Reverse Transcription-polymerase Chain Reaction Products Research Articles

Arctium lappa is a new Natural Host of Tomato Spotted Wilt Virus in Korea.

Burdock (Arctium lappa L., belongs to the family Asteraceae), is an edible plant and an oriental medicinal herb in Korea (Han and Koo, 1993). In July 2023, burdocks showing chlorotic ringspots and yellowing on the leaves were observed in nine of approximately 4,000 plants in a greenhouse in Daegu, South Korea. To determine the causal virus species, nine symptomatic leaves from each individual plant were collected and tested using commercially available immunostrips (Agdia, Elkhart, USA) for cucumber mosaic virus (CMV) and tomato spotted wilt virus (TSWV). Seven out of nine samples tested positive for TSWV only. TSWV in South Korea was first reported on sweet pepper from Yesan in 2004 (Kim et al., 2004) and has since spread to various crops. The first report of TSWV infecting burdock plants in the world was from Hawaii in 1995 (Bautista et al., 1995), but TSWV-infected burdock has not been reported in Korea. To further confirm the presence of TSWV, total RNA was extracted from TSWV-positive burdock leaves using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and used in reverse transcription-polymerase chain reaction (RT-PCR) assays with a specific primer set that amplifies 777 bp of nucleocapsid gene (N gene) of TSWV (Yoon et al., 2014). To obtain the complete genome sequence of this TSWV in the burdock plant, named TSWV-DG, fragments of L, M, and S segments were amplified and sequenced. The complete genome sequences of the L (8914 nt), M (4773 nt), and S (2946 nt) segments were obtained by overlapping RT-PCR amplicons. RT-PCR products were cloned into the pGEM-T Easy vector, and selected DNA clones were sequenced using Sanger method (Bioneer, Korea). The complete genome sequences were deposited to GenBank (LC790665, LC790666, and LC790667, respectively). BLASTn analysis showed that sequences of each TSWV-DG segment had maximum nucleotide identities of 99.5%, 99.5%, and 99.5% with TSWV-L, TSWV-M, and TSWV-S (OM154971, OM154970, and OM154969, respectively), which were isolated from water dropwort (Oenanthe crocata) in China (Qiu et al., 2023). To assess the biological activity of TSWV-DG, A. lappa and Nicotiana benthamiana were inoculated mechanically with sap from infected burdock leaves and maintained for visual inspection of virus symptoms at 25 ℃ at 3 weeks. TSWV-DG produced symptoms on the systemic leaves of A. lappa, that included chlorotic spots and yellowing, and on the leaves of N. benthamiana, that included chlorotic spots and mosaic patterns from 14 days-post-inoculation. Meanwhile, mock-inoculated A.lappa and N.benthamiana remained symptomless. The presence of TSWV on the inoculated leaves was subsequently confirmed through Immunostrip and RT-PCR analyses. TSWV may pose a significant threat to the production of A. lappa, which is cultivated as both leafy greens and root vegetables in Korea. Furthermore, A. lappa may not only be at risk of damage from TSWV infection but also act as a potential source of TSWV infection, thereby posing a risk of transmission to other key crops in Korea, such as pepper or potato (Yoon et al., 2014). This is the first report TSWV infecting burdock in South Korea.

Recent Advances in the Role of Different Nanoparticles in the Various Biosensors for the Detection of the Chikungunya Virus.

Humans contract the Chikungunya virus (CHIKV), an alphavirus transmitted by mosquitoes that induces acute and chronic musculoskeletal discomfort and fever. Millions of cases of the disease have been attributed to CHIKV in the Indian Ocean region since 2004, and the virus has since spread to Europe, the Middle East, and the Pacific. The exponential proliferation of CHIKV in recent times underscores the critical nature of implementing preventative measures and exploring potential control strategies. The principal laboratory test employed to diagnose infection in serum samples collected over six days after the onset of symptoms is the detection of CHIKV or viral RNA. Although two commercially available real-time reverse transcription-polymerase chain reaction products exist, data on their validity are limited. A diagnostic instrument that is rapid, sensitive, specific, and cost-effective is, therefore an absolute necessity, particularly in developing nations. Biosensors have demonstrated considerable potential in the realm of pathogen detection. The rapid and sensitive detection of viruses has been facilitated by the development of numerous types of biosensors, including affinity-based nano-biosensors, graphene affinity-based biosensors, optical nano-biosensors, surface Plasmon Resonance-based optical nano-biosensors, and electrochemical nano-biosensors. Furthermore, the utilization of nanomaterials for signal extension, including but not limited to gold and silver nanoparticles, quantum dots, and iron oxide NPs, has enhanced the precision and sensitivity of biosensors. The developed innovative diagnostic method is time-efficient, precise, and economical; it can be implemented as a point-of-care device. The technique may be implemented in diagnostic laboratories and hospitals to identify patients infected with CHIKV. Throughout this article, we have examined a multitude of CHIKV nano-biosensors and their respective properties. Following a discussion of representative nanotechnologies for biosensors, numerous NPs-assisted CHIKV nano-biosensors are summarized in this article. As a result, we anticipate that this review will furnish a significant foundation for advancing innovative CHIKV nano-biosensors.

First Report of Passiflora latent virus in Passion fruit (Passiflora edulis) in China.

Passion fruit (Passilora edulis, family Passifloraceae.) is an economically important fruit crop in many tropical and subtropical regions worldwide. It is widely planting in southern China, and in greenhouses throughout the country. In Mar 2022, symptoms of a viral-like infection were observed on the leaves of passion fruit plants in a 3-hectare greenhouse complex in Hohhot, China. Chlorotic lesions were observed on leaves of two vines of passion fruit and symptomatic leaves developed chlorotic spots, followed by systemic leaf chlorosis and necrosis. Dark ringed spots emerged on the surface of matured fruits (Figure 1). To confirm infectivity, mechanical transmission of the virus was performed by grinding leaves from two symptomatic passion fruit vines in 0.1M phosphate buffer pH 7, and the resulting two samples were each used to rub-inoculate carborundum-dusted leaves of three healthy passion fruit seedlings. Newly emerging leaves of inoculated plants developed mild mosaic symptoms 30-days after inoculation. Three samples from each of the two original symptomatic plants and two samples from each inoculated seedling tested positive using a Passiflora latent virus (PLV) ELISA Kit (Creative Diagnostics, USA). To further confirm the virus identity, total RNA from leaf samples from one of the original greenhouse symptomatic plants and one of the inoculated seedlings were extracted using an TaKaRa MiniBEST Viral RNA Extraction Kit (Takara, Japan). The two RNA samples were subjected to reverse transcription-polymerase chain reaction (RT-PCR) tests with virus specific primers PLV-F (5'-ACACAAAACTGCGTGTTGGA-3') and PLV-R (5'-CAAGACCCACCTACCTCAGTGTG-3') (Cho et al., 2020). RT-PCR products of the expected 571 bp were obtained from both the original greenhouse sample and inoculated seedling. Amplicons were cloned into the pGEM-T Easy Vector, and two clones per sample were Sanger sequenced bidirectionally (Sangon Biotech, China), and the sequence of one clone from one of the original symptomatic sample was uploaded to NCBI (GenBank OP320922.1). This accession had 98% nucleotide sequence identity with a PLV isolate from Korea (GenBank: LC556232.1). RNA extracts from two asymptomatic samples tested negative for PLV with both ELISA and RT-PCR tests. We also tested the original symptomatic sample for common occurring passion fruit viruses, including passion fruit woodiness virus (PWV), cucumber mosaic virus (CMV), east asian passiflora virus (EAPV), telosma mosaic virus (TeMV), papaya leaf curl Guangdong virus (PaLCuGdV), and the RT-PCR results were negative for those viruses. However, based on the systemic leaf chlorosis and necrosis symptoms, we cannot preclude a mixed infestation of other viruses. PLV affects fruit quality and has high potential to reduce market value. To our knowledge, this is the first report of PLV in China, which could provide a reference basis to PLV identification, prevention and control. Acknowledgments This research was carried out with the support of Inner Mongolia Normal University High-level Talents Scientific Research Startup Project (Grant no. 2020YJRC010). Supplementary material Figure 1. Mottle, leaf distortion, puckering symptoms on old leaf (A), mild puckering symptom on young leaf (B), and ring-striped spots symptoms on fruit (C) of the PLV infected passion fruit plant in China.

A Novel Pathogen of an Emerging Infectious Disease (Large Kidney Disease) in Farmed Blue Foxes

An emerging infectious disease (EID) in foxes called “large kidney disease”, characterized by enlarged kidneys, has been breaking out in fox farms in China, although its pathogenesis has not yet been elucidated. Here, we performed viral metagenomics sequencing on diseased fox tissue samples that identified a virus with 82.6% homology to the xenotropic murine leukemia virus-related virus (XMRV) PreXMRV-1 provirus strain (GenBank accession number NC_007815.2) in sick fox tissue. It was named PreXMRV-20, and its genome was verified by reverse transcription-polymerase chain reaction (PCR) and PCR product sequencing. Nonenveloped and polygonal virus-like particles consistent with the shape and size of XMRV were observed by negative staining electron microscopy. Administered subcutaneously, PreXMRV-20 infected weaned foxes, leading to growth retardation. The discovery of the PreXMRV-20 strain (the first isolation of an XMRV homolog in blue foxes) identifies a potential public health issue in blue fox breeding since XMRV has been confirmed to be a zoonotic virus.

Evidence of cassava common mosaic virus in cassava shoot apical meristems

The data that support the findings of this study are available from the corresponding author upon reasonable request. Figure S1 Effect of explant size on the regeneration of CsCMV-free plants. Each bar represents the mean ± SEM (n = 30). Different letters indicate statistically significant differences (one-way analysis of variance with Fisher’s LSD multiple comparison test, p ≤ 0.05). Figure S2 Electrophoresis of the reverse transcription-PCR products amplified with universal primers for Potexvirus, obtained from in vitro-generated cassava plants regenerated from explants of three sizes. (T1) shoot tip of 10 mm; (T2) shoot tip of 0.7 mm; (T3) shoot apical meristem of 0.2 mm; (C+) positive control; (C−) negative control; (CX) reaction control; (MWM) molecular weight marker 1 kb Plus DNA ladder. Figure S3 Electron micrographs of cassava plants infected with CsCMV. (a) Cells of the shoot tip (cross section) of cassava plants infected with CsCMV corresponding to T1. (b) and (c) Detail of CsCMV particles associated with the cell wall in T1. CW, cell wall; VA, vacuole; MI, mitochondrion; NU, nucleus; VP, viral particle. Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.

First Report of the Association of Zygocactus virus X with Dragon Fruit (Hylocereus spp.) plants from Telangana, India.

Dragon fruit (Hylocereus spp.) a member of the family Cactaceae, is widely cultivated throughout the world, includingspan style="font-family:'Times New Roman'; letter-spacing:0.05pt; color:#333333"> India. During 2020-2021 crop growing season, mosaic symptoms were observed on the cladodes of dragon fruit plants (Purple Pink cultivar: 1-2% disease incidence) grown at a farmer's field of Telangana, India (Fig. S1 a). The symptomatic cladodes (n= 4), observed under leaf-dip electron microscopy (Zuchmaan and Zellnig, 2009) at Indian Agricultural Research Institute, New Delhi, revealed the presence of flexuous rod- shaped virus-like particles (Fig S1 b). Virus particles were of 580 x 13 nm size, corresponding to the genus Potexvirus. For further confirmation, the total RNA isolated from symptomatic cladodes using a NucleoSpin RNA Plant Mini kit (Macherey-Nagel). Subsequently, a reverse transcription polymerase chain reaction (RT-PCR) was performed using the PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio). The cDNA was further amplified with the primers specific to coat protein (CP) gene of four different species of the genus Potexvirus known to infect members of Cactaceae family. Four sets of primers were used for detection, viz., Cactus virus X (CVX) (F, 5'-ATGTCTACTACTGGAGTCCA-3'; R, 5'-CTACTCAGGGCCTGGGAGAA-3'); Pitaya virus X (PiVX) (F, 5'-ATGGCTACTCAAACAGCACAA-3'; R, 5'-CTACTCTGGGGAGGGAAG-3'); Schlumbergera virus X (SchVX) (F, 5'-ATGTCGACCACTCCATCTTC-3'; R, 5'-TTATTCAGGGGATGGTAGTA-3') and Zygocactus virus X (ZyVX) (F, 5'-ATGTCTAACACTGCAGGAGT-3'; R, TCATTC GGGACCCGGTAGGA-3') (Duarte et al., 2008; Janssen et al., 2021; Parameswari et al., 2021), by following the PCR profile (Park et al., 2018). The species-specific primers of CVX, PiVX and SchVX did not amplify any amplicon, whereas the primers specific to ZyVX at nucleotide position 5841-6521 from complete CP gene have resulted in amplification of expected size (~680 base pairs) from all the samples. The gel-purified RT-PCR products were cloned into a pDrive cloning vector (Qiagen, Germany) and sequenced bi-directionally using Sanger sequencing. The resultant sequences (681 nt) of the CP gene showed 98% (nucleotide) and 100% (amino acid) sequence similarity with the CP gene sequence (Accession No: KY581590) of ZyVX. Hence, one representative sequence was deposited to the NCBI GenBank database as ZyVX-DPC isolate (Accession number- OK415019). The Neighbour Joining Phylogenetic Tree constructed using MEGA6 software (Tamura et al. 2013) showed grouping of Indian ZyVX-DPC isolate with the previously reported ZyVX isolates from Korea, Taiwan, China and Germany (Fig. S1c). These results confirmed the association of ZyVX with the symptomatic cladodes of dragon fruit plants collected from Telangana, India. Earlier studies revealed that ZyVX is a member of the genus Potexvirus known to infect dragon fruit plants from Brazil and China (Duarte et al., 2008). In India until now, anthracnose disease (Colletotrichum siamense) and CVX from Hylocereus spp. were reported (Abirami et al., 2019; Parameswari et al., 2021). To the best of our knowledge, this is the first report of ZyVX infection on dragon fruit in India. The draon fruit, being vegetatively propagated and with increasing cultivable area in India (Abirami et al, 2019), the present study gains significance. Further studies on mode of virus transmission, estimation of crop yield losses, host range studies and finding out source of resistance are essential.

First report of Cotton leafroll dwarf virus infecting cacao (Theobroma cacao L.) trees in Brazil.

Cotton leafroll dwarf virus (genus Polerovirus, family Solemoviridae) has been commonly reported affecting cotton plants (Gossypium spp., family Malvaceae) and several weed species (Ramos-Sobrinho et al., 2021; Sedhain et al., 2021). During a recent survey, cacao (Theobroma cacao L.) trees exhibiting virus-like symptoms such as leaf mosaic, vein clearing, and yellow spot were observed in the south part of the state of Bahia, northeastern Brazil, in 2022. Leaf samples were randomly collected from symptomatic cacao plants (n=30) growing in an affected area of approximately 30 ha. Total RNA obtained from pooled cacao samples were subjected to Illumina HiSeq 2500 sequencing as previously described (Keith et al., 2021), and partial sequences of cotton leafroll dwarf virus (CLRDV), and other virus-specific sequence contigs, were de novo assembled according to Ramos-Sobrinho et al. (2021). To further investigate the presence of CLRDV in cacao leaves, total RNA was individually extracted using a modified silica protocol (Rott and Jelkmann, 2001) and used as template for cDNA synthesis with random hexamers using the SuperScript™ IV First-Strand Synthesis System (Invitrogen, CA, USA) following the manufacturer´s protocol. Detection of CLRDV was carried out by reverse transcription-polymerase chain reaction (RT-PCR) with the primers PL4F and o3-R, which amplify the open reading frame 3 (ORF3) encoding the capsid protein (Corrêa et al., 2005). Expected size amplicons (~0.6 kb) were observed from 16 out of 30 symptomatic plants, indicating ~53% of the cacao trees were infected by CLRDV. Considering 14 symptomatic plants tested negative for CLRDV, the symptoms observed here could also be caused by other viral groups or abiotic stress. To confirm the detection of CLRDV, the first half (~3.5kb) of the viral genome was amplified from two representative cacao samples using the primers P20F and P22R (Avelar et al., 2020). The RT-PCR products were gel-purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, WI, USA) and Sanger sequenced. The RNA Illumina sequencing from pooled cacao samples (n=30) yielded 34,610,572 million trimmed reads. Two contigs of 868 and 839 nucleotides (nt) in length, and sharing high nt identity with CLRDV isolates, were assembled from 6,903 and 10,271 reads, at a coverage depth of 795 and 1,224x, respectively. Together, these contigs represent ~29% of the complete viral genome and included part of the 5´-untraslated region, ORF0 and the second half of ORF1-ORF2. Additional CLRDV-like contigs were observed across the viral genome, but they were not considered for further analyses due to the poor sequence quality. The Illumina- and Sanger-derived ORF0 and partial ORF1-ORF2 sequences shared >97% nt identity, suggesting they were congruent. Pairwise sequence comparisons for ORF0, encoding the gene silencing suppressor P0, indicated the cacao-associated isolates shared 99.7 and 99.2% nt and amino acid (aa) identity one with another, respectively. The ORF0 nt sequences showed 91.9-93.8 and 90.7-93.6% identity, while the aa sequences shared 85.8-88.5 and 86.2-90.0% similarity, with CLRDV isolates previously reported in South America and the USA, respectively. Finally, the ~3.5kb nt sequences of cacao-infecting CLRDV isolates shared 92.9-95.8% identity with CLRDV genomes deposited in NCBI-GenBank. The Bayesian phylogenetic tree reconstructed based on ORF0 nt sequences showed the new sequences were more closely related to CLRDV-atypical isolates (GenBank accession nos. KF359946, KF359947, KF906260, and KF906261). Together, these results suggest the new ORF0 sequences belong to CLRDV and were deposited in GenBank under accession nos. ON954058-ON954059. To our knowledge, this is the first report of CLRDV infecting cacao plants, expanding the range of malvaceous hosts of this polerovirus. CLRDV is largely known for causing yield losses in cotton crops, but additional studies are needed to determine if CLRDV infection is detrimental to cacao production.

Identification and functional characterization of a novel truncating splicing variant in COL4A5 gene causes X-linked Alport syndrome with astigmatism.

Identification and functional characterization of a novel truncating splicing variant in COL4A5 gene causes X-linked Alport syndrome with astigmatism.

Occurrence and Distribution of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia.

During the growing season of 2021-2022, a total of 145 symptomatic tomato leaf and fruit samples were collected from different locations in Riyadh Region, Saudi Arabia, showing a moderate-to-severe mosaic with dark green wrinkling, blistering, narrowing, and deformation with necrosis spot on tomato leaves, while irregular brown necrotic lesions, deformation, and yellowing spots rendering the fruits non-marketable were observed on tomato fruits. These samples were tested serologically against important tomato viruses using enzyme-linked immunosorbent assay (ELISA), and the obtained results showed that 52.4% of symptomatic tomato samples were found positive for Tomato brown rugose fruit virus (ToBRFV), wherein 12 out of 76 samples were singly infected; however, 64 out of 145 had mixed infection. A sample with a single infection of ToBRFV was used for mechanical inoculation into a range of different host plants; symptoms were observed weekly, and the presence of the ToBRFV was confirmed by ELISA and reverse transcription-polymerase chain reaction (RT-PCR). A total RNA was extracted from selected ELISA-positive samples, and RT-PCR was carried out using specific primers F-3666 and R-4718, which amplified a fragment of 1052 bp. RT-PCR products were sequenced in both directions, and partial genome nucleotide sequences were submitted to GenBank under the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities (99-99.5%) among them and 99-100% identity with ToBRFV isolates in different countries. A ToBRFV isolate (MZ130503) was selected for mechanical inoculation and to evaluate symptom severity responses of 13 commonly grown tomato cultivars in Saudi Arabia. All of the tomato cultivars showed a wide range of symptoms. The disease severity index of the tested cultivars ranged between 52% and 96%. The importance ToBRFV disease severity and its expanding host range due to its resistance breaking ability was discussed.

First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Novel compound heterozygous cadherin 3 mutations in hypotrichosis and juvenile macular dystrophy.

Novel compound heterozygous cadherin 3 mutations in hypotrichosis and juvenile macular dystrophy.

Analysis of direct-acting antiviral-resistant hepatitis C virus haplotype diversity by single-molecule and long-read sequencing.

The method of analyzing individual resistant hepatitis C virus (HCV) by a combination of haplotyping and resistance‐associated substitution (RAS) has not been fully elucidated because conventional sequencing has only yielded short and fragmented viral genomes. We performed haplotype analysis of HCV mutations in 12 asunaprevir/daclatasvir treatment‐failure cases using the Oxford Nanopore sequencer. This enabled single‐molecule long‐read sequencing using rolling circle amplification (RCA) for correction of the sequencing error. RCA of the circularized reverse‐transcription polymerase chain reaction products successfully produced DNA longer than 30 kilobase pairs (kb) containing multiple tandem repeats of a target 3 kb HCV genome. The long‐read sequencing of these RCA products could determine the original sequence of the target single molecule as the consensus nucleotide sequence of the tandem repeats and revealed the presence of multiple viral haplotypes with the combination of various mutations in each host. In addition to already known signature RASs, such as NS3‐D168 and NS5A‐L31/Y93, there were various RASs specific to a different haplotype after treatment failure. The distribution of viral haplotype changed over time; some haplotypes disappeared without acquiring resistant mutations, and other haplotypes, which were not observed before treatment, appeared after treatment. Conclusion: The combination of various mutations other than the known signature RAS was suggested to influence the kinetics of individual HCV quasispecies in the direct‐acting antiviral treatment. HCV haplotype dynamic analysis will provide novel information on the role of HCV diversity within the host, which will be useful for elucidating the pathological mechanism of HCV‐related diseases.

First Report of Tomato Brown Rugose Fruit Virus Infecting the Tomato Crop in Saudi Arabia.

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia

First Report of Clover Yellow Vein Virus on Orchid (Dendrobium sp.) in South Korea.

Orchid is one of the most popular and commercially important cultivated flowers in the world. Among many orchid species, Dendrobium species are popular cut flowers and potted plants in South Korea. In March 2019, 10 Dendrobium orchid plants in a greenhouse in Daegu, South Korea showed large chlorotic blotches, mosaic and mottle symptoms. One leaf each from the 10 symptomatic orchid plants by leaf dip-preparations and transmission electron microscopy (JEM-1400; JEOL Inc., Tokyo, Japan) after leaf dip-preparations (Brenner and Horne 1959; Richert-Pöggeler et al. 2019). Typical potyvirus-like particles of flexuous and filamentous shape and ∼ 760 × 15 nm length/width were observed in all tested samples. The presence of potyvirus was confirmed by serological detection with a commercially available ImmunoStrip® for potyvirus group (Agdia, Elkhart, USA). In contrast, a negative result was obtained for a virus-free Dendrobium plant by the serological test. The two most common viruses in orchids, namely odontoglossum ringspot virus (ORSV) and cymbidium mosaic virus (CymMV) in all Dendrobium samples were not detected in any samples by an ImmunoStrip® for ORSV and CymMV (Agdia, Elkhart, USA). To determine the species of the virus, total RNA was extracted from all 10 ImmunoStrip®-positive samples using the RNeasy plant mini kit (Qiagen, Hilden, Germany). Subsequently, reverse transcription-PCR (RT-PCR) products (~1,625 bp) were amplified using potyvirus- specific primer pair (Gibbs and Mackenzie, 1997) and sequenced by the Sanger method at Macrogen (Seoul, South Korea). Sequencing results showed 100% nucleotide identity among 10 samples. Thus, one sequence was chosen for identification of virus species using sequence comparison. BLASTn analysis showed that the nucleotide sequence and its deduced amino acid sequence of the amplicon shared 95.4-98.7% and 96.2-99.6% identity to multiple clover yellow vein virus (ClYVV) sequences (e.g., accession no. AB011819) in GenBank. To further confirm the presence of ClYVV and determine if other viral agents were present in the samples, total RNA from three of the 10 symptomatic plants was depleted of ribosomal RNAs and subjected to high-throughput sequencing (HTS) analysis on a HiSeq 4000 platform (Macrogen Inc., Seoul, South Korea). A total of 3,764,432, 4,203,881, and 4,139,775 of 150-bp paired-end clean reads were obtained for the three samples. After de novo assembly of the reads with Trinity (Haas et al. 2013), 5, 6 and 7 contigs were obtained and searched with BLASTn against NCBI viral refseq database. Eighteen contigs from all three samples sized at 2,176-9,432 nt exhibited 94.0-97.9% nucleotide identity with the complete genome sequences of other ClYVV isolates (e.g., accession no. AB011819) deposited in Genbank; no other viruses were identified by HTS. The complete genome sequence (9,585 nucleotides in length) of ClYVV Dendrobium isolate (ClYVV-Den) was determined using ClYVV-specific primers (Takahashi et al., 1997) and the sequence of CIYVV-Den was deposited to GenBank (Accession no. LC506604). Together, these results support that symptomatic Dendrobium orchids were infected with ClYVV-Den in this study. ClYVV has been previously reported affecting Calanthe orchids in Japan (Inouye et al., 1988; Ikegami et al., 1995). Our results suggest that ClYVV may be detrimental to the production of Dendrobium orchids or commercial ornamental crops in South Korea. To our knowledge, this is the first report of ClYVV in Dendrobium sp. in South Korea.

Rotavirus genotypes and clinical outcome of natural infection based on vaccination status in the post-vaccine era

ABSTRACT Rotavirus (RV) is a leading cause of gastroenteritis in children. In Japan, Rotarix (RV1; GlaxoSmithKline), which is a monovalent vaccine derived from human RV (G1P[8]), has been introduced since November 2011, and RotaTeq (RV5; MSD) which is an pentavalent, human-bovine mono-reassortant vaccine (G1, G2, G3, G4, and P1A[8]), has been introduced since July 2012. Long-term follow-up on vaccine efficacy and RV genotypical change should be carried out in order to control RV infection. The RV gastroenteritis (RVGE) outbreak occurred during the 2018/2019 season in Aichi prefecture, Japan. Therefore, the molecular epidemiology of RV among three different groups of RVGE, which were outpatients who received RV1, those who received RV5, and those without vaccination, was explored. Clinical features of RVGE patients were compared among the three patient groups. Children less than 15 years of age with gastroenteritis who visited any of seven pediatric practices between January and June 2019 were enrolled in the study. G, P, and E genotypes were determined by direct sequencing of reverse transcription–polymerase chain reaction products amplified from stool samples. Among 110 patients, there were 27, 28, and 55 in the RV1-vaccinated, RV5-vaccinated, and unvaccinated groups, respectively. The most frequent genotype was G8P[8] (92/110 patients, 83.6%). Genotype distributions did not significantly differ among the three patient groups (P = .125). Mean Vesikari score was significantly lower among RV1-vaccinated (7.1) and RV5-vaccinated patients (6.4) than among unvaccinated patients (10.2) (P < .001). Even in RVGE patients treated in an outpatient clinic, RV vaccine reduced the severity of the disease in this cohort.

Prevalence and genetic characterization of noroviruses in children with acute gastroenteritis in Senegal, 2007-2010.

Norovirus is the leading cause of sporadic and epidemic acute gastroenteritis (AGE) in children and adults around the world. We investigated the molecular diversity of noroviruses in a pediatric population in Senegal between 2007 and 2010 before therotavirus vaccine implementation. Stool samples were collected from 599 children under 5 years of age consulting for AGE in a hospital in Dakar. Specimens were screened for noroviruses using the Allplex™ GI-Virus Assay. Positive samples were genotyped after sequencing of conventional reverse transcription-polymerase chain reaction products. Noroviruses were detected in 79 (13.2%) of the children, with GII.4 (64%) and GII.6 (10%) as the most frequently identified genotypes. Our study describes the distribution of genotypes between 2007 and 2010 and should be a baseline for comparison with more contemporary studies. This could help decision-makers on possible choices of norovirus vaccines in the event of future introduction.

First report of Soybean dwarf virus infecting white clover (Trifolium repens) in Finland.

Soybean dwarf virus (SbDV, genus Luteovirus) is a single-stranded positive-sense RNA virus able to infect several legume species. SbDV was first reported in Japan where it was associated with significant yield losses in soybean (Tamada, 1969). Since then the virus has been detected worldwide. In Europe, the virus has only been reported from Germany (Abraham et al. 2007; Gaafar et al. 2020). In July 2018, several white clover plants (Trifolium repens L.) with leaf discoloration were observed in different locations in Oulu region in northern Finland. Individual plants were collected and analysed for the presence of viruses using small-RNA (sRNA) sequencing (Kreuze et. al. 2009) and reverse transcription-PCR (RT-PCR). Total RNA was extracted using EZNA micro RNA kit (Omega Bio-Tek, GA, USA). For sRNA analysis, sequencing libraries were constructed using the TruSeq small RNA library prep kit (Illumina, CA, USA) and sequenced on Illumina MiSeq platform. On average, 1.3 million single-end reads were obtained per sample, of which 27% were 18-25 nt long and used for the subsequent analysis. Contig assembly and virus identification with VirusDetect software (Zheng et al. 2017) detected SbDV in five out of six white clover samples analysed. Depending on the sample, 26-39 contigs (with lengths up to 301-469 nt) aligned to complete genome of a SbDV isolate previously described from white clover in USA (accession no. JN674402). The cumulative alignment coverage ranged from 35.5 % to 65.3 % with nucleotide identities between 94.4 % and 97.3 %. Additionally, two samples seemed to contain an unidentified closterovirus and one contained White clover cryptic virus 2. No additional viruses were detected from two of the samples.To confirm the presence of SbDV, the samples were tested by RT-PCR using primers MDF, MYF and MUR in multiplex (Schneider et al. 2011) together with SuperScript III One-Step RT-PCR System with the Platinum Taq DNA polymerase kit (Thermo Fisher Scientific, USA), essentially as instructed by the manufacturer. RT-PCR product of approximately 400 bp was produced from each of the five samples previously tested SbDV positive by sRNA analysis. No products were produced from the sample that was SbDV negative in sRNA analysis. Direct sequencing of two of the PCR products produced 347 and 361 bp sequences (GenBank: MZ355392 and MW929169) that were 95.7 % and 95.2 % identical, respectively, to a SbDV isolate (accession no. AB038148) that causes yellowing on soybean and is transmitted by Acyrthosiphon pisum (Terauchi et al. 2003). To our knowledge this is the first report of SbDV in Finland. SbDV is transmitted only by aphids (neither mechanical nor seed transmission occurs). In siRNA analysis all the isolates from Finland formed contigs that aligned almost perfectly (100 % coverage with ≥ 99 % nucleotide identity) to the coat protein (accession no. EF466131) of an SbDV isolate transmittable from white clover to faba bean by A. pisum (Abraham et al. 2007), an aphid common in Finland. Although significant yield losses by SbDV have only been reported on soybean (Tamada, 1969), the virus also causes symptoms in other legume crops, such as growth reduction on pea (Tian et al. 2017) and faba bean (Abraham et al. 2007), both of which are cultivated in Finland.

First report of dasheen mosaic virus infecting taro (Colocasia esculenta) in Louisiana.

Taro [Colocasia esculenta (L.) Schott], also called dasheen or malanga is an important staple crop in many tropical and subtropical countries (Chaïr et al. 2016). In October 2020, taro plants showing foliar symptoms consisting of mosaic, feathery mottle, and vein clearing patterns were observed in the Hilltop Arboretum, the Bluebonnet Swamp Nature Center, the Louisiana State University Agricultural Center Botanic Gardens, and the University Lake, in Baton Rouge, Louisiana. Unidentified aphids were also observed infesting the plants showing the described symptoms. From each location, two foliar samples from symptomatic and two from asymptomatic plants were collected and tested by ELISA using antiserum for general potyvirus group (Agdia, Elkhart, IN). Seven of eight symptomatic samples tested positive while the asymptomatic samples were negative. The seven positive samples were used to perform an additional ELISA test using antiserum specific for dasheen mosaic virus (DsMV) (Agdia). All seven samples tested positive for DsMV. To confirm the identity of the virus, total RNA was extracted from the seven samples using the PureLink® Plant RNA Reagent Kit (Invitrogen, Carlsbad, CA). After DNA digestion with PerfeCta® DNase I (Qiagen, Beverly, MA), the RNA was used to perform reverse transcription polymerase chain reaction (RT-PCR) with primer set DMV 5708-5731-F/DMV 6131-6154-R which is specific for DsMV (Wang et al. 2017). RT-PCR was performed using the AccessQuickTM RT-PCR System (Promega, Madison, WI) following the reaction conditions described by Wang et al. PCR products of the expected size (~447 bp) were obtained with all seven samples and were Sanger-sequenced. A consensus sequence (MW284936) was obtained with the two sequences from samples collected at the University Lake and aligned with other sequences available in the GenBank using BLASTn. Our isolate of DsMV showed 90.6% nt identity to an isolate of DsMV from Ethiopia (MG602229). Mechanical inoculations to healthy taro plants were conducted using leaf tissue of symptomatic plants as source of inoculum. Inoculated plants exhibited mosaic symptoms three weeks after inoculation and were ELISA-positive for DsMV. Symptomatology, serological tests, RT-PCR testing, and DNA sequencing of RT-PCR products support that the symptomatic taro plants were infected with DsMV. Taro is a crop in Hawaii, but in the contiguous United States, it is mostly grown as an ornamental and is considered an invasive species. Its distribution is restricted to the southern continental states and Hawaii (Cozad et al. 2018). CABI, EPPO (1998) lists the presence of DsMV in several states of the United States, including Louisiana; however, there is no record in the literature of the identification of this virus in Louisiana. The potential impact of DsMV in taro and related ornamental species in southern United States is unknown. To the best of our knowledge, this is the first report documenting DsMV infecting taro in Louisiana.

Epidemiology and molecular characterization of re-emerged virulent strains of Peste des Petits Ruminants virus among sheep in Kassala State, Eastern Sudan

BackgroundPeste des Petits Ruminants (PPR) is a severe contagious viral disease, which mainly affects small ruminants. PPR is caused by a Morbillivirus that belongs to the family Paramyxoviridae. In this study 12 suspected PPR outbreaks among sheep and goats were investigated in four localities in Kassala State, Eastern Sudan, during 2015—2017. The causative agent was confirmed by a Sandwich Enzyme-Linked Immunosorbent Assay (sELISA), and a Reverse Transcription Polymerase Chain Reaction (RT-PCR) targeting a partial sequence of nucleocapsid protein gene (N- gene) and a partial sequence of fusion protein gene (F- gene). Sequencing and phylogenetic analysis were carried out on six N- gene based RT-PCR products selected from two outbreaks occurred on border and inner localities of Kassala State to determine the circulating lineages of PPRV strains. Identity percentages were determined between isolates in this study and previous Sudanese, and other (African and Asian) isolates which clustered along with them.ResultsOut of 30 samples, 22 (73.3%) were positive using sandwich ELISA. From 22 s ELISA positive samples, 17 (77.3%) were positive by Ngene based RT-PCR and only 7(43.8%) out of 16 positive samples by N gene based RT-PCR were positive using Fgene based RT-PCR. The sequencing and phylogenetic analysis confirmed involvement of the lineage IV of PPRV in outbreaks among small ruminants in Kassala State and high identity percentage between our isolates and previous Sudanese and other (African and Asian) isolates.ConclusionsThe present study demonstrates that genetic relationship between PPRV strains circulating in sheep in Kassala State, Eastern Sudan, and PPRV strains characterized as lineage IV in neighboring African countries such as Eretria,Ethiopia, Egypt, and other Asian countries

Cytological, Histological and Molecular Characterization of Two Isolates of Cucumber Mosaic Virus (CMV) in Egypt

Two isolates of Cucumber mosaic virus (CMV), CMV-wild tobacco (from Alexandria governorate) and CMV-cucumber (from Kafr El-Sheikh governorate) were investigated in this study. Cytological studies on epidermal strips of Nicotiana glutinosa leaves separately infected with each isolate revealed the presence of viral crystalline inclusion bodies within the infected cells. Electron microscopy of ultrathin sections of CMV infected N. glutinosa leaves showed significant alterations in the shape and internal structure of chloroplasts. The cell wall had serrated edges in infected cells but was more severe in cells infected with CMV-wild tobacco isolate compared to those infected with CMV-cucumber isolate. CMV-cucumber isolate was partially purified from systemically infected leaves of N. glutinosa. The ratio A260/ 280 was 1.0 and the concentration of the virus in the preparation was estimated using an extinction coefficient of E260nm0.1%, 1cm = 5. Yield of purified virus was about 2.8 mg/100 g fresh weight of infected N. glutinosa leaves. Electron microscopy of the purified preparation of CMV showed the presence of numerous spherical particles with a mean particle diameter of 28 nm. Amplified real-time reverse transcription-polymerase chain reaction (qRT-PCR) product of coat protein gene of each isolate was purified and sequenced. Sequences of both isolates had been submitted to GenBank Database and ware assigned accession number (LT669766) for CMV-cucumber isolate and (LT706517) for CMV-wild tobacco isolate. The sequences were edited using Chromas Pro. Version 1.34 software and compared with previously subgrouping of 27 isolates of the virus retrieved from the GenBank database. Both CMV-wild tobacco and CMV-cucumber isolates were closely related to the isolate with the accession number AJ585086 with a similarity of 97.07% and 98.54%, respectively, suggesting that the two isolates belong to subgroup II. According to the available literature, this is the first report in Egypt where CMV isolates belonging to subgroup II have been obtained