained from facilities located in the Buffalo City Municipality. Raw samples were collected weekly using the grab technique for a period of 48 weeks. Ribonucleic acids were extracted from the samples, using the QIAGEN Powersoil Total RNA Extraction kit, and extracted RNA samples were further profiled for the presence of SARS-CoV-2 genomes using Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) technique. Furthermore, various environmental matrices were utilized to estimate the potential health risk to plant operators associated with exposure to SARS-CoV-2 viral particles using the quantitative microbiological risk assessment (QMRA) model. Our findings revealed the prevalence of SARS-CoV-2 genomes with concentrations that ranged from 0.22 × 103 to 17.60 × 103 genome copies per milliliter (GC/mL). Different exposure scenarios were employed for the QMRA model, and the findings indicate a probability of infection (P(i)) ranging from 0.93% to 37.81% across the study sites. Similarly, the P(i) was highly significant (p < 0.001) for the 20 mL volumetric intake as compared to other volumetric intake scenarios, and high P(i) was also observed in spring, autumn, and winter for all WWTPs. The P(i) was significantly different (p < 0.05) with respect to the different seasons and with respect to different volume scenarios.

First report of pepper chlorosis-associated virus infecting tobacco (Nicotiana tabacum) plants in Sichuan Province in China.

Tobacco (Nicotiana tabacum) is an economically important crop in China, and more than 30 viruses have been reported to infect tobacco (Yin et al. 2022). In July 2022, we observed interveinal necrosis on tobacco leaves in fields in Sichuan Province (N 27.9172, E 105.6662) (Fig. 1). Total RNA was isolated from multiple leaves of one plant using an RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit (TIANGEN, Beijing, China). Total RNAs were pooled, and a TruSeq Stranded Total RNA with RiboZero Gold Kit (Illumina, San Diego, CA, USA) was used to eliminate ribosomal RNA. An RNA-Seq library was constructed using VAHTS Universal V6 RNA-seq Library Prep (Nanjing Vazyme, China). High-throughput sequencing was performed on the Illumina DNBseq platform (BGI-ShenZhen, China), which yielded 20,102,087 reads with an average length of 150 nt (total size >6 Gb). Unaligned reads were assembled de novo using SPAdes (Bankevich et al. 2012). Contigs with length ≥200 nt were subjected to local BLASTn and BLASTx analyses against the GenBank nt and nr databases, respectively (Wang et al. 2022). A total of 23 contigs were identified through BLASTx (e-value cut-off = 10 -3), ranging from 631 to 1555 bp long, with 82% to 96% coverage to partial genomic sequences of pepper chlorosis-associated virus (PepCaV-Higashitsuno_2021; Accessions: LC719619 to LC719621) and one contig (6459 bp) with 99% similarity to tobacco mosaic virus (Accession: OP525281) isolate DSMZ PV-0109 from Germany. The complete genome sequence of PepCaV was obtained using primers based on the assembled contigs. The 5'- and 3'-terminal regions of the RNA genome were obtained by 5'- and 3'-rapid amplification of cDNA ends. These amplicons were cloned using the pEASY-Blunt Zero Cloning Kit (TRANSGEN, Nangjing, China) and sequenced by Sanger sequencing. Complete genome sequences of tripartite PepCaV from tobacco samples were 7697, 1808, and 1557 nucleotides long (Accession: OR451987 to OR451989) and showed genome organization typical of the genus Ophiovirus in the family Aspiviridae. The complete sequences of RNA1, RNA2 and RNA3 genome segments shared 92.36%, 90.43%, and 95.24%, nucleotide sequence identities, respectively, with the isolate PepCaV-Higashitsuno_2021 pepper isolate (Accession: LC719619 to LC719621) (Shimomoto et al. 2023), but PepCaV has not been reported to infect N. tabacum. In June 2023, 10 plants collected from each place of Macheng (N 27.9094, E 105.6740), Xiangyang (N 28.0936, E 105.6249) and Moni (N 27.8899, E 105.5936) showing interveinal necrosis symptoms were tested using RT-PCR using PepCaV-MP610-F (5'-TGTTCTCTGCTATGCGGTTG -3') and PepCaV-MP610-R (5'-AGCAATCTCGCACCTGAAGT-3') to product 610bp amplicon. Twenty-five tobacco plants were positive for PepCaV. Single sequence from each location was submitted to GenBank (Accession: PP728631 to PP728633). Sap extracts from the original field leaf samples collected from Sichuan Province were used to mechanically inoculate tobacco plants (10 plants) at the four-leaf stage. After 7 days, leaf samples were tested using RT-PCR assay specific to PepCaV and TMV while samples were positive only for TMV but failed to transmit PepCaV by mechanical inoculation. According to previous literature, ophioviruses may be transmitted though soilborne fungus (Jeong et al. 2014). Further research is needed to understand the transmission, epidemiology, and pathological properties of the PepCaV. To our knowledge, this is the first report documenting natural PepCaV infection of tobacco plants in China, providing a scientific basis for PepCaV infection control in tobacco plantations.

The Regulatory Effect of RNA m6 A Methylation Modification on KDM4B Gene Expression in t (8;21) AML Cells by MeRIP-qPCR

To confirm the direct regulatory effect of WTAP-mediated RNA m6A modification on the KDM4B gene in t (8;21) acute myeloid leukemia (AML) cells through MeRIP combined with reverse transcription real-time quantitative PCR (RT-qPCR) technology. The lentivirus-mediated shRNA target WTAP or KDM4B gene was used to transfect the t (8;21) AML cell lines: Kasumi-1 and SKNO-1, and cells transfected with randomly shuffled shRNA as the control. Using the Ultrapure RNA Extraction Kit (DNase I) to extract RNA. The Magna MeRIPTM m6A Kit was used to enrich methylated modified fragments, and detect the m6A methylated RNA regions by RT-qPCR, and the protein and mRNA expression levels of WTAP and KDM4B in cells were detected by Western blot and reverse transcription real-time quantitative PCR (RT-qPCR). Colony formation assays were used to detect the colony ability of cells in vitro. Silencing the expression of WTAP in Kasumi-1 cells, the enrichment of m6A methylation modification was significantly decreased in the 3'UTR of KDM4B mRNA(P < 0.01), and the protein(P < 0.001) and mRNA (Kasumi-1:P < 0.001; SKNO-1: P < 0.01) expression levels of KDM4B were also significantly inhibited in Kasumi-1 and SKNO-1 cells upon WTAP knockdown (all P < 0.01), accompanied by a significant decrease in the colony-forming ability of both cell lines (both P < 0.01). In t(8;21) AML cell lines, WTAP could regulate the expression of KDM4B by regulating the m6A modification of the 3'UTR of KDM4B mRNA, and silencing the expression of KDM4B could inhibit the cellular proliferation in vitro.

Replication of Human Norovirus in Human Intestinal Enteroids Is Affected by Fecal Sample Processing.

Human intestinal enteroids (HIEs) culture is an emerging model for assessing the infectivity of human noroviruses (HuNoVs). The model is based on detecting an increase in HuNoV RNA post-infection of HIEs. HuNoV fecal samples used for HIE infection are traditionally processed by serial filtration. Recently, processing HuNoV fecal samples by serial centrifugation was shown to retain vesicles containing HuNoV. The objective of this study was to investigate whether serially centrifuged fecal samples, RNA extraction kit (QIAamp versus MagMaX) and HIE age (newer versus older) affect HuNoV RNA fold increase in HIE. HuNoV GII.1, GII.4 and GII.6 fecal samples were prepared by serial centrifugation and filtration and the viral RNA in HIE was quantified at 1 and 72 h post-infection (hpi) following RNA extraction and RT-qPCR. The serially filtered GII.1, GII.4 and GII.6 showed successful replication in HIE, resulting in mean log increases of 2.2, 2 and 1.2, respectively, at 72 vs. 1 hpi. In contrast, only serially centrifuged GII.1 showed consistently successful replication. However, using newer HIE passages and the MagMAX kit resulted in mean log fold increases for serially centrifuged GII.1, GII.4 and GII.6 (1.6, 2.3 and 1.8 log, respectively) that were similar to serially filtered samples. Therefore, HuNoV fecal sample processing and HIE age can affect virus replication in the HIE model.

Epidemiology, Phylogeny and Drug Resistance against Human Immuno- Deficiency Virus in Pakistan

Background: The human immunodeficiency virus is categorised in the genus Lentivirus, subfamily Orthoretrovirinae of the Retroviridae family. Methodology: 40 specimens in total were included in the research to conduct the whole experimentation. The viral RNA extraction was performed by using the Qiagen viral RNA extraction kit. After the extraction of RNA, the cDNA was synthesized. Qiagen One step rt-PCR kit was used for amplification by using pair of primers forward primers (A) &amp; reverse primer (D) 10uM/ug. Sequencing and capillary electrophoresis were performed. The phylogenetic tree of HIV was done by using mega. Results: Out of 40, 10 samples are sequenced 4 of them are resistance against drugs. Sample Ids 226 and 229 are resistance to Rilpivirine (RPV) and Etravirine(ETR) also has 138A mutation in HIV-1. Sample Id 231 have resistance to Lamivudine (3TC), emtricitabine (FTC) and abacavir (ABC) also has M184V mutation in HIV-1. Sample Id 232 have resistance to Lamivudine (3TC), emtricitabine (FTC) and abacavir (ABC) also has M184V Nevirapine (NVP) and efavirenz(EFV) mutation in HIV-1.

PD-L1 mRNA derived from tumor-educated platelets as a potential immunotherapy biomarker in non-small cell lung cancer.

To date, the role of programmed death ligand-1 (PD-L1) messenger RNA (mRNA) derived from tumor-educated platelets (TEPs) has not been well investigated in patients with advanced non-small cell lung cancer (NSCLC). A few reports have examined whether mRNA in TEPs can predict the clinical responses of patients with advanced NSCLC following immunotherapy. This study aimed to identify novel biomarkers to improve the clinical benefits and outcomes of NSCLC patients. Advanced NSCLC patients receiving a combination of immunotherapy and chemotherapy, or immunotherapy alone as a first- or second-line treatment at the Fudan University Shanghai Cancer Center were enrolled in this study. All the patients had wild-type epidermal growth factor receptor/anaplastic lymphoma kinase. The patients were enrolled in clinical trials for immune checkpoint inhibitors (ICIs), including nivolumab, pembrolizumab, atezolizumab, durvalumab, tremelimumab, and camrelizumab. Tumoral PD-L1 expression was tested by immunohistochemistry (PD-L1 22C3 pharmDx kit, Agilent, Santa Clara, CA, USA) in archived tissue samples, when available, to calculate the tumor proportion scores (TPSs). RNA and exosomal RNA of blood were isolated before immunotherapy using the Yunying RNA extraction kit (Yunying Medicine, Shanghai, China). The concentration and quality of the RNA was determined using a Qubit fluorometer (Life Technologies, Carlsbad, CA, USA). Finally, we analyzed the predictive value of TEP-derived PD-L1 mRNA expression and association with the level of the tumoral PD-L1 expression. In total, 72 patients were enrolled in this study. Most of the patients were male (n=54, 75.0%), had adenocarcinoma (n=49, 68.1%). We found there was no significant correlation between the TEP-derived mRNA of PD-L1 and tumoral PD-L1 expression based on the results of the Pearson Correlation test (r=-0.19, P=0.233). Based on the median of PD-L1 mRNA, 72 patients were divided into a high PD-L1 group and a low PD-L1 group. We found that 19 patients (44.4%) responded to immunotherapy [partial response or progression-free survival (PFS) >6 months] in the high PD-L1 group, but only five patients (13.9%) responded to immunotherapy in the low PD-L1 group (P<0.01). The median PFS of the low PD-L1 group was lower than that of the high PD-L1 group (2.8 vs. 8.3 months, P<0.001). For the patients who were treated with immunotherapy alone (n=64), a similar PFS advantage was observed in the high PD-L1 group (2.8 vs. 8.0 months, P=0.002). This article presented the first data on TEP-derived PD-L1 mRNA in advanced NSCLC patients following immunotherapy and showed the potential advantage of using it as the surrogate biomarker for predicting the PFS and overall survival of patients following immunotherapy.

Examination and comparison of the RNA extraction methods using mouse serum.

Serum microRNAs (miRNAs) are considered useful as non-invasive biomarkers for different diseases. However, the optimal method for extracting RNAs from serum is currently unknown. In the present study, several RNA extraction kits were used to examine the optimal kit. RNAs were extracted from the serum of 8-week-old C57BL/6NJcl male mice following the protocol of each RNA extraction kit. The yield of the extracted RNA samples was calculated, and an Agilent Bioanalyzer was used to assess the electrophoretic patterns. An Agilent mouse miRNA microarray was utilized to confirm the expression patterns of the extracted RNA samples. The results revealed significant differences in RNA yields from the miRNeasy Serum/Plasma Advanced kit and mirVana™ PARIS™ RNA and Native Protein Purification Kit compared with almost all other samples. Further, two peaks were determined in the miRNeasy Serum/Plasma Advanced kit using a small RNAs kit of Agilent Bioanalyzer, including one at 20-40 nucleotides (nt) and another at ~40-100 nt, whereas the other reagents had a single peak. This revealed that the extracted RNAs may differ in composition based on the RNA extraction method. Some types of miRNAs were only detected with certain RNA extraction reagents. This suggested that different RNA extraction reagents may cause differences in the types of miRNAs detected. On the other hand, the miRNAs commonly expressed by the three RNA extraction reagents are highly correlated in expression levels.