Rickettsia Genomes Research Articles

Widespread use of real-time PCR for rickettsial diagnosis: Figure 1

We report 2years of experience with rickettsial molecular diagnosis using real-time PCR at the French National Reference Center. All Rickettsia genomes available were compared to discover specific sequences to design new sets of primers and probes. The specificity was verified in silico and against a panel of 30 rickettsial species. Sensitivity was determined using 10-fold serial dilutions. Finally, primers and probes that were both specific and sensitive were routinely used for the diagnosis of rickettsial infections from clinical specimens. We retained sets of primers and probes to detect spotted fever group Rickettsia, typhus group Rickettsia,Rickettsia conorii,Rickettsia slovaca,Rickettsia africae and Rickettsia australis; 643 clinical samples were screened for the presence of Rickettsia DNA. Overall, 45 positive samples were detected, including 15 Rickettsia africae, nine R.conorii, five Rickettsia sibirica mongolitimonae, four R.slovaca, two R.australis, four Rickettsia massiliae, one Rickettsia honei, one Rickettsia typhi and eight Rickettsia sp. Positive samples were detected mainly from cutaneous biopsies and swabs (31/45). Widespread use of real-time PCR is inexpensive and reduces delay in the diagnosis of rickettsial infections. These real-time PCR assays could be implemented easily in laboratories that have molecular facilities and may be added to existing molecular tools as a point-of-care strategy.

Tropism and Pathogenicity of Rickettsiae

Rickettsiae are obligate intracellular parasitic bacteria that cause febrile exanthematous illnesses such as Rocky Mountain spotted fever, Mediterranean spotted fever, epidemic, and murine typhus, etc. Although the vector ranges of each Rickettsia species are rather restricted; i.e., ticks belonging to Arachnida and lice and fleas belonging to Insecta usually act as vectors for spotted fever group (SFG) and typhus group (TG) rickettsiae, respectively, it would be interesting to elucidate the mechanisms controlling the vector tropism of rickettsiae. This review discusses the factors determining the vector tropism of rickettsiae. In brief, the vector tropism of rickettsiae species is basically consistent with their tropism toward cultured tick and insect cells. The mechanisms responsible for rickettsiae pathogenicity are also described. Recently, genomic analyses of rickettsiae have revealed that they possess several genes that are homologous to those affecting the pathogenicity of other bacteria. Analyses comparing the genomes of pathogenic and non-pathogenic strains of rickettsiae have detected many factors that are related to rickettsial pathogenicity. It is also known that a reduction in the rickettsial genome has occurred during the course of its evolution. Interestingly, Rickettsia species with small genomes, such as Rickettsia prowazekii, are more pathogenic to humans than those with larger genomes. This review also examines the growth kinetics of pathogenic and non-pathogenic species of SFG rickettsiae (SFGR) in mammalian cells. The growth of non-pathogenic species is restricted in these cells, which is mediated, at least in part, by autophagy. The superinfection of non-pathogenic rickettsiae-infected cells with pathogenic rickettsiae results in an elevated yield of the non-pathogenic rickettsiae and the growth of the pathogenic rickettsiae. Autophagy is restricted in these cells. These results are discussed in this review.

Effect of rickettsial toxin VapC on its eukaryotic host.

Rickettsia are intracellular bacteria typically associated with arthropods that can be transmitted to humans by infected vectors. Rickettsia spp. can cause mild to severe human disease with a possible protection effect of corticosteroids when antibiotic treatments are initiated. We identified laterally transferred toxin-antitoxin (TA) genetic elements, including vapB/C, in several Rickettsia genomes and showed that they are functional in bacteria and eukaryotic cells. We also generated a plaque assay to monitor the formation of lytic plaques over time and demonstrated that chloramphenicol accelerates host cell lysis of vapB/C-containing Rickettsia. Whole-genome expression, TUNEL and FISH assays on the infected cells following exposure to the antibiotic revealed early apoptosis of host cells, which was linked to over-transcription of bacterial vapB/C operons and subsequent cytoplasmic VapC toxin release. VapC that is expressed in Escherichia coli and Saccharomyces cerevisiae or microinjected into mammalian cells is toxic through RNase activity and is prevented by dexamethasone. This study provides the first biological evidence that toxin–antitoxin elements act as pathogenic factors in bacterial host cells, confirming comparative genomic evidence of their role in bacterial pathogenicity. Our results suggest that early mortality following antibiotic treatment of some bacterial infections can be prevented by administration of dexamethasone.

Rickettsial evolution in the light of comparative genomics

Rickettsia are best known as strictly intracellular vector-borne bacteria that cause mild to severe diseases in humans and other animals. Recent advances in molecular tools and biological experiments have unveiled a wide diversity of Rickettsia spp. that include species with a broad host range and some species that act as endosymbiotic associates. Molecular phylogenies of Rickettsia spp. contain some ambiguities, such as the position of R. canadensis and relationships within the spotted fever group. In the modern era of genomics, with an ever-increasing number of sequenced genomes, there is enhanced interest in the use of whole-genome sequences to understand pathogenesis and assess evolutionary relationships among rickettsial species. Rickettsia have small genomes (1.1-1.5 Mb) as a result of reductive evolution. These genomes contain split genes, gene remnants and pseudogenes that, owing to the colinearity of some rickettsial genomes, may represent different steps of the genome degradation process. Genomics reveal extreme genome reduction and massive gene loss in highly vertebrate-pathogenic Rickettsia compared to less virulent or endosymbiotic species. Information gleaned from rickettsial genomics challenges traditional concepts of pathogenesis that focused primarily on the acquisition of virulence factors. Another intriguing phenomenon about the reduced rickettsial genomes concerns the large fraction of non-coding DNA and possible functionality of these "non-coding" sequences, because of the high conservation of these regions. Despite genome streamlining, Rickettsia spp. contain gene families, selfish DNA, repeat palindromic elements and genes encoding eukaryotic-like motifs. These features participate in sequence and functional diversity and may play a crucial role in adaptation to the host cell and pathogenesis. Genome analyses have identified a large fraction of mobile genetic elements, including plasmids, suggesting the possibility of lateral gene transfer in these intracellular bacteria. Phylogenetic analyses have identified several candidates for horizontal gene acquisition among Rickettsia spp. including tra, pat2, and genes encoding for the type IV secretion system and ATP/ADP translocase that may have been acquired from bacteria living in amoebae. Gene loss, gene duplication, DNA repeats and lateral gene transfer all have shaped rickettsial genome evolution. A comprehensive analysis of the entire genome, including genes and non-coding DNA, will help to unlock the mysteries of rickettsial evolution and pathogenesis.

TheRickettsia conoriiAutotransporter Protein Sca1 Promotes Adherence to Nonphagocytic Mammalian Cells

The pathogenesis of spotted fever group (SFG) Rickettsia species, including R. conorii and R. rickettsii, is acutely dependent on adherence to and invasion of host cells, including cells of the mammalian endothelial system. Bioinformatic analyses of several rickettsia genomes revealed the presence of a cohort of genes designated sca genes that are predicted to encode proteins with homology to autotransporter proteins of Gram-negative bacteria. Previous work demonstrated that three members of this family, rOmpA (Sca0), Sca2, and rOmpB (Sca5) are involved in the interaction with mammalian cells; however, very little was known about the function of other conserved rickettsial Sca proteins. Here we demonstrate that sca1, a gene present in nearly all SFG rickettsia genomes, is actively transcribed and expressed in R. conorii cells. Alignment of Sca1 sequences from geographically diverse SFG Rickettsia species showed that there are high degrees of sequence identity and conservation of these sequences, suggesting that Sca1 may have a conserved function. Using a heterologous expression system, we demonstrated that production of R. conorii Sca1 in the Escherichia coli outer membrane is sufficient to mediate attachment to but not invasion of a panel of cultured mammalian epithelial and endothelial cells. Furthermore, preincubation of a recombinant Sca1 peptide with host cells blocked R. conorii cell association. Together, these results demonstrate that attachment to mammalian cells can be uncoupled from the entry process and that Sca1 is involved in the adherence of R. conorii to host cells.

Improvement of RNA purification from infected tissues to explore the in vivo host–pathogen interactions with microarrays

Rickettsiae are Gram-negative alpha proteobacteria and arthropod-borne disease agents of spotted fevers and typhus [1]. Because of their obligate intracellular lifestyle, the molecular mechanisms involved in their pathogenicity are still poorly understood. To circumvent the difficulties in working with these bacteria, rickettsial genomes have been sequenced, thus allowing further postgenomic studies. DNA microarrays can be considered as powerful tools to understand the host–pathogen interactions in the course of infectious diseases. Exploring the RNA profiles of both host and pathogen promises to improve our knowledge of the infectious process, thus favouring the development of preventive or therapeutic strategies [2]. While published studies mainly focused on the eukaryotic response, the complementary picture, i.e. the bacterial response, was poorly analysed because of several technical limitations [3]. The transcriptomic analysis of R. conorii was recently performed by microarrays [4]. This bacterium is responsible for Mediterranean spotted fever (MSF), a disease characterised by a skin lesion called eschar caused by the bite of its vector, the brown dog tick, Rhipicephalus sanguineus [5]. The aim of this work was to analyse the transcriptome pattern of rickettsiae within such eschars using the same strategy based on the removal of eukaryotic contaminants coupled with subsequent random amplification of cDNA. Our goal was also to recover eukaryotic RNA from the same sample, thus considering both sides of the host–pathogen interaction. Preliminary assays were performed using rabbit eschars generated by the sub-cutaneous inoculation of purified bacteria (not shown). Human eschars were collected by sterile scalpel excision from patients suffering from MSF and immediately placed at 4 C overnight in 1 mL of RNA Later (Qiagen, Valencia, California, USA) before storage at )80 C. The biopsies were rapidly decontaminated by a 5-min incubation in iodated alcohol and 1 min washing in nuclease free water. The tissues excised in small pieces were mechanically lysed with tungsten beads and using the Mixer Mill MM3 (Qiagen), before enzymatic digestion with proteinase K. The total RNA was extracted from resulting lysates using the RNeasy Micro kit (Qiagen). Eukaryotic RNA was removed from the total RNA sample using the MicroEnrich Kit (Ambion, Austin, Texas, USA) as described [4]. To recover the eukaryotic RNA from the same sample, the beads were then mixed in TE buffer pH 8 and heated for 1 min at 95 C. The supernatants were collected and precipitated with alcohol. The bacterial RNA was retro-transcribed using random primers and amplified with the Genomiphi kit (GE Healthcare, Piscataway, New Jersey, USA), while human RNA was amplified using poly d(T) primers with T7 polymerase (Agilent, Santa Clara, California, USA). To check for the quality of amplification, PCR were performed on cDNA using primers targeting the rrs gene from R. conorii (FGGCTCAGAACGAACGCTATC ⁄R-GTTAGCTGCGAAACCGAAAG) and the eukaryotic actin gene (F-GGACTTCGAGCAAGAGATGG ⁄R-AGCACTGTGTTGGCGTACAG), respectively. Hybridisations of prokaryotic cDNA were achieved following Cy3 or Cy5 labelling of R. conorii from eschars and using bacteria grown in vero cells as control. R. conorii microarrays were obtained from Agilent (‘Custom microarray’ design) and processed as described [6]. Hybridisations of human microarrays (Agilent) were performed with one colour labelling as recommended. The electrophoregrams obtained with the Bioanalyzer (Agilent) indicated that the extraction of Corresponding author and reprint requests: P. Renesto, Universite de la Mediterranee, URMITE IRD-CNRS 6236, Faculte de Medecine, 27 Bd Jean Moulin, 13385 Marseille, cedex 05, France E-mail: patricia.renesto@univmed.fr

Characterization of Sec-Translocon-Dependent Extracytoplasmic Proteins of Rickettsia typhi

As obligate intracellular, vector-borne bacteria, rickettsiae must adapt to both mammalian and arthropod host cell environments. Deciphering the molecular mechanisms of the interactions between rickettsiae and their host cells has largely been hindered by the genetic intractability of these organisms; however, research in other gram-negative pathogens has demonstrated that many bacterial determinants of attachment, entry, and pathogenesis are extracytoplasmic proteins. The annotations of several rickettsial genomes indicate the presence of homologs of the Sec translocon, the major route for bacterial protein secretion from the cytoplasm. For Rickettsia typhi, the etiologic agent of murine typhus, homologs of the Sec-translocon-associated proteins LepB, SecA, and LspA have been functionally characterized; therefore, the R. typhi Sec apparatus represents a mechanism for the secretion of rickettsial proteins, including virulence factors, into the extracytoplasmic environment. Our objective was to characterize such Sec-dependent R. typhi proteins in the context of a mammalian host cell infection. By using the web-based programs LipoP, SignalP, and Phobius, a total of 191 R. typhi proteins were predicted to contain signal peptides targeting them to the Sec translocon. Of these putative signal peptides, 102 were tested in an Escherichia coli-based alkaline phosphatase (PhoA) gene fusion system. Eighty-four of these candidates exhibited signal peptide activity in E. coli, and transcriptional analysis indicated that at least 54 of the R. typhi extracytoplasmic proteins undergo active gene expression during infections of HeLa cells. This work highlights a number of interesting proteins possibly involved in rickettsial growth and virulence in mammalian cells.

Rickettsia Phylogenomics: Unwinding the Intricacies of Obligate Intracellular Life

BackgroundCompleted genome sequences are rapidly increasing for Rickettsia, obligate intracellular α-proteobacteria responsible for various human diseases, including epidemic typhus and Rocky Mountain spotted fever. In light of phylogeny, the establishment of orthologous groups (OGs) of open reading frames (ORFs) will distinguish the core rickettsial genes and other group specific genes (class 1 OGs or C1OGs) from those distributed indiscriminately throughout the rickettsial tree (class 2 OG or C2OGs).Methodology/Principal FindingsWe present 1823 representative (no gene duplications) and 259 non-representative (at least one gene duplication) rickettsial OGs. While the highly reductive (∼1.2 MB) Rickettsia genomes range in predicted ORFs from 872 to 1512, a core of 752 OGs was identified, depicting the essential Rickettsia genes. Unsurprisingly, this core lacks many metabolic genes, reflecting the dependence on host resources for growth and survival. Additionally, we bolster our recent reclassification of Rickettsia by identifying OGs that define the AG (ancestral group), TG (typhus group), TRG (transitional group), and SFG (spotted fever group) rickettsiae. OGs for insect-associated species, tick-associated species and species that harbor plasmids were also predicted. Through superimposition of all OGs over robust phylogeny estimation, we discern between C1OGs and C2OGs, the latter depicting genes either decaying from the conserved C1OGs or acquired laterally. Finally, scrutiny of non-representative OGs revealed high levels of split genes versus gene duplications, with both phenomena confounding gene orthology assignment. Interestingly, non-representative OGs, as well as OGs comprised of several gene families typically involved in microbial pathogenicity and/or the acquisition of virulence factors, fall predominantly within C2OG distributions.Conclusion/SignificanceCollectively, we determined the relative conservation and distribution of 14354 predicted ORFs from 10 rickettsial genomes across robust phylogeny estimation. The data, available at PATRIC (PathoSystems Resource Integration Center), provide novel information for unwinding the intricacies associated with Rickettsia pathogenesis, expanding the range of potential diagnostic, vaccine and therapeutic targets.

Visualization of pseudogenes in intracellular bacteria reveals the different tracks to gene destruction

Variably present genes and pseudogenes in Rickettsia species tend to have been acquired more recently and to be more divergent from the genes conserved across all species

Development of a method for recovering rickettsial RNA from infected cells to analyze gene expression profiling of obligate intracellular bacteria

The Rickettsia genus is composed of Gram-negative bacteria responsible for Typhus and spotted fevers. Because of the limitations imposed by their obligate intracellular location, the molecular mechanisms responsible for their pathogenicity remain poorly understood. Several rickettsial genomes are now available, thus providing the foundation for a new era of post-genomic research. Here, using Rickettsia conorii as model, we developed a suitable method for microarray-based transcriptome analysis of rickettsiae. Total RNA was extracted from infected Vero cells using a protocol preserving its integrity, as observed by Bioanalyzer (Agilent) profiles. By a subtractive hybridization method, the samples were subsequently depleted of eukaryotic RNA that represents up to 90% of the whole extract and that hampers fluorochrome labeling of rickettsial nucleic acids. To obtain the amount of material required for microarray hybridization, the bacterial RNA was then amplified using random primers. Hybridizations were carried out on microarrays specific for R. conorii but containing a limited number of selected targets. Our results show that this method yielded reproducible signals. Transcriptional changes observed following exposure of R. conorii to a nutrient stress were verified by real-time quantitative PCR and by quantitative reverse transcription PCR starting from amplified cDNA and total RNA as templates, respectively. We conclude that this approach has great potential for the study of mechanisms behind the virulence and intracellular survival of members of the genus Rickettsia.

Lateral gene transfer between obligate intracellular bacteria: Evidence from the Rickettsia massiliae genome

Rickettsia massiliae is a tick-borne obligate intracellular alpha-proteobacteria causing spotted fever in humans. Here, we present the sequence of its genome, comprising a 1.3-Mb circular chromosome and a 15.3-kb plasmid. The chromosome exhibits long-range colinearity with the other Spotted Fever Group Rickettsia genomes, except for a large fragment specific to R. massiliae that contains 14 tra genes presumably involved in pilus formation and conjugal DNA transfer. We demonstrate that the tra region was acquired recently by lateral gene transfer (LGT) from a species related to Rickettsia bellii. Further analysis of the genomic sequences identifies additional candidates of LGT between Rickettsia. Our study indicates that recent LGT between obligate intracellular Rickettsia is more common than previously thought.

Mariner -Based Transposon Mutagenesis of Rickettsia prowazekii

Rickettsia prowazekii, the causative agent of epidemic typhus, is an obligate intracellular bacterium that grows directly within the cytoplasm of its host cell, unbounded by a vacuolar membrane. The obligate intracytoplasmic nature of rickettsial growth places severe restrictions on the genetic analysis of this distinctive human pathogen. In order to expand the repertoire of genetic tools available for the study of this pathogen, we have employed the versatile mariner-based, Himar1 transposon system to generate insertional mutants of R. prowazekii. A transposon containing the R. prowazekii arr-2 rifampin resistance gene and a gene coding for a green fluorescent protein (GFP(UV)) was constructed and placed on a plasmid expressing the Himar1 transposase. Electroporation of this plasmid into R. prowazekii resulted in numerous transpositions into the rickettsial genome. Transposon insertion sites were identified by rescue cloning, followed by DNA sequencing. Random transpositions integrating at TA sites in both gene coding and intergenic regions were identified. Individual rickettsial clones were isolated by the limiting-dilution technique. Using both fixed and live-cell techniques, R. prowazekii transformants expressing GFP(UV) were easily visible by fluorescence microscopy. Thus, a mariner-based system provides an additional mechanism for generating rickettsial mutants that can be screened using GFP(UV) fluorescence.

Rickettsiae and Rickettsial Infections: The Current State of Knowledge

New human rickettsial pathogens have been discovered, and long-known rickettsiae of undetermined pathogenicity have been demonstrated to cause illness. Disease associated with Rickettsia slovaca has unique clinical manifestations, including prominent lymphadenopathy without fever and rash. Rickettsial genomes are highly conserved, with reductive evolution leading to a small genome that relies on the host cell for many biosynthetic functions. Advances in the evaluation of the pathogenesis of rickettsial disease include identification of rickettsial adhesins, a host cell receptor, signaling elements associated with entry of rickettsiae by induced phagocytosis, rickettsial enzymes mediating phagosomal escape, and host actin-based rickettsial cell-to-cell spread. Disruption of adherens junctions of infected endothelial cells likely plays a role in the critical pathophysiologic mechanism: increased microvascular permeability. Production of reactive oxygen species by infected endothelium injures these cells. However, disseminated intravascular coagulation rarely occurs. Immunity is mediated by reactive cytokine-activated rickettsicidal nitrogen and oxygen species and by clearance of rickettsiae by cytotoxic CD8 T cells.

Transposon insertion reveals pRM, a plasmid of Rickettsia monacensis.

Until the recent discovery of pRF in Rickettsia felis, the obligate intracellular bacteria of the genus Rickettsia (Rickettsiales: Rickettsiaceae) were thought not to possess plasmids. We describe pRM, a plasmid from Rickettsia monacensis, which was detected by pulsed-field gel electrophoresis and Southern blot analyses of DNA from two independent R. monacensis populations transformed by transposon-mediated insertion of coupled green fluorescent protein and chloramphenicol acetyltransferase marker genes into pRM. Two-dimensional electrophoresis showed that pRM was present in rickettsial cells as circular and linear isomers. The 23,486-nucleotide (31.8% G/C) pRM plasmid was cloned from the transformant populations by chloramphenicol marker rescue of restriction enzyme-digested transformant DNA fragments and PCR using primers derived from sequences of overlapping restriction fragments. The plasmid was sequenced. Based on BLAST searches of the GenBank database, pRM contained 23 predicted genes or pseudogenes and was remarkably similar to the larger pRF plasmid. Two of the 23 genes were unique to pRM and pRF among sequenced rickettsial genomes, and 4 of the genes shared by pRM and pRF were otherwise found only on chromosomes of R. felis or the ancestral group rickettsiae R. bellii and R. canadensis. We obtained pulsed-field gel electrophoresis and Southern blot evidence for a plasmid in R. amblyommii isolate WB-8-2 that contained genes conserved between pRM and pRF. The pRM plasmid may provide a basis for the development of a rickettsial transformation vector.

Murine Typhus from Vietnam, Imported into Japan

To the Editor: In Vietnam, many febrile diseases such as malaria, dengue fever, Japanese encephalitis, scrub typhus, and more recently, severe acute respiratory syndrome (SARS) and avian influenza have been reported. Murine typhus cases were also reported during and before the 1960s but not thereafter (1–5). On May 3, 2003, a 54-year-old male resident of Tokushima, Japan, had onset of fever in the suburban town of Cu Chi, ≈60 km northwest of Ho Chi Minh City, Vietnam. Exanthema appeared on his trunk and limbs on May 7. He returned to Japan on May 9 and was admitted to Tokushima University Hospital on May 10. His body temperature was 39.0°C, and serum, C-reactive protein level was high (17.06 mg/dL) on admission (day 8 of illness). Unfortunately, the blood sample taken on that day was discarded. We then collected blood on days 10, 11, 12, 14, 17, and 24 of illness for diagnosis. Minocycline was administered on day 8 and resulted in a gradual decrease in fever and rash. Weil-Felix tests on day 12 showed the serum to be positive for Proteus vulgaris OX19 (titer 160); tests for P. vulgaris OX2 and OXK were negative (titer of 10 for both). We examined blood samples for possible diseases such as malaria, dengue fever, SARS, and rickettsioses. Giemsa-stained peripheral blood samples obtained on day 11 showed no malarial parasites. Results of immunoglobulin M (IgM)-capture ELISA of serum on days 10, 11, and 17 of illness were negative for dengue antibodies. Reverse transcription (RT)–PCR of the serum on day 11 was also negative. RT-PCRs of a pharyngeal swab and urine collected on day 11 were both negative for the SARS coronavirus. These specimens were also injected into Vero cells, and no cytopathic effects were generated. RT-PCR of these cultures was also negative for SARS coronavirus. Moreover, SARS antibodies were not found in serum samples on days 11 and 14 of illness. Serum was also tested for Orientia tsutsugamushi and Coxiella burnttii on day 12 to exclude scrub typhus and Q fever as diagnoses. Indirect immunofluorescence tests for etiologic agents of spotted fever, murine typhus, and epidemic typhus were then performed with serum samples collected on days 10, 14, and 24. We used Rickettsia typhi and R. prowazekii as typhus group (TG) rickettsial antigens and R. japonica and R. conorii as spotted fever group (SFG) rickettsiae. IgM antibody was detected for these antigens, indicating that the disease was a primary infection of rickettsiae (Table). When TG and SFG rickettsioses were compared, TG rickettsiae represented markedly higher elevated titers than SFG rickettsiae, which excluded a diagnosis of SFG rickettsiosis. PCR for the TG rickettsial genome in the convalescent-phase serum on day 10 was negative. Table IFA titers of the patient sera and the cross-absorption test* To demonstrate more detailed antigenic reactivity, Western immunoblotting was performed with serum on day 14 (6). The serum reacted similarly to the ladderlike lipopolysaccharide (LPS) of R. typhi and R. prowazekii. As expected from the group-specific nature of rickettsial LPS, no reaction was demonstrated to LPS of SFG rickettsiae, R. japonica and R. conorii, although weak reactivity, mainly to the major outer member protein of SFG rickettiae, rOmpB, and molecules of smaller sizes was shown (6,7). As described previously, rOmpB has cross-reactive antigenicity between TG and SFG rickettsiae (6). Compared with the trace reaction to rOmpB of SFG rickettsiae, an extremely high level of reaction was demonstrated to rOmpB of TG rickettsiae. These results confirmed the disease to be a TG rickettsiosis. To elucidate whether the disease was murine typhus or epidemic typhus, we conducted cross-absorption tests as described previously (8,9). Serum absorbed by R. typhi showed complete absorption, demonstrating no reaction to R. typhi or R. prowazekii (Table). However, the serum absorbed by R. prowazekii resulted in incomplete absorption, demonstrating no reactivity to R. prowazekii but some reactivity to R. typhi, which was left unabsorbed. Western immunoblotting with the serum absorbed by R. prowazekii showed reactivity only to the rOmpB of R. typhi but not to that of R. prowazekii. These results confirmed the diagnosis of murine typhus. This is the first serodiagnosis of murine typhus in Vietnam since the 1960s (1–5). Since rats inhabit the area where the patient acquired the illness, murine typhus seems to have occurred sporadically or endemically but to have been undiagnosed since the 1960s, maybe because it was thought to have been eradicated and thus widely forgotten. This case was the first imported into Japan since the 1940s, when many Japanese soldiers and residents who returned from abroad had the disease.

On the nature of obligate intracellular symbiosis of rickettsiae — Rickettsia prowazekii cells import mitochondrial porin

Mitochondrial porin was identified in Rickettsia prowazekii by Western blot analysis of whole cells and membrane fractions with monoclonal antibody against porin VDAC 1 of animal mitochondria. Using the BLAST server, no protein sequences homologous to mitochondrial porin were found among the rickettsial genomes. Rickettsiae also do not contain their own porin. The protein imported by rickettsiae is weakly extracted by nonionic detergents and, like porin in mitochondria, is insensitive to proteinase K in whole cells. Immunocytochemical analysis showed that it localizes to the outer membrane of the bacterial cells. These data support an earlier suggestion about import by rickettsiae of indispensable proteins from cytoplasm of the host cell as a molecular basis of obligate intracellular parasitism. They are also consistent with the hypothesis invoking a transfer of genes specifying surface proteins from the last common ancestor of rickettsiae and mitochondria to the host genome, and preservation by rickettsiae of the primitive ability to import these proteins.

Genome Sequence of Rickettsia bellii Illuminates the Role of Amoebae in Gene Exchanges between Intracellular Pathogens

The recently sequenced Rickettsia felis genome revealed an unexpected plasmid carrying several genes usually associated with DNA transfer, suggesting that ancestral rickettsiae might have been endowed with a conjugation apparatus. Here we present the genome sequence of Rickettsia bellii, the earliest diverging species of known rickettsiae. The 1,552,076 base pair–long chromosome does not exhibit the colinearity observed between other rickettsia genomes, and encodes a complete set of putative conjugal DNA transfer genes most similar to homologues found in Protochlamydia amoebophila UWE25, an obligate symbiont of amoebae. The genome exhibits many other genes highly similar to homologues in intracellular bacteria of amoebae. We sought and observed sex pili-like cell surface appendages for R. bellii. We also found that R. bellii very efficiently multiplies in the nucleus of eukaryotic cells and survives in the phagocytic amoeba, Acanthamoeba polyphaga. These results suggest that amoeba-like ancestral protozoa could have served as a genetic “melting pot” where the ancestors of rickettsiae and other bacteria promiscuously exchanged genes, eventually leading to their adaptation to the intracellular lifestyle within eukaryotic cells.

Sca 1, a previously undescribed paralog from autotransporter protein-encoding genes in Rickettsia species

BackgroundAmong the 17 genes encoding autotransporter proteins of the "surface cell antigen" (sca) family in the currently sequenced Rickettsia genomes, ompA, sca5 (ompB) and sca4 (gene D), have been extensively used for identification and phylogenetic purposes for Rickettsia species. However, none of these genes is present in all 20 currently validated Rickettsia species. Of the remaining 14 sca genes, sca1 is the only gene to be present in all nine sequenced Rickettsia genomes. To estimate whether the sca1 gene is present in all Rickettsia species and its usefulness as an identification and phylogenetic tool, we searched for sca1genes in the four published Rickettsia genomes and amplified and sequenced this gene in the remaining 16 validated Rickettsia species.ResultsSca1 is the only one of the 17 rickettsial sca genes present in all 20 Rickettsia species. R. prowazekii and R. canadensis exhibit a split sca1 gene whereas the remaining species have a complete gene. Within the sca1 gene, we identified a 488-bp variable sequence fragment that can be amplified using a pair of conserved primers. Sequences of this fragment are specific for each Rickettsia species. The phylogenetic organization of Rickettsia species inferred from the comparison of sca1 sequences strengthens the classification based on the housekeeping gene gltA and is similar to those obtained from the analyses of ompA, sca5 and sca4, thus suggesting similar evolutionary constraints. We also observed that Sca1 protein sequences have evolved under a dual selection pressure: with the exception of typhus group rickettsiae, the amino-terminal part of the protein that encompasses the predicted passenger domain, has evolved under positive selection in rickettsiae. This suggests that the Sca1 protein interacts with the host. In contrast, the C-terminal portion containing the autotransporter domain has evolved under purifying selection. In addition, sca1 is transcribed in R. conorii, and might therefore be functional in this species.ConclusionThe sca1 gene, encoding an autotransporter protein that evolves under dual evolution pressure, is the only sca-family gene to be conserved by all Rickettsia species. As such, it is a valuable identification target for these bacteria, especially because rickettsial isolates can be identified by amplification and sequencing of a discriminatory gene fragment using a single primer pair. It may also be used as a phylogenetic tool. However, its current functional status remains to be determined although it was found expressed in R. conorii.

Progress in Rickettsial Genome Analysis from Pioneering of Rickettsia prowazekii to the Recent Rickettsia typhi

Three rickettsial genomes have been sequenced and annotated. Rickettsia prowazekii and R. typhi have similar gene order and content. The few differences between R. prowazekii and R. typhi include a 12-kb insertion in R. prowazekii, a large inversion close to the origin of replication in R. typhi, and loss of the complete cytochrome c oxidase system by R. typhi. R. prowazekii, R. typhi, and R. conorii have 13, 24, and 560 unique genes, respectively, and share 775 genes, most likely their essential genes. The small genomes contain many pseudogenes and much noncoding DNA, reflecting the process of genome decay. R. typhi contains the largest number of pseudogenes (41), and R. conorii the fewest, in accordance with its larger number of genes and smaller proportion of noncoding DNA. Conversely, typhus rickettsiae contain fewer repetitive sequences. These genomes portray the key themes of rickettsial intracellular survival: lack of enzymes for sugar metabolism, lipid biosynthesis, nucleotide synthesis, and amino acid metabolism, suggesting that rickettsiae depend on the host for nutrition and building blocks; enzymes for the complete TCA cycle and several copies of ATP/ADP translocase genes, suggesting independent synthesis of ATP and acquisition of host ATP; and type IV secretion system. All rickettsiae share two outer membrane proteins (OmpB and Sca 4) and LPS biosynthesis machinery. RickA, unique to spotted fever rickettsiae, plays a role in induction of actin polymerization in R. conorii, but not in R. prowazekii or R. typhi. The genome of R. typhi contains four potentially membranolytic genes (tlyA, tlyC, pldA, and pat-1) and five autotransporter genes, sca 1, sca 2, sca 3, ompA, and ompB. The presence of six 50-amino acid repeat units in Sca 2 suggests function as an adhesin. The high laboratory passage of the sequenced strains raises the issue of the occurrence of laboratory mutations in genes not required for growth in cell culture or eggs. Resequencing revealed that eight annotated pseudogenes of E strain are actually intact genes. Comparative genomics of virulent and avirulent strains of rickettsial species may reveal their virulence factors.

Phylogenic Analysis of Rickettsial Patatin‐like Protein with Conserved Phospholipase A2 Active Sites

Genome analysis of Rickettsia felis highlighted the presence of three patatin-like protein (PLP) genes (pat1, pat2A, and pat2B), whereas only one PLP gene (pat1) is found in the other sequenced rickettsial genomes. Here, we aligned the rickettsial PLPs with characterized patatins from plants and found that they possess all the conserved amino acid residues identified as important for phospholipase A(2) activity. We also carried out a phylogenic analysis of the rickettsial PLPs together with bacterial and eukaryotic homologs. The phylogeny of the rickettsial Pat1 proteins is in conflict with the currently recognized Rickettsia phylogeny. Possible scenarios that might explain this incongruence are discussed and involve either gene conversion or gene duplication events.