Reverse Transcription Loop-mediated Isothermal Amplification Research Articles

Development of reverse transcription loop-mediated isothermal amplification (RT-LAMP) for rapid detection of viruses infecting patchouli (Pogostemon cablin).

Patchouli (Pogostemon cablin), a highly valued medicinal plant, suffers significant economic losses following infection with Broad bean wilt virus 2 (BBWV-2) and Peanut stripe virus (PStV). In this study, a field-based isothermal technique called reverse transcription loop-mediated isothermal amplification (RT-LAMP) was established for an early and specific detection of BBWV-2 and PStV. The oligo primers were designed to target the coat protein genes of PStV and BBWV-2. The reaction conditions, such as temperature and time duration, were optimized to 65°C for 60min. The LAMP amplicons positive for PStV and BBWV-2 revealed characteristic ladder-type bands following agarose gel electrophoresis. Further, a colorimetric assay using a metal ion-based indicator (Hydroxy-naphthol blue, HNB) was conducted to visualize the amplified products with the naked eye, thus facilitating accessibility to field practices. The assay developed in this study was found to be virus specific, and was 100 times more sensitive than RT-PCR. Thus, the RT-LAMP assay established in this study is quick, reliable, and cost-effective for the accurate identification of BBWV-2 and PStV. It will facilitate the screening of patchouli planting materials. Further, it may reduce the risk of virus spread and could be helpful in phytosanitary programs.

A high throughput immuno-affinity mass spectrometry method for detection and quantitation of SARS-CoV-2 nucleoprotein in human saliva and its comparison with RT-PCR, RT-LAMP, and lateral flow rapid antigen test.

Many reverse transcription polymerase chain reaction (RT-PCR) methods exist that can detect SARS-CoV-2 RNA in different matrices. RT-PCR is highly sensitive, although viral RNA may be detected long after active infection has taken place. SARS-CoV-2 proteins have shorter detection windows hence their detection might be more meaningful. Given salivary droplets represent a main source of transmission, we explored the detection of viral RNA and protein using four different detection platforms including SISCAPA peptide immunoaffinity liquid chromatography-mass spectrometry (SISCAPA-LC-MS) using polyclonal capture antibodies. The SISCAPA-LC MS method was compared to RT-PCR, RT-loop-mediated isothermal amplification (RT-LAMP), and a lateral flow rapid antigen test (RAT) for the detection of virus material in the drool saliva of 102 patients hospitalised after infection with SARS-CoV-2. Cycle thresholds (Ct) of RT-PCR (E gene) were compared to RT-LAMP time-to-positive (TTP) (NE and Orf1a genes), RAT optical densitometry measurements (test line/control line ratio) and to SISCAPA-LC-MS for measurements of viral protein. SISCAPA-LC-MS showed low sensitivity (37.7 %) but high specificity (89.8 %). RAT showed lower sensitivity (24.5 %) and high specificity (100 %). RT-LAMP had high sensitivity (83.0 %) and specificity (100.0 %). At high initial viral RNA loads (<20 Ct), results obtained using SISCAPA-LC-MS correlated with RT-PCR (R2 0.57, p-value 0.002). Detection of SARS-CoV-2 nucleoprotein in saliva was less frequent than the detection of viral RNA. The SISCAPA-LC-MS method allowed processing of multiple samples in <150 min and was scalable, enabling high throughput.

Ultrasensitive and fast detection of SARS-CoV-2 using RT-LAMP without pH-dependent dye.

This study investigates the performance of reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the colorimetric detection of SARS-CoV-2 using fluorometric dye, namely, calcein. The detection limit (LoD) with the N-ID1 primer set resulted in superior performance, corresponding to ~ 2 copies/reaction or ~ 0.1 copies/μL of the RNA sample. The color development can be observed by the naked eye, using an ultraviolet (UV) transilluminator or a hand-UV light without the requirement of expensive devices. The average time-to-reaction (TTR) value was 26.2 min in high-copy number samples, while it was about 50 min in rRT-PCR. A mobile application was proposed to quantify the positive and negative results based on the three-color spaces (RGB, Lab, and HSB). Compared to rRT-PCR (n = 67), this assay allows fast and sensitive visual detection of SARS-CoV-2, with high sensitivity (90.9%), selectivity (100%), and accuracy (94.03%). Besides, the assay was sensitive regardless of variants. Since this assay uses a fluorescent dye for visual observation, it can be easily adapted in RT-LAMP assays with high sensitivity. Thus, it can be utilized in low-source centers and field testing such as conferences, sports meetings, refugee camps, companies, and schools.

A Sequencing-Based Phylogenetic Analysis of Various Strains of Watermelon Silver Mottle Virus in Northern China and Their One-Step Detection Using Reverse Transcription Loop-Mediated Isothermal Amplification.

Watermelon silver mottle virus (WSMoV), a potentially invasive virus, is known to reduce the yield and degrade the quality of infected crops in Cucurbitaceae and Solanaceae families, resulting in significant economic losses in limited areas of several Asian countries. WSMoV, previously detected on various crops in southern China, has now become more prevalent on watermelon and sweet pepper in the northern cities of China for the first time. A sequencing-based phylogenetic analysis has confirmed that the viral strains infecting cucumber, watermelon, and sweet pepper plants in Shandong Province are most closely related to those isolated from Guangdong, Guangxi, and Taiwan, suggesting a farther and continuous spread of WSMoV throughout China. To develop a fast, accurate, and practical protocol for WSMoV detection, we designed a set of primers from the conserved sequence of the WSMoV nucleocapsid protein (N) gene for a one-step assay based on reverse transcription loop-mediated isothermal amplification (RT-LAMP). The RT-LAMP assay was performed successfully for 50 min at 61°C and exhibited a highly specific result without cross-reactions with other similar viruses and a sensitivity that is 100-fold higher than that of the traditional RT-PCR. The confirmation of 26 WSMoV suspect samples collected from various regions in Shandong through the RT-LAMP testing has demonstrated that the assay is suitable and practical for detection of WSMoV in both laboratory and field settings.

Development and clinical application of loop-mediated isothermal amplification combined with lateral flow assay for rapid diagnosis of SARS-CoV-2

BackgroundThe diagnostic assay leveraging multiple reverse transcription loop-mediated isothermal amplification (RT-LAMP) could meet the requirements for rapid nucleic acid detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).MethodsThe devised assay merged the lateral flow assay with the RT-LAMP technology and designed specific primers for the simultaneous detection of the target and human-derived internal reference genes within a single reaction. An inquiry into the assay's limit of detection (LOD), sensitivity, and specificity was carried out. The effectiveness of this assay was validated using 498 clinical specimens.ResultsThis LOD of the assay was determined to be 500 copies/mL, and there was no observed cross-reaction with other respiratory pathogens. The detection results derived from clinical specimens showed substantial concordance with those from real-time reverse transcription-polymerase chain reaction (RT-qPCR) (Cohen's kappa, 0.876; 95% CI: 0.833-0.919; p<0.005). The diagnostic sensitivity and specificity were 87.1% and 100%, respectively.ConclusionThe RT-LAMP assay, paired with a straightforward and disposable lateral immunochromatographic strip, achieves visual detection of dual targets for SARS-CoV-2 immediatly. Moreover, the entire procedure abstains from nucleic acids extraction. The samples are lysed at room temperature and subsequently proceed directly to the RT-LAMP reaction, which can be executed within 30 minutes at a constant temperature of 60-65°C. Then, the RT-LAMP amplification products are visualized using colloidal gold test strips.Trial registrationThis study was registered at the Chinese Clinical Trial Registry (Registration number: ChiCTR2200060495, Date of registration 2022-06-03).

Comparison of dye-based and probe-based RT-LAMP in detection of canine astrovirus.

A rapid and sensitive assay is essential for reliable surveillance and diagnosis of canine astrovirus (CaAstV). In this study, two real-time reverse transcription loop-mediated isothermal amplification (RT-LAMP) assays with high sensitivity, rapidity, and reliability were developed using fluorescence dye and FRET-based assimilating probes for real-time detection of CaAstV. These assays specifically amplified the ORF2 gene of CaAstV and did not amplify any sequences from canine enterovirus. The limit of detection (LOD) of both the probe-based and dye-based RT-LAMPs was 100 copies/μL. Fluorescence signals were generated within 30 min for the lowest concentration of a standard RNA sample, which was significantly faster than that achieved by real-time fluorescence quantitative PCR (qRT-PCR) assay. When clinical samples were tested, the positive and negative agreement of the dye-based RT-LAMP assay with qRT-PCR was 87.5% (14/16) and 93.55% (29/31), respectively. The positive and negative agreement of the probe-based RT-LAMP assay with qRT-PCR was 94.11% (16/17) and 96.55% (28/29), respectively. The RT-LAMP assays developed in this study showed strong potential for use as an on-site diagnostic assay for rapid, specific, and reliable detection of CaAstV in clinical samples.

Distribution of Wheat-Infecting Viruses and Genetic Variability of Wheat Streak Mosaic Virus and Barley Stripe Mosaic Virus in Kazakhstan.

Wheat is an essential cereal crop for the economy and food safety of Kazakhstan. In the present work, a screening of wheat and barley from different regions of Kazakhstan was conducted using newly developed specific primers for reverse transcription PCR and loop-mediated isothermal amplification (LAMP) assays. In total, 82 and 19 of 256 samples of wheat and barley tested positive for wheat streak mosaic virus (WSMV) and barley stripe mosaic virus (BSMV), respectively. A phylogenetic analysis using two independent methods revealed that most of the analyzed isolates had a European origin. Molecular data on the distribution and diversity of cereal viruses in Kazakhstan were obtained for the first time and will help lay a foundation for the implementation of genetics and genomics in wheat phyto-epidemiology in the country.

A reverse transcription loop-mediated isothermal amplification assay for quick detection of tomato mosaic virus.

Tomato mosaic virus (ToMV), an economically important virus that affects a wide range of crops, is highly contagious, and its transmission is mediated by mechanical means, and through contaminated seeds or planting materials, making its management challenging. To contain its wide distribution, early and accurate detection of infection is required. A survey was conducted between January and May, 2023 in major tomato growing counties in Kenya, namely, Baringo, Kajiado, Kirinyaga and Laikipia, to establish ToMV disease incidence and to collect samples for optimization of the reverse transcription loop-mediated isothermal amplification assay (RT-LAMP) assay. A RT-LAMP assay, utilizing primers targeting the coat protein, was developed and evaluated for its performance. The method was able to detect ToMV in tomato samples within 4:45 minutes, had a 1,000-fold higher sensitivity than conventional reverse transcription polymerase chain reaction (RT-PCR) method and was specific to ToMV. Furthermore, the practical applicability of the assay was assessed using tomato samples and other solanaecous plants. The assay was able to detect the virus in 14 tomato leaf samples collected from the field, compared to 11 samples detected by RT-PCR, further supporting the greater sensitivity of the assay. To make the assay more amenable for on-site ToMV detection, a quick-extraction method based on alkaline polyethylene glycol buffer was evaluated, which permitted the direct detection of the target virus from crude leaf extracts. Due to its high sensitivity, specificity and rapidity, the RT-LAMP method could be valuable for field surveys and quarantine inspections towards a robust management of ToMV infections.

The Performance of Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) Virus Using the Colorimetric Reverse-Transcription Loop Mediated Isothermal Amplification (RT-LAMP) Method in Saliva Specimens of Suspected COVID-19 Patients.

Corona Virus Disease-19 (COVID-19) is a disease caused by Severe-Acute-Respiratory-Syndrome-Coronavirus-2 (SARS-CoV-2). The most reliable and widely accepted method for diagnosing this infection, despite facing various challenges, is the Reverse Transcription Polymerase Chain Reaction (RT-PCR) method, which utilizes nasopharyngeal swab sample. Reverse-transcription loop mediated isothermal amplification (RT-LAMP) is a simpler nucleic acid amplification method compared to the RT-PCR method. This method has several advantages, including: of amplification at constant temperature, faster results, and potentially greater examination capacity. This study aimed to compare the validity of the RT-LAMP method using saliva specimens with that of the RT-PCR method using nasopharyngeal smears. This was an analytical observational study with a cross-sectional design. The participants were inpatients in the COVID-19 special isolation building of Hasan Sadikin General Hospital, Indonesia with a probable (clinical symptoms of covid, but not confirm NAAT examination) or confirmed diagnosis of COVID-19 from September 2021 to February 2022. The inclusion criteria are COVID-19 patients with symptoms, adult subjects, and composite mentions. Patients who were unable to secrete saliva were also excluded. In total, 118 specimens were collected. The validity test results of the saliva specimens using the RT-LAMP method showed sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV), of 65.5%, 100%, 100%, and 75%, respectively. The results increased in subjects treated between 3 and 7 days after symptom onset ie 73.2%, 100%, 100%, and 82.3%, respectively. The very strong specificity accompanied by good sensitivity and NPV in the group of subjects treated 3-7 days after the onset of symptoms indicates that the RT-LAMP method using saliva specimens can be an efficient and reliable alternative tool in detecting the SARS-CoV-2 virus.

UbiNAAT: a multiplexed point-of-care nucleic acid diagnostic platform for rapid at-home pathogen detection.

The COVID-19 pandemic increased demands for respiratory disease testing to facilitate treatment and limit transmission, demonstrating in the process that most existing test options were too complex and expensive to perform in point-of-care or home scenarios. Lab-based molecular techniques can detect viral RNA in respiratory illnesses but are expensive and require trained personnel, while affordable antigen-based home tests lack sensitivity for early detection in newly infected or asymptomatic individuals. The few home RNA detection tests deployed were prohibitively expensive. Here, we demonstrate a point-of-care, paper-based rapid analysis device that simultaneously detects multiple viral RNAs; it is demonstrated on two common respiratory viruses (COVID-19 and influenza A) spiked onto a commercial nasal swab. The automated device requires no sample preparation by the user after insertion of the swab, minimizing user operation steps. We incorporated lyophilized amplification reagents immobilized in a porous matrix, a novel thermally actuated valve for multiplexed fluidic control, a printed circuit board that performs on-device lysis and amplification within a cell-phone-sized disposable device. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) products are visualized via fluorescent dyes using a modified cell phone, resulting in detection of as few as 104 viral copies per swab across both pathogens within 30 minutes. This integrated platform could be commercialized in a form that would be inexpensive, portable, and sensitive; it can readily be multiplexed to detect as many as 8 different RNA or DNA sequences, and adapted to any desired RNA or DNA detection assays.

Development of a self-powered digital LAMP microfluidic chip (SP-dChip) for the detection of emerging viruses.

Point-of-care (POC) diagnostics have emerged as a crucial technology for emerging pathogen detections to enable rapid and on-site detection of infectious diseases. However, current POC devices often suffer from limited sensitivity with poor reliability to provide quantitative readouts. In this paper, we present a self-powered digital loop-mediated isothermal amplification (dLAMP) microfluidic chip (SP-dChip) for the rapid and quantitative detection of nucleic acids. The SP-dChip utilizes a vacuum lung design to passively digitize samples into individual nanoliter wells for high-throughput analysis. The superior digitization scheme is further combined with reverse transcription loop-mediated isothermal amplification (RT-LAMP) to demonstrate dLAMP detection of Zika virus (ZIKV). Firstly, the LAMP assay is loaded into the chip and passively digitized into individual wells. Mineral oil is then pipetted through the chip to differentiate each well as an individual reactor. The chip did not require any external pumping or power input for rapid and reliable results to detect ZIKA RNA as low as 100 copies per μL within one hour. As such, this SP-dChip offers a new class of solutions for truly affordable, portable, and quantitative POC detections for emerging viruses.

Point-of-care testing for COVID-19: a simple two-step molecular diagnostic development and validation during the SARS-CoV-2 pandemic.

During the coronavirus disease 19 (COVID-19) pandemic, diagnostic testing of the general population proved challenging due to limitations of the gold-standard diagnostic procedure using reverse transcription real-time polymerase chain reaction (RT-qPCR) for large-scale testing on the centralised model, especially in low-resource areas. To address this, a point-of-care (PoC) diagnostic protocol for COVID-19 was developed, providing fast, reliable, and affordable testing, particularly for low-mid develop areas. The PoC diagnostic process combines a simple paper-based RNA extraction method housed within a 3D-printed plastic device with a colorimetric reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay. Nasopharyngeal/oropharyngeal swabs (NOS) and saliva samples were tested between 2020 and 2021, with the assistance of Santa Catarina's State Health Secretary, Brazil. The developed diagnostic protocol showed a limit of detection of 9,900 copies and an overall diagnostic specificity of 98% for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) from 1,348 clinical analysed samples. The diagnostic sensitivity was 95% for NOS samples, 85% for early morning saliva, and 69% for indiscriminate saliva. In conclusion, the developed device successfully extracted SARS-CoV-2 viral RNA from swabs and saliva clinical samples. When combined with colorimetric RT-LAMP, it provides results within 45 min using minimal resources, thus delivering a diagnostic kit protocol that is applicable in large-scale sampling.

ElectrochemCap: an integrated detection for loop-mediated isothermal amplification reactions.

Loop-mediated isothermal amplification (LAMP) of genetic materials has emerged as a powerful molecular biology technique with great potential to be a standard point-of-care (POC) technique. This method has found several applications, but it still presents challenges for its direct on-site application, particularly in terms of integrated reaction and detection systems and the risk of carryover contamination. In this work, we propose an innovative solution - an electrochemical microcentrifuge tube cap (ElectrochemCap) based on a screen-printed electrode, a 3D printed adapter and an adhesive layer - which integrates the amplification reaction and its subsequent electrochemical detection in a single device. The design, fabrication, and electrochemical characterization of the ElectrochemCap are reported here, demonstrating its suitability for LAMP detection. Rapidly emerging technologies, such as 3D printing or xurography, are the basis of a prototype that has been validated for the detection of SARS-CoV-2 using reverse transcription LAMP (RT-LAMP), achieving results comparable to those obtained by gold-standard RT-qPCR. Moreover, we have explored the versatility of the ElectrochemCap presenting several additional designs (for containers with different volumes, shapes and materials, as well as multiplexed approaches), expanding its potential applications. Overall, the ElectrochemCap represents an affordable, versatile, and marketable innovation for integrated quantitative electrochemical detection, with enormous possibilities in bioelectroanalytical procedures and portable laboratory setups.

CRISPR/Cas12a coupled with loop-mediated isothermal amplification and lateral flow assay for SARS-CoV-2 detection.

Point-of-care testing (POCT) is rapid, exhibits highly sensitive performance, can facilitate home self-testing and avoids cross-contamination. Herein, we developed a biosensor that combines Si-OH magnetic bead (MB)-based fast RNA extraction, reverse transcription-loop-mediated isothermal amplification (RT-LAMP), CRISPR-Cas12a, and lateral flow assay (LFA) for rapid detection of SARS-CoV-2 RNA within 1.5 h. In the presence of the SARS-CoV-2 LAMP amplicon, the trans-cleavage activity of Cas12a was activated to cleave the probe, separating streptavidin from the AuNPs-digoxin (Dig) antibody, resulting in the inability of the test line to capture the AuNPs-Dig antibody. The method can distinguish SARS-CoV-2 from other RNA viruses, with a limit-of-detection (LOD) of 6.2 × 102 copies per mL. Therefore, LAMP-CRISPR-LFA has high specificity and sensitivity and is convenient to develop into commercial assay kits, which could have a broad prospect for practical application.

Development of a self-contained microfluidic chip and an internet-of-things-based point-of-care device for automated identification of respiratory viruses.

The COVID-19 pandemic greatly impacted the in vitro diagnostic market, leading to the development of new technologies such as point-of-care testing (POCT), multiplex testing, and digital health platforms. In this study, we present a self-contained microfluidic chip integrated with an internet-of-things (IoT)-based point-of-care (POC) device for rapid and sensitive diagnosis of respiratory viruses. Our platform enables sample-to-answer diagnostics within 70 min by automating RNA extraction, reverse transcription-loop-mediated isothermal amplification (RT-LAMP), and fluorescence detection. The microfluidic chip is designed to store all the necessary reagents for the entire diagnostic assay, including a lysis buffer, a washing buffer, an elution buffer, and a lyophilized RT-LAMP cocktail. It can perform nucleic acid extraction, aliquoting, and gene amplification in multiple reaction chambers without cross-contamination. The IoT-based POC device consists of a Raspberry Pi 4 for device control and data processing, a CMOS sensor for measuring fluorescence signals, a resistive heater panel for temperature control, and solenoid valves for controlling the movement of on-chip reagent solutions. The proposed device is portable and features a touchscreen for user control and result display. We evaluated the performance of the platform using 11 clinical respiratory virus samples, including 5 SARS-CoV-2 samples, 2 influenza A samples, and 4 influenza B samples. All tested clinical samples were accurately identified with high specificity and fidelity, demonstrating the ability to simultaneously detect multiple respiratory viruses. The combination of the integrated microfluidic chip with the POC device offers a simple, cost-effective, and scalable solution for rapid molecular diagnosis of respiratory viruses in resource-limited settings.

Development and evaluation of an easy to use real-time reverse-transcription loop-mediated isothermal amplification assay for clinical diagnosis of West Nile virus

West Nile Virus (WNV) causes a serious public health concern in many countries around the world. Virus detection in pathological samples is a key component of WNV infection diagnostic, classically performed by real-time PCR. In outbreak situation, rapid detection of the virus, in peripheral laboratories or at point of care, is crucial to guide decision makers and for the establishment of adequate action plans to prevent virus dissemination. Here, we evaluate a Loop-mediated isothermal amplification (LAMP) tool for WNV detection. Amplifications were performed comparatively on extracted viral RNA and on crude samples using a classical thermal cycler and a portable device (pebble device). qRT-PCR was used as gold standard and two sets of urine samples (n = 62 and n = 74) were used to evaluate the retained amplification protocols and assess their sensitivity and specificity. RT-LAMP on RNA extracts and crude samples showed a sensitivity of 90 % and 87 %, respectively. The specificity was 100 % for extracts and 97 % for crude samples. Using the device, the RT-LAMP on extracted RNA was comparable to the gold standard results (100 % sensitivity and specificity) and it was a bit lower on crude samples (65 % sensitivity and 94 % specificity). These results show that RT-LAMP is an efficient technique to detect WNV. RT-LAMP provides a rapid, sensitive, high-throughput and portable tool for accurate WNV detection and has potentials to facilitate diagnostic and surveillance efforts both in the laboratory and in the field, especially in developing countries.

Reverse transcription loop-mediated isothermal amplification (RT-LAMP) primer design based on Indonesia SARS-CoV-2 RNA sequence

BackgroundThe COVID-19 pandemic has highlighted the importance of tracking cases by using various methods such as the Reverse transcription loop-mediated isothermal amplification (RT-LAMP) which is a fast, simple, inexpensive, and accurate mass tracker. However, there have been no reports about the development of RT-LAMP primer designs that use genome sequences of viruses from Indonesia. Therefore, this study aimed to design an RT-LAMP primer using SARS-CoV-2 genome sequences from Indonesia and several other countries representing five continents in the world, as well as genomes from five Variants of Concern (VOC). ResultThe results showed that the consensus sequence of 70 SARS-CoV-2 virus sequences was obtained with a length of 29,982 bases. The phylogenetic test confirmed that the consensus sequence had a close kinship with the SARS-CoV-2 Wuhan Isolate. Furthermore, the SimPlot analysis showed that there was a high genetic diversity of sequences from the Coronaviridae tribal virus at base sequences of 1,500–5,000, 6,500–7,500, and 23,300–25,500. A total of 139 sets of primers were obtained from the primer design with 4 sets namely T1_6, T1_9, T4_7, and T4_52 having the best characteristics. Based on the secondary structure analysis test on 4 sets of primers, T1_6 and T1_9 were predicted not to form secondary structures at RT-LAMP operational temperatures. The primer set T1_9 showed better specificity in BLAST NCBI and eLAMP BLAST tests. ConclusionThis study obtained a primer set of T1_9 with base sequence F3: CACTGAGACTCATTGATGCTATG, B3: CCAACCGTCTCTAAGAAACTCT, F2: GTTCACATCTGATTTGGCTACT, F1c: GAAGTCAACTGAACAACACCACCT, B2: CCTTCCTTAAACTTCTCTTCAAGC, B1c: GTGGCTAACTAACATCTTTGGCACT, LB: TGAAAACAAACCCGCCGTCCTTG, which meets the ideal parameters and has the best specificity. Therefore, it is recommended for use in further tests to recognize SARS-CoV-2 from Indonesia, other five continents, as well as five VOCs, including the new Omicron sub-variant.

Evaluation of reverse transcription loop-mediated isothermal amplification assay for the detection of severe fever with thrombocytopenia syndrome in clinical laboratories: A single-center study.

Severe fever with thrombocytopenia syndrome (SFTS) is an acute infectious disease prevalent in East Asia with a high mortality rate (5%-30%). Reverse transcription loop-mediated isothermal amplification (RT-LAMP), a rapid nucleic acid-based diagnostic technique, is a useful alternative for the clinical diagnosis of SFTS, particularly in resource-limited hospitals or rural clinics in SFTS virus-endemic regions. However, the actual clinical sensitivity and specificity of RT-LAMP remain unclear. This study evaluated the field application of RT-LAMP.This prospective field study included 130 patients with laboratory-confirmed SFTS from Yantai, Shandong Province, China. Two sets of RT-LAMP primers were validated, and one set of RT-LAMP assays was optimized for field detection. Nucleic acids of serially collected serum/plasma samples were identified using quantitative reverse transcription polymerase chain reaction (RT-qPCR) and RT-LAMP.In laboratory tests, we optimized the detection time of primer set 2 for the RT-LAMP to 60 min. Notably, the onsite testing of 279 plasma samples from patients with SFTS revealed that the sensitivity and specificity of the test were 81.9% and 96.3%, respectively. We also analyzed samples with different durations of the disease, and our study showed that the sensitivity of RT-LAMP detection at the beginning of admission was 89.92%. Univariate analysis showed that the detection rate of RT-LAMP was similar to that of RT-qPCR in the first 5 days of the disease course and was lower than that of RT-qPCR on Days 6 and 14-15 of the disease course. The positive detection rate in patients aged ≥ 65 years was significantly higher than that in younger age groups.RT-LAMP is a simple, suitable, and rapid clinical detection method of SFTS onsite screening. It is more suitable for screening patients in the early stages of the disease and analyzing samples obtained from patients aged ≥ 65 years before the 6th day of the disease course.

Development of a reverse transcription loop-mediated isothermal amplification based clustered regularly interspaced short palindromic repeats Cas12a assay for duck Tembusu virus

Duck Tembusu virus (DTMUV) is an emerging pathogen that poses a serious threat to the duck industry in China. Currently, polymerase chain reaction (PCR), quantitative PCR (qPCR) and reverse transcription loop-mediated isothermal amplification (RT-LAMP) are commonly used for DTMUV detection. However, these methods require complex steps and special equipment and easily cause false-positive results. Therefore, we urgently need to establish a simple, sensitive and specific method for the clinical field detection of DTMUV. In this study, we developed an RT-LAMP-based CRISPR-Cas12a assay targeting the C gene to detect DTMUV with a limited detection of 3 copies/μL. This assay was specific for DTMUV without cross-reaction with other common avian viruses and only required some simple pieces of equipment, such as a thermostat water bath and blue/UV light transilluminator. Furthermore, this assay showed 100% positive predictive agreement (PPA) and negative predictive agreement (NPA) relative to SYBR Green qPCR for DTMUV detection in 32 cloacal swabs and 22 tissue samples, supporting its application for clinical field detection.

A real-time colourimetric reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the rapid detection of highly pathogenic H5 clade 2.3.4.4b avian influenza viruses

ABSTRACT Highly pathogenic avian influenza viruses (HPAIV) are a major threat to the global poultry industry and public health due to their zoonotic potential. Since 2016, Europe and France have faced major epizootics caused by clade 2.3.4.4b H5 HPAIV. To reduce sample-to-result times, point-of-care testing is urgently needed to help prevent further outbreaks and the propagation of the virus. This study presents the design of a novel real-time colourimetric reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the detection of clade 2.3.4.4b H5 HPAIV. A clinical validation of this RT-LAMP assay was performed on 198 pools of clinical swabs sampled in 52 poultry flocks during the H5 HPAI 2020–2022 epizootics in France. This RT-LAMP assay allowed the specific detection of HPAIV H5Nx clade 2.3.4.4b within 30 min with a sensitivity of 86.11%. This rapid, easy-to-perform, inexpensive, molecular detection assay could be included in the HPAIV surveillance toolbox.