End Of RNA Research Articles

CLP1 acts as the main RNA kinase in mice

CLP1 plays an essential role in the protein complex involved in mRNA 3′-end formation and polyadenylation as well as in the tRNA splicing endonuclease (TSEN) complex involved in the splicing of precursor tRNAs. NOL9 localizes in the nucleolus of cells and plays an essential role in ribosomal RNA maturation. Both CLP1 and NOL9 are RNA kinases that phosphorylate the 5′ end of RNAs. From the evidence that phosphorylation of the 5′ end of a siRNA is essential for its efficient RNA cleavage, it was expected that CLP1 and NOL9 would be corresponding molecules. However, there had been no direct evidence that this is the case. In this study, murine NOL9 showed no apparent RNA kinase activity in cells or even in an RNA kinase assay using recombinant murine NOL9 protein. Although siRNA efficiency was decreased in CLP1 kinase-dead (Clp1K/K) cells, it was not influenced by NOL9 overexpression. These findings indicate that in mouse cells it is CLP1 that mainly acts to phosphorylate the 5′ end of RNAs in the siRNA pathway, with no apparent involvement of NOL9.

ARS2 Regulates Nuclear Paraspeckle Formation through 3'-End Processing and Stability of NEAT1 Long Noncoding RNA.

Nuclear paraspeckle assembly transcript 1 (NEAT1) is a long noncoding RNA that functions as an essential framework of subnuclear paraspeckle bodies. Of the two isoforms (NEAT1_1 and NEAT1_2) produced by alternative 3'-end RNA processing, the longer isoform, NEAT1_2, plays a crucial role in paraspeckle formation. Here, we demonstrate that the 3'-end processing and stability of NEAT1 RNAs are regulated by arsenic resistance protein 2 (ARS2), a factor interacting with the cap-binding complex (CBC) that binds to the m7G cap structure of RNA polymerase II transcripts. The knockdown of ARS2 inhibited the association between NEAT1 and mammalian cleavage factor I (CFIm), which produces the shorter isoform, NEAT1_1. Furthermore, the knockdown of ARS2 led to the preferential stabilization of NEAT1_2. As a result, NEAT1_2 RNA levels were markedly elevated in ARS2 knockdown cells, leading to an increase in the number of paraspeckles. These results reveal a suppressive role for ARS2 in NEAT1_2 expression and the subsequent formation of paraspeckles.

Principles of RNA and nucleotide discrimination by the RNA processing enzyme RppH.

All enzymes face a challenge of discriminating cognate substrates from similar cellular compounds. Finding a correct substrate is especially difficult for the Escherichia coli Nudix hydrolase RppH, which triggers 5′-end-dependent RNA degradation by removing orthophosphate from the 5′-diphosphorylated transcripts. Here we show that RppH binds and slowly hydrolyzes NTPs, NDPs and (p)ppGpp, which each resemble the 5′-end of RNA. A series of X-ray crystal structures of RppH-nucleotide complexes, trapped in conformations either compatible or incompatible with hydrolysis, explain the low reaction rates of mononucleotides and suggest two distinct mechanisms for their hydrolysis. While RppH adopts the same catalytic arrangement with 5′-diphosphorylated nucleotides as with RNA, the enzyme hydrolyzes 5′-triphosphorylated nucleotides by extending the active site with an additional Mg2+ cation, which coordinates another reactive nucleophile. Although the average intracellular pH minimizes the hydrolysis of nucleotides by slowing their reaction with RppH, they nevertheless compete with RNA for binding and differentially inhibit the reactivity of RppH with triphosphorylated and diphosphorylated RNAs. Thus, E. coli RppH integrates various signals, such as competing non-cognate substrates and a stimulatory protein factor DapF, to achieve the differential degradation of transcripts involved in cellular processes important for the adaptation of bacteria to different growth conditions.

Crystal structure of human cytoplasmic tRNAHis-specific 5'-monomethylphosphate capping enzyme.

BCDIN3 domain containing RNA methyltransferase, BCDIN3D, monomethylates the 5′-monophosphate of cytoplasmic tRNAHis with a G−1:A73 mispair at the top of an eight-nucleotide-long acceptor helix, using S-adenosyl-l-methionine (SAM) as a methyl group donor. In humans, BCDIN3D overexpression is associated with the tumorigenic phenotype and poor prognosis in breast cancer. Here, we present the crystal structure of human BCDIN3D complexed with S-adenosyl-l-homocysteine. BCDIN3D adopts a classical Rossmann-fold methyltransferase structure. A comparison of the structure with that of the closely related methylphosphate capping enzyme, MePCE, which monomethylates the 5′-γ-phosphate of 7SK RNA, revealed the important residues for monomethyl transfer from SAM onto the 5′-monophosphate of tRNAHis and for tRNAHis recognition by BCDIN3D. A structural model of tRNAHis docking onto BCDIN3D suggested the molecular mechanism underlying the different activities between BCDIN3D and MePCE. A loop in BCDIN3D is shorter, as compared to the corresponding region that forms an α-helix to recognize the 5′-end of RNA in MePCE, and the G−1:A73 mispair in tRNAHis allows the N-terminal α-helix of BCDIN3D to wedge the G−1:A73 mispair of tRNAHis. As a result, the 5′-monophosphate of G−1 of tRNAHis is deep in the catalytic pocket for 5′-phosphate methylation. Thus, BCDIN3D is a tRNAHis-specific 5′-monomethylphosphate capping enzyme that discriminates tRNAHis from other tRNA species, and the structural information presented in this study also provides the molecular basis for the development of drugs against breast cancers.

In vitro trackable assembly of RNA-specific nucleocapsids of the respiratory syncytial virus

In vitro trackable assembly of RNA-specific nucleocapsids of the respiratory syncytial virus

Structural basis of DNA targeting by a transposon-encoded CRISPR-Cas system.

Bacteria use adaptive immune systems encoded by CRISPR and Cas genes to maintain genomic integrity whenchallenged by pathogens and mobile genetic elements1-3. Type I CRISPR-Cas systems typically target foreign DNA for degradation via joint action of the ribonucleoprotein complex Cascade and the helicase-nuclease Cas34,5, but nuclease-deficient type I systems lacking Cas3 have been repurposed for RNA-guided transposition by bacterial Tn7-like transposons6,7. How CRISPR- and transposon-associated machineries collaborate during DNA targeting and insertion remains unknown. Here we describe structures of a TniQ-Cascade complex encoded by the Vibrio cholerae Tn6677 transposon using cryo-electron microscopy, revealing the mechanistic basis of this functional coupling. The cryo-electron microscopy maps enabled de novo modelling and refinement of the transposition protein TniQ, which binds to the Cascade complex as a dimer in a head-to-tail configuration, at the interface formed by Cas6 and Cas7 near the 3' end of the CRISPR RNA (crRNA). The natural Cas8-Cas5 fusion protein binds the 5' crRNA handle and contacts the TniQ dimer via a flexible insertion domain. A target DNA-bound structure reveals critical interactions necessary for protospacer-adjacent motif recognition and R-loop formation. This work lays the foundation for a structural understanding of how DNA targeting by TniQ-Cascade leads to downstream recruitment of additional transposase proteins, and will guide protein engineering efforts to leverage this system for programmable DNA insertions in genome-engineering applications.

First Report of Watermelon Green Mottle Mosaic Virus in North America

In 2013, cucumber green mottle mosaic virus (CGMMV), a seed-transmitted cucurbit-infecting member of the genus Tobamovirus, was detected in California (Tian et al. 2014). CGMMV is a quarantined pathogen for which the California Department of Food and Agriculture monitors. Diagnostic samples suspected of CGMMV infection led to the identification of a different virus, watermelon green mottle mosaic virus (WGMMV), of the genus Tobamovirus, in November 2017. WGMMV was recently described by Cheng et al. (2018) infecting watermelon in Taiwan. In November 2017, two opo gourd fruits exhibiting CGMMV-like symptoms collected from a Santa Clara County farmer’s market, and 25 leaf samples from a mixed cucurbit production block from a Fresno County farm were tested for CGMMV by ELISA (Agdia, Elkhart, IN) and transmission electron microscopy. Most samples were CGMMV positive. However, rigid rod-shaped particles (∼18 × 300 nm) were detected from several CGMMV-negative samples. These samples tested positive by ELISA against tobacco mosaic virus (Agdia), indicating the presence of a serologically related virus. Initial nucleic acid analysis of the 2017 isolate by reverse-transcription polymerase chain reaction (RT-PCR) from total plant RNA using tobamovirus primers, as previously described by Dovas et al. (2004), resulted in a 497-nucleotide (nt) amplicon whose sequence aligned with other tobamovirus RNA-dependent RNA-polymerase sequences in GenBank. Sanger sequencing of this amplicon and 5′ and 3′ rapid amplification of cDNA ends (RACE) of genomic RNA (FirstChoice RLM-RACE kit, Thermo Fisher Scientific, Waltham, MA) with primer walking resulted in assembling the full 6,482-nt genome, which was deposited in GenBank (accession MK070867). An NCBI BLAST search indicates the isolate shares 98% sequence identity with WGMMV (accession MH837097) and 82% with cucumber mottle virus (accession AB261167) (Altshul et al. 1990; Orita et al. 2007). WGMMV-positive samples came from opo gourd (Lagenaria siceraria), fuzzy gourd (Benincasa hispida), Asian pumpkin (Cucurbita pepo), Japanese cucumber (Cucumis sativus), and bitter melon (Momordica charantia). Many plants were coinfected with CGMMV and WGMMV, but single infections were identified by RT-PCR from bitter melon and used for mechanical transmission. Detection primers were CGMMV_CP_F, CTTACAATCCGATCACACCTAG; CGMMV_CP_R, CTAAGCTTTCGAGGTGGTAGC; WGMMV4F, CTGCTAAGAGGGTTTATG; and WGMMV4R, CTTGGAAATCCGGTAAG. Transmission studies using Nicotiana benthamiana, sugar pumpkin, cucumber, watermelon, and Chenopodium amaranticolor were carried out as previously described (Ciuffo et al. 2016). Control plants were mock inoculated with buffer. At 10 days postinoculation, plants inoculated with infected leaf tissue, except C. amaranticolor, had slightly distorted leaves, mild mottling, and a crinkled appearance on new growth. Distal leaves of inoculated plants, except C. amaranticolor, tested positive for WGMMV by RT-PCR, and mock-inoculated plants were negative. C. amaranticolor developed local lesions on inoculated leaves. All plants were CGMMV negative by RT-PCR. During this work a second WGMMV detection occurred in June 2018 in Fresno County, also from a mixed cucurbit field. Both detections represent the first time WGMMV has been identified in California and North America and the second detection of the virus in cucurbit crops. The economic impact, means of transmission, and spread of this virus are currently unknown and merit further study.

A tRNA-Derived Small RNA Regulates Ribosomal Protein S28 Protein Levels after Translation Initiation in Humans and Mice

tRNA-derived small RNAs (tsRNAs) have been implicated in many cellular processes, yet the detailed mechanisms are not well defined. We previously found that the 3' end of Leu-CAG tRNA-derived small RNA (LeuCAG3'tsRNA) regulates ribosome biogenesis in humans by maintaining ribosomal protein S28 (RPS28) levels. The tsRNA binds to coding (CDS) and non-coding 3' UTR sequence in the RPS28 mRNA, altering its secondary structure and enhancing its translation. Here we report that the functional 3' UTR target site is present in primates while the CDS target site is present in many vertebrates. We establish that this tsRNA also regulates mouse Rps28 translation by interacting with the CDS target site. We further establish that the change in mRNA translation occurred at a post-initiation step in both species. Overall, our results suggest that LeuCAG3'tsRNA might maintain ribosome biogenesis through a conserved gene regulatory mechanism in vertebrates.

Genome-wide analysis of the H3K27me3 epigenome and transcriptome in Brassica rapa.

BackgroundGenome-wide maps of histone modifications have been obtained for several plant species. However, most studies focus on model systems and do not enforce FAIR data management principles. Here we study the H3K27me3 epigenome and associated transcriptome of Brassica rapa, an important vegetable cultivated worldwide.FindingsWe performed H3K27me3 chromatin immunoprecipitation followed by high-throughput sequencing and transcriptomic analysis by 3′-end RNA sequencing from B. rapa leaves and inflorescences. To analyze these data we developed a Reproducible Epigenomic Analysis pipeline using Galaxy and Jupyter, packaged into Docker images to facilitate transparency and reuse. We found that H3K27me3 covers roughly one-third of all B. rapa protein-coding genes and its presence correlates with low transcript levels. The comparative analysis between leaves and inflorescences suggested that the expression of various floral regulatory genes during development depends on H3K27me3. To demonstrate the importance of H3K27me3 for B. rapa development, we characterized a mutant line deficient in the H3K27 methyltransferase activity. We found that braA.clf mutant plants presented pleiotropic alterations, e.g., curly leaves due to increased expression and reduced H3K27me3 levels at AGAMOUS-like loci.ConclusionsWe characterized the epigenetic mark H3K27me3 at genome-wide levels and provide genetic evidence for its relevance in B. rapa development. Our work reveals the epigenomic landscape of H3K27me3 in B. rapa and provides novel genomics datasets and bioinformatics analytical resources. We anticipate that this work will lead the way to further epigenomic studies in the complex genome of Brassica crops.

A novel 5'-hydroxyl dinucleotide hydrolase activity for the DXO/Rai1 family of enzymes.

Modifications at the 5′-end of RNAs play a pivotal role in determining their fate. In eukaryotes, the DXO/Rai1 family of enzymes removes numerous 5′-end RNA modifications, thereby regulating RNA turnover. Mouse DXO catalyzes the elimination of incomplete 5′-end caps (including pyrophosphate) and the non-canonical NAD+ cap on mRNAs, and possesses distributive 5′-3′ exoribonuclease activity toward 5′-monophosphate (5′-PO4) RNA. Here, we demonstrate that DXO also catalyzes the hydrolysis of RNAs bearing a 5′-hydroxyl group (5′-OH RNA). The crystal structure of DXO in complex with a 5′-OH RNA substrate mimic at 2.0 Å resolution provides elegant insight into the molecular mechanism of this activity. More importantly, the structure predicts that DXO first removes a dinucleotide from 5′-OH RNA. Our nuclease assays confirm this prediction and demonstrate that this 5′-hydroxyl dinucleotide hydrolase (HDH) activity for DXO is higher than the subsequent 5′-3′ exoribonuclease activity for selected substrates. Fission yeast Rai1 also has HDH activity although it does not have 5′-3′ exonuclease activity, and the Rat1-Rai1 complex can completely degrade 5′-OH RNA. An Arabidopsis DXO1 variant is active toward 5′-OH RNA but prefers 5′-PO4 RNA. Collectively, these studies demonstrate the diverse activities of DXO/Rai1 and expands the collection of RNA substrates that can undergo 5′-3′ mediated decay.

NAD Analogs in Aid of Chemical Biology and Medicinal Chemistry.

Nicotinamide adenine dinucleotide (NAD) serves as an essential redox co-factor and mediator of multiple biological processes. Besides its well-established role in electron transfer reactions, NAD serves as a substrate for other biotransformations, which, at the molecular level, can be classified as protein post-translational modifications (protein deacylation, mono-, and polyADP-ribosylation) and formation of signaling molecules (e.g., cyclic ADP ribose). These biochemical reactions control many crucial biological processes, such as cellular signaling and recognition, DNA repair and epigenetic modifications, stress response, immune response, aging and senescence, and many others. However, the links between the biological effects and underlying molecular processes are often poorly understood. Moreover, NAD has recently been found to tag the 5′-ends of some cellular RNAs, but the function of these NAD-capped RNAs remains largely unrevealed. Synthetic NAD analogs are invaluable molecular tools to detect, monitor, structurally investigate, and modulate activity of NAD-related enzymes and biological processes in order to aid their deeper understanding. Here, we review the recent advances in the design and development of NAD analogs as probes for various cellular NAD-related enzymes, enzymatic inhibitors with anticancer or antimicrobial therapeutic potential, and other NAD-related chemical biology tools. We focus on research papers published within the last 10 years.

Identification of a Type-Specific Promoter Element That Differentiates between Influenza A and B Viruses.

Type A and type B influenza viruses (FluA and FluB viruses) are two major human pathogens that share common structural and functional features. FluA and FluB viruses can reassort within each type but never between the types. Here, we bioinformatically analyzed all promoter sequences of FluA and FluB viruses and confirmed the presence of the type-specific promoter elements. We then studied the promoter elements with cell-based in vivo assays and an in vitro replication initiation assay. Our results identified, for the first time, a type-specific promoter element-the nucleotide at position 5 in the 3' end of the viral RNA (vRNA)-that plays a key role(s) in modulating polymerase activity in a type-specific manner. Interestingly, swapping the promoter element between FluA and FluB recombinant viruses showed different tolerances: the replacement of FluA virus-specific U5 with FluB virus-specific C5 in influenza virus A/WSN/33 (H1N1) could be reverted to U5 after 2 to 3 passages, while the replacement of FluB virus-specific C5 with FluA virus-specific U5 in influenza virus B/Yamagata/88 could be maintained, but with significantly reduced replication efficiency. Therefore, our findings indicate that the nucleotide variation at position 5 in the 3' end of the vRNA promoter between FluA and FluB viruses contributes to their RNP incompatibility, which may shed new light on the mechanisms of intertypic exclusion of reassortment between FluA and FluB viruses.IMPORTANCE Genetic reassortment of influenza virus plays a key role in virus evolution and the emergence of pandemic strains. The reassortment occurs extensively within either FluA or FluB viruses but never between them. Here, we bioinformatically compared available promoter sequences of FluA and FluB viruses and confirmed the presence of the type-specific promoter elements. Our in vivo and in vitro mutagenesis studies showed that a type-specific promoter element-the nucleotide at position 5 in the 3' end of vRNA promoters-plays key roles in modulating polymerase activity. Interestingly, FluA and FluB viruses showed different tolerances upon key promoter element swapping in the context of virus infections. We concluded that the nucleotide at position 5 in the 3' end of the vRNA promoters of FluA and FluB viruses is a critical type-specific determinant. This work has implications for further elucidating the mechanisms of the intertypic exclusion of reassortment between FluA and FluB viruses.

Structural studies of the eIF4E-VPg complex reveal a direct competition for capped RNA: Implications for translation.

Viruses have transformed our understanding of mammalian RNA processing, including facilitating the discovery of the methyl-7-guanosine (m7G) cap on the 5' end of RNAs. The m7G cap is required for RNAs to bind the eukaryotic translation initiation factor eIF4E and associate with the translation machinery across plant and animal kingdoms. The potyvirus-derived viral genome-linked protein (VPg) is covalently bound to the 5' end of viral genomic RNA (gRNA) and associates with host eIF4E for successful infection. Divergent models to explain these observations proposed either an unknown mode of eIF4E engagement or a competition of VPg for the m7G cap-binding site. To dissect these possibilities, we resolved the structure of VPg, revealing a previously unknown 3-dimensional (3D) fold, and characterized the VPg-eIF4E complex using NMR and biophysical techniques. VPg directly bound the cap-binding site of eIF4E and competed for m7G cap analog binding. In human cells, VPg inhibited eIF4E-dependent RNA export, translation, and oncogenic transformation. Moreover, VPg formed trimeric complexes with eIF4E-eIF4G, eIF4E bound VPg-luciferase RNA conjugates, and these VPg-RNA conjugates were templates for translation. Informatic analyses revealed structural similarities between VPg and the human kinesin EG5. Consistently, EG5 directly bound eIF4E in a similar manner to VPg, demonstrating that this form of engagement is relevant beyond potyviruses. In all, we revealed an unprecedented modality for control and engagement of eIF4E and show that VPg-RNA conjugates functionally engage eIF4E. As such, potyvirus VPg provides a unique model system to interrogate eIF4E.

FFPEcap-seq: a method for sequencing capped RNAs in formalin-fixed paraffin-embedded samples.

The majority of clinical cancer specimens are preserved as formalin-fixed paraffin-embedded (FFPE) samples. For clinical molecular tests to have wide-reaching impact, they must be applicable to FFPE material. Accurate quantitative measurements of RNA derived from FFPE specimens is challenging because of low yields and high amounts of degradation. Here, we present FFPEcap-seq, a method specifically designed for sequencing capped 5′ ends of RNA derived from FFPE samples. FFPEcap-seq combines enzymatic enrichment of 5′ capped RNAs with template switching to create sequencing libraries. We find that FFPEcap-seq can faithfully capture mRNA expression levels in FFPE specimens while also detecting enhancer RNAs that arise from distal regulatory regions. FFPEcap-seq is a fast and straightforward method for making high-quality 5′ end RNA-seq libraries from FFPE-derived RNA.

PmiREN: a comprehensive encyclopedia of plant miRNAs.

MicroRNAs (miRNAs) are small non-coding RNA molecules that function as diverse endogenous gene regulators at the post-transcriptional level. In the past two decades, as research effort on miRNA identification, function and evolution has soared, so has the demand for miRNA databases. However, the current plant miRNA databases suffer from several typical drawbacks, including a lack of entries for many important species, uneven annotation standards across different species, abundant questionable entries, and limited annotation. To address these issues, we developed a knowledge-based database called Plant miRNA Encyclopedia (PmiREN, http://www.pmiren.com/), which was based on uniform processing of sequenced small RNA libraries using miRDeep-P2, followed by manual curation using newly updated plant miRNA identification criteria, and comprehensive annotation. PmiREN currently contains 16,422 high confidence novel miRNA loci in 88 plant species and 3,966 retrieved from miRBase. For every miRNA entry, information on precursor sequence, precursor secondary structure, expression pattern, clusters and synteny in the genome, potential targets supported by Parallel Analysis of RNA Ends (PARE) sequencing, and references is attached whenever possible. PmiREN is hierarchically accessible and has eight built-in search engines. We believe PmiREN is useful for plant miRNA cataloguing and data mining, therefore a resource for data-driven miRNA research in plants.

Termination of pre-mRNA splicing requires that the ATPase and RNA unwindase Prp43p acts on the catalytic snRNA U6.

The termination of pre-mRNA splicing functions to discard suboptimal substrates, thereby enhancing fidelity, and to release excised introns in a manner coupled to spliceosome disassembly, thereby allowing recycling. The mechanism of termination, including the RNA target of the DEAH-box ATPase Prp43p, remains ambiguous. We discovered a critical role for nucleotides at the 3' end of the catalytic U6 small nuclear RNA in splicing termination. Although conserved sequence at the 3' end is not required, 2' hydroxyls are, paralleling requirements for Prp43p biochemical activities. Although the 3' end of U6 is not required for recruiting Prp43p to the spliceosome, the 3' end cross-links directly to Prp43p in an RNA-dependent manner. Our data indicate a mechanism of splicing termination in which Prp43p translocates along U6 from the 3' end to disassemble the spliceosome and thereby release suboptimal substrates or excised introns. This mechanism reveals that the spliceosome becomes primed for termination at the same stage it becomes activated for catalysis, implying a requirement for stringent control of spliceosome activity within the cell.

Structural and functional characterisation of human RNA helicase DHX8 provides insights into the mechanism of RNA-stimulated ADP release.

DHX8 is a crucial DEAH-box RNA helicase involved in splicing and required for the release of mature mRNA from the spliceosome. Here, we report the biochemical characterisation of full-length human DHX8 and the catalytically active helicase core DHX8Δ547, alongside crystal structures of DHX8Δ547 bound to ADP and a structure of DHX8Δ547 bound to poly(A)6 single-strand RNA. Our results reveal that DHX8 has an in vitro binding preference for adenine-rich RNA and that RNA binding triggers the release of ADP through significant conformational flexibility in the conserved DEAH-, P-loop and hook-turn motifs. We demonstrate the importance of R620 and both the hook-turn and hook-loop regions for DHX8 helicase activity and propose that the hook-turn acts as a gatekeeper to regulate the directional movement of the 3' end of RNA through the RNA-binding channel. This study provides an in-depth understanding of the activity of DHX8 and contributes insights into the RNA-unwinding mechanisms of the DEAH-box helicase family.

Dynamics of Protein Accumulation from the 3' End of Viral RNA Are Different from Those in the Rest of the Genome in Potato Virus A Infection.

One large open reading frame (ORF) encodes 10 potyviral proteins. We compared the accumulation of cylindrical inclusion (CI) protein from the middle, coat protein (CP) from the 3'end, and Renilla luciferase (RLUC) from two distinct locations in potato virus A (PVA) RNA. 5' RLUC was expressed from an rluc gene inserted between the P1 and helper component proteinase (HCPro) cistrons, and 3' RLUC was expressed from the gene inserted between the RNA polymerase and CP cistrons. Viral protein and RNA accumulation were quantitated (i) when expressed from PVA RNA in the presence of ectopically expressed genome-linked viral protein (VPg) and auxiliary proteins and (ii) at different time points during natural infection. The rate and timing of 3' RLUC and CP accumulation were found to be different from those of 5' RLUC and CI. Ectopic expression of VPg boosted PVA RNA, 3' RLUC, and, together with HCPro, CP accumulation, whereas 5' RLUC and CI accumulation remained unaffected regardless of the increased viral RNA amount. In natural infection, the rate of the noteworthy minute early accumulation of 3' RLUC accelerated toward the end of infection. 5' RLUC accumulation, which was already pronounced at 2 days postinfection, increased moderately and stabilized to a constant level by day 5, whereas PVA RNA and CP levels continued to increase throughout the infection. We propose that these observations connect with the mechanisms by which potyvirus infection limits CP accumulation during early infection and specifically supports its accumulation late in infection, but follow-up studies are required to understand the mechanism of how this occurs.IMPORTANCE The results of this study suggest that the dynamics of potyviral protein accumulation are regulated differentially from the 3' end of viral RNA than from the rest of the genome, the significance of which would be to satisfy the needs of replication early and particle assembly late in infection.

Synthesis of Adenine Dinucleosides 2′,5′‐Bridged by Sulfur‐Containing Linkers as Bisubstrate SAM Analogues for Viral RNA 2′‐O‐Methyltransferases

Viral RNA 2′‐O‐methyltransferases play a crucial role for luring the host cell innate antiviral response during a viral infection by catalyzing either the methylation of the 5′‐end RNA cap‐structure at 2′‐OH of nucleoside N1 or by inducing internal 2′‐O‐methylation of adenosines within RNA sequence using S‐adenosyl‐l‐methionine (SAM) as the methyl donor. Our goal is to synthesize bisubstrate SAM analogues mimicking the transition state of the 2′‐O‐methylation of the RNA in order to block viral 2′‐O‐methyltransferases and struggle against emerging viruses. Here we designed and synthesized five dinucleosides by connecting a 5′‐thioadenosine representing the SAM to the 2′‐OH of another adenosine unit mimicking the RNA substrate, via various sized sulfur‐containing linkers such as alkylthioether linkers, sulfoxide or sulfone derivatives, or a disulfide bond.

Exploration of CCA-added RNAs revealed the expression of mitochondrial non-coding RNAs regulated by CCA-adding enzyme

ABSTRACTPost-transcriptional non-template additions of nucleotides to 3′-ends of RNAs play important roles in the stability and function of RNA molecules. Although tRNA nucleotidyltransferase (CCA-adding enzyme) is known to add CCA trinucleotides to 3′-ends of tRNAs, whether other RNA species can be endogenous substrates of CCA-adding enzyme has not been widely explored yet. Herein, we used YAMAT-seq to identify non-tRNA substrates of CCA-adding enzyme. YAMAT-seq captures RNA species that form secondary structures with 4-nt protruding 3′-ends of the sequence 5′-NCCA-3′, which is the hallmark structure of RNAs that are generated by CCA-adding enzyme. By executing YAMAT-seq for human breast cancer cells and mining the sequence data, we identified novel candidate substrates of CCA-adding enzyme. These included fourteen ‘CCA-RNAs’ that only contain CCA as non-genomic sequences, and eleven ‘NCCA-RNAs’ that contain CCA and other nucleotides as non-genomic sequences. All newly-identified (N)CCA-RNAs were derived from the mitochondrial genome and were localized in mitochondria. Knockdown of CCA-adding enzyme severely reduced the expression levels of (N)CCA-RNAs, suggesting that the CCA-adding enzyme-catalyzed CCA additions stabilize the expression of (N)CCA-RNAs. Furthermore, expression levels of (N)CCA-RNAs were severely reduced by various cellular treatments, including UV irradiation, amino acid starvation, inhibition of mitochondrial respiratory complexes, and inhibition of the cell cycle. These results revealed a novel CCA-mediated regulatory pathway for the expression of mitochondrial non-coding RNAs.