Reverse Primer Research Articles

Plant growth promotion and antifungal activities of the mango phyllosphere bacterial consortium for the management of Fusarium wilt disease in pea (Pisum sativum L.)

Root rot caused by the pathogen Fusarium oxysporum is the number one cause of pea plant (P. sativum L.) death. There are many potential advantages to using rhizobacteria, endophytic bacteria and phyllospheric bacteria for managing plant diseases and promoting plant growth. This study investigated the potentiality of consortium species of bacteria to suppress root rot disease and their ability to promote the growth of pea plants compared with their individual and control plants. A total of 55 phyllospheric bacteria were isolated from mango flower and Bacillus sp. LBF- 02, Bacillus sp. LBF- 03 and Bacillus sp. LBF- 05 showed the most potent antimicrobial activity against root rot pathogens in a dual culture assay. Identification of phyllobacterial strain LBF- 01, LBF- 03 and LBF-05 were done by 16S rDNA sequence analysis using 704f forward primer (50-AGATTTTCCGACGGCAGGTT-30) and 907r reverse primer (50-CCGTCAATTCMTTTRAGTTT-30) with the PCR conditions. Their ability to solubilize phosphate, produce ammonia, siderophore and indole acetic acid, as well as produce extracellular enzymes in vitro was excellent. The results of a greenhouse study found that pea seed treated with consortium isolate significantly increased high germination rates and vigour indexes, as well as shoot and root length, fresh and dry weights, as compared with seed treated with single isolate and control. The defense enzyme activities in consortium treated pots were higher than those in individual and control pots. The plants treated with consortium exhibited higher levels of chlorophyll and carotenoids content in their leaves compared to the untreated control and single treated plants. A significant variation in the chemical profile of pea plants was found (F7,16 ? 2.598; P ? 0.048) resulting from different treatments (T1-T8). After evaluating a variety of growth and microbiological parameters, it was concluded that inoculation with the microbial consortium contributed to raising healthy and vigorously growing pea seedlings in greenhouse conditions, which is applicable in the field in future for sustainable farming.

Molecular Detection of Fusarium species infected Corn in Kurdistan region-Iraq

Corn or Maize product is regarded as one of the essential products in the world and stands third product after the rice and wheat crops. Different fungal pathogens attack corn plants; one of them is ear rot, brought on by Fusarium species and whose occurrence is primarily influenced by environmental factors. In order to isolate and identify Fusarium species from corn plants and their prevalence, 50 samples of corn were collected during September, October, and November of 2021 from 30 corn fields in 14 regions of different places in the Kurdistan region of Iraq. From all samples, 39 isolates of Fusarium were detected and based on morphological characteristics, six other species of Fusarium were identified, namely F. verticillioides (33.34%), F. proliferatum (25.64%), F. oxysporum (12.82%), F. incarnatum and F. equiseti (10.25% each), then F. fujikuroi (7.7%). The most prevalent species was F. verticillioides which was isolated from seven corn fields and significantly higher than all other isolated species. All Fusarium isolates were also molecularly identified depending on amplifying the internal transcribed spacer (ITS) universal region using forward ITS1 and reverse ITS4 primers and indicated DNA fragments ranged from 550 to 570 bp. The PCR fragments of the amplified ITS region were sequenced, aligned and registered in NCBI GeneBank with specified accession numbers. The phylogenetic tree and all analyzes were performed using the MEGA program version 11.0.13. The current study concluded that the corn fields in the Kurdistan region are infected with different Fusarium species, and the most common species is F. verticillioides. As well as the Fusarium species in the Kurdistan region have close evolutionary history to the same species in other countries. Thus, the study recommends more research to investigate the occurrence of toxigenic Fusarium species associated with cereal grains in the region.

Development and evaluation of an RNase H-dependent PCR (rhPCR) and an rh-quantitative PCR (rhqPCR) system for detection of a new potato pathogen-Ilyonectria pseudodestructans.

Ilyonectria pseudodestructans is a plant pathogen causing root rot on fruit trees such as grapevine and apple. Recently, it was reported to be a pathogen of potato. The increasing risk of this pathogen on plants makes it essential to develop a rapid and accurate detection method. In this study, an RNase H-dependent PCR (rhPCR) protocol and a modified probe based rh-quantitative PCR (rhqPCR) protocol for I. pseudodestructans detection were developed. Both the forward and reverse primers for rhPCR and rhqPCR carry a RNA nucleotide at the site where a single-nucleotide polymorphism between I. pseudodestructans and strains of other Ilyonectria species is located and the rhqPCR also contains a fluorescent-labeled target-specific probe. The primers were designed based on the sequence of the Histone H3 gene and could amplify a DNA fragment of 73 base pairs (bp). In the specificity test, by alignment via the Blastn tool, the RNA nucleotide bases on both the forward and reverse primers were identical to the corresponding genomic site of 16 of 17 (94.1%) database-available I. pseudodestructans strains, and different to 43 of 44 (97.7%) database-available strains of other Ilyonectria species. When the rhPCR/rhqPCR protocols were applied on 11 I. pseudodestructans strains and 46 other strains of different species of plant pathogens, all the I. pseudodestructans generated positive reactions but all the other strains were negative, which indicated an excellent specificity of the primers. In the sensitivity test, the lowest DNA template amount for a positive reaction using the rhPCR/rhqPCR methods was 2 pg for I. pseudodestructans genomic DNA. When testing the rhqPCR method on gBlock, the lowest number of molecules for a positive reaction was six. These results indicated a high sensitivity of the protocol for I. pseudodestructans detection. This is the first report of a probe-based rhqPCR to be applied on plant disease diagnosis; in addition, this is also the first rapid molecular protocol to detect I. pseudodestructans, and therefore, the new rhPCR/rhqPCR methods are recommended to plant disease diagnostic labs for their routine work.

Taxonomic Confirmation of Rare Fruits in West Kalimantan Using rbcL and matK Sequences

Phylogenetic analysis for plants can be very helpful in determining species identification or taxonomic status morphologically. rbcL and matK are widely used as genetic markers in constructing seed plant phylogenies. Different identification and new collection during the re-inventory from the previous study were found in two and four types of rare fruits in Sibohe Forest, West Kalimantan. The six types include pisang karok (Musa sp.) and Kandis (Garcinia sp.), as well as nubik (Artocarpus sp.), tehengan (Artocarpus sp.), smallest arok (Ficus sp.), and amok (Alpinia sp.). This study aimed to analyze the phenetic relationship of six rare fruits from Kalimantan based on rbcL and matK genes. DNA samples were obtained from dried body parts of the previous study and amplified by PCR using both forward and reverse primers for rbcL and matK genes. Amplification was observed on electrophoresis gel for rbcL gene of nubik, tehengan, smallest arok, amok, and pisang karok, while only pisang karok in matK gene. However, matK gene sequence was also obtained for amok even though the band was not seen on the gel. Phylogenetic analysis using the two genes confirmed the morphological identification reported in the previous study; however, using matK as a single gene for taxonomic confirmation must be reconsidered. The information of rbcL and matK sequences of six rare fruits from West Kalimantan could be the first information for building the DNA barcodes of the rare fruits in West Kalimantan.

Diagnostic test of multiplex PCR design based on COVID-19 genotype variations in local isolates

Background: Coronavirus disease 2019 (COVID-19) is an infectious disease caused by the SARS-CoV-2 virus which is a new strain of the Coronavirus, the primary and probe designs were carried out to find candidate primers and probes to be used as the detection of COVID-19. The purpose of this study was to design multiplex PCR on primers and ORF1ab and N gene probes in COVID-19 examination using the multiplex PCR method and it is expected to have good validity in the examination. Methods: The research design is in the form of explorative descriptive with a cross sectional approach. Starting from April to December 2021. The samples used in this study were 221 COVID-19 gene sequences downloaded from the NCBI and GISAID gene databases. Results: The design results of the ORF1ab gene primer and probe with forward primer: 5'- CGCAATTTACAACACAGAC -3' reverse primer: 5'- GTTCTTTATGCTAGCCACT -3' amplicon length 183 bp, and probe sequence: FAM 5'-AAACACACAACAGCATCGTCA-3' BHQ-1, on the N gene with forward primer: 5'-AATTCAACTCCAGGCAG -3' and reverse primer: 5'- CTCTCTCAAGCTGGTTCAATC -3' amplicon length 111 bp, and probe sequence: HEX 5'-CAGCAAAGCAAGAGCAGCA-3' BHQ-1 primary pair sequence and ORF1ab gene probe and N gene conjecture qualified for q-PCR. Conclusions: The obtained primary and probe pair sequences can be used as COVID-19 detection using the multiplex PCR method.

First Record of Free-Living Nematode Mylonchulus hawaiiensis from Bondowoso Regency-Indonesia

Monochids are predatory nematodes that can be found in various ecosystems. In this study, we analyzed monochids from the rhizosphere of Arabica coffee in Bondowoso Regency-Indonesia. The morphological analysis showed that the nematode belonged to the Mylonchulus hawaiiensis (Cassidy, 1931) species. The analysis results were also confirmed by a molecular analysis using DNA from a single nematode. The study also involved a polymerase chain reaction process using a forward primer SSU F07 (5’-AAA GAT TAA GCC ATG CAT G-3’) and reverse primer SSU R 81 (5’-TGA TCC WKC YGC AGG TTC AC-3’), which amplifies the small subunit (SSU) region of rDNA. Phylogenetic analysis of the sequence obtained formed a cluster with those of M. hawaiiensis found in GenBank. The sequences obtained had homology ranging from 99.64 to 99.70% compared with M. hawaiiensis sequences found in GenBank. This study is the first report of M. hawaiiensis from Indonesia.

Characterization of Yeast Isolated from Berkeep, a Traditional Fermented Milk Products of Darfur State, Western Sudan

Berkeep is a naturally fermented yoghurt-like milk product consumed as common food in parts of the Darfur State, Western Sudan. Its production and consumption derive much food security and economic benefits to the rural people in the region. The objective of this study was to isolate and characterize yeasts of Berkeep by both conventional and molecular-based methods. A total of 220 yeast isolates, were obtained from 75 samples of Berkeep from three production sites namely, Elkoumah, Manwashy and Kass in Darfur state, were purified then characterized to species level by molecular tools. Based on ITS-PCR using the forward primer Cy5-Y-ITS1 and reverse primer Y-ITS4, the isolates were screened into five groups. Representative of each group was selected for sequence analysis of ITS rRNA gene. The gene sequence was subjected to nucleotide BLAST. The yeast microbiota of Berkeep was dominated by Kluyveromyces marxianus (YG4, 85 isolates) which showed 100% homology towards Kluyveromyces marxianus isolate QKM4. 14.54% (32 isolates), Sixty-eight (Group YG5) identified as Saccharomyces cerevisiae showed 97.22% homology towards Saccharomyces cerevisiae isolate JKSP39. Group YG3 revealed 100% homology towards Pichia kudriavzevii isolate Sugarcane. Eleven isolates, (YG2) showed 99.37% homology towards Pichia kudriavzevii strain YS179. The twenty-four isolates of group, (YG1) recorded 99.70% similarity towards Candida intermedia isolate B-NC-12-f 16i. Very minute variation was observed with in the three production sites concerning the yeast count and type of yeast species.

Transcriptional Analysis of TP53 Gene in Chronic Hepatitis C Patients Treated with Sofosbuvir, Daclatasvir, Pegylated Interferon, and Ribavirin.

Hepatitis C virus (HCV) is a major public health problem that affects more than 170 million people globally. HCV is a principal cause of hepatocellular carcinoma (HCC) around the globe due to the high frequency of hepatitis C infection, and the high rate of HCC is seen in patients with HCV cirrhosis. TP53 is considered as a frequently altered gene in all cancer types, and it carries an interferon response element in its promoter region. In addition to that, the TP53 gene also interacts with different HCV proteins. HCV proteins especially NS3 protein and core protein induce the mutations in the TP53 gene that lower the expression of this gene in HCV patients and leads to HCC development. In this study, we examined the transcriptional analysis of the TP53 gene in HCV-infected patients administered with different combinations of antiviral therapies including sofosbuvir + daclatasvir, sofosbuvir + ribavirin, and pegylated interferon + ribavirin. This study included 107 subjects; 15 treated with sofosbuvir + daclatasvir, 58 treated with sofosbuvir + ribavirin, 11 treated with interferon + ribavirin, 8 untreated, 10 HCC patients, and 5 were healthy controls. Total RNA was extracted from the PMBCs of HCV infected patients and reverse transcribed into cDNA using a gene specific reverse primer. The expression level of TP53 mRNA was analyzed using quantitative PCR. The expression of TP53 mRNA was notably upregulated in rapid virological response (RVR), early virological response (EVR), and sustained virological response (SVR) groups as compared to non-responders and naïve groups. The expression of TP53 mRNA was seen high in HCC as compared to control groups. Additionally, it has been demonstrated that sofosbuvir + daclatasvir treatment stimulates significant elevation in TP53 gene expression as compared to (sofosbuvir + ribavirin) and (IFN + ribavirin) treatment. This study indicates that the TP53 gene expression is highly upregulated in RVR, EVR, and SVR groups as compared to control groups. Moreover, sofosbuvir + daclatasvir therapy induces significant rise in TP53 mRNA expression levels as compared to (sofosbuvir + ribavirin) and (IFN + ribavirin) treatment. According to these results, it can be concluded that sofosbuvir + daclatasvir plays a significant role in preventing HCV patients from developing severe liver complications as compared to other administered therapies. This study is novel as no such type of study has been conducted previously on the expression of TP53 in local HCV-infected population treated with different combinations of therapies. This study is helpful for the development of new therapeutic strategies and for improving existing therapies.

High-Affinity Neutralizing DNA Aptamers against SARS-CoV-2 Spike Protein Variants

The continuous emergence of new variants of concern for SARS-CoV-2 has created a challenge for existing therapies. To address this, we developed a series of single-stranded DNA aptamers that not only bind specifically to the trimer S protein of SARS-CoV-2 but also block the interaction between the trimer S protein and ACE2 receptors. The systematic evolution of ligands by exponential enrichment (SELEX) was performed to select the aptamers for SARS-CoV-2 trimer S protein. ELISA-based assay and flow cytometry were performed to test the apatmers’ binding and inhibition of trimer S protein in vitro. Binding affinity was measured using surface plasmon resonance. Significance was determined in Prism 9.0 using the one-way ANOVA test (Dunnett’s multiple comparisons test) or two-way ANOVA test (Tukey’s multiple comparisons test) for comparisons. The p values < 0.05 were considered statistically significant. After 12 rounds of SELEX, eight highly enriched aptamers were able to bind to the trimer S protein of the SARS-CoV-2 Wuhan original strain as well as the trimer S proteins of the Delta, Delta plus, Alpha, Lambda, Mu, and Omicron variants, with affinities in the nM range, while also inhibiting their interaction with ACE2 receptors in Vero E6 cells. Modifications to our best aptamer were made by adding forward and reverse primer sequences and truncation. The modified aptamers AYA2012004_L and AYA2012004_L-M1 showed up to 70% inhibition of the binding of virus-like particles (VLPs) expressing S protein to the ACE2 receptor expressed in HEK293T cells. Our findings imply that the selected aptamers can prevent SARS-CoV-2 from entering host cells and hence suppress the viral infection. In addition, the findings suggest that the selected aptamers might be an innovative therapy for the treatment of COVID-19.

Microbial and epidemiological factors in early detection of esophageal squamous cell carcinoma and precancerous lesions.

Microbial and epidemiological factors in early detection of esophageal squamous cell carcinoma and precancerous lesions.

First report of Tobacco rattle virus infecting Brassica oleracea var. botrytis (cauliflower) in India.

The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.

Differentiation of cattle and buffalo meat using multiplex polymerase chain reaction

Authentication of origin of animal species is of paramount importance owing to economic, social, religious, forensic and public health considerations. In the present study, a multiplex polymerase chain reaction (mPCR) was developed by designing unique species-specific forward and a common reverse primers flanking mitochondrial D-loop region for the authentication of cattle (Bos indicus / B. taurus) and buffalo (Bubalus bubalis) species. Novel mPCR amplified 382 bp product specific to cattle and 336 bp specific to buffalo. Possibility of cross amplification in other species was rules out by testing as many as 25 other animal species. The novel mPCR assay developed in this study for the authentic identification and differentiation of meats of cattle and buffalo could be applied for the differentiation of samples derived from cattle and buffalo in diagnostic laboratories thereby ensuring prompt labelling of products, protecting consumer sentiments and enforcement of laws.

Correction to: Endothelial Transient Receptor Potential Canonical Channel Regulates Angiogenesis and Promotes Recovery after Myocardial Infarction.

HomeJournal of the American Heart AssociationVol. 12, No. 7Correction to: Endothelial Transient Receptor Potential Canonical Channel Regulates Angiogenesis and Promotes Recovery after Myocardial Infarction Open AccessCorrectionPDF/EPUBAboutView PDFView EPUBSections ToolsAdd to favoritesDownload citationsTrack citations ShareShare onFacebookTwitterLinked InMendeleyReddit Jump toOpen AccessCorrectionPDF/EPUBCorrection to: Endothelial Transient Receptor Potential Canonical Channel Regulates Angiogenesis and Promotes Recovery after Myocardial Infarction Originally published28 Mar 2023https://doi.org/10.1161/JAHA.121.027660Journal of the American Heart Association. 2023;12:e027660This article corrects the followingEndothelial Transient Receptor Potential Canonical Channel Regulates Angiogenesis and Promotes Recovery After Myocardial InfarctionOther version(s) of this articleYou are viewing the most recent version of this article. Previous versions: March 28, 2023: Ahead of Print In the article by Xin Wen et al, “Endothelial Transient Receptor Potential Canonical Channel Regulates Angiogenesis and Promotes Recovery After Myocardial Infarction,” which published online March 5, 2022 (J Am Heart Assoc. 2022;11:e023678. DOI: 10.1161/JAHA.121.023678) and was included in the March 15, 2022 issue of the journal, corrections were needed.In Figure 1E, the image for tube formation in primary coronary artery endothelial cells from floxed TRPC1 (TRPC1fl/fl) mice was incorrect. This figure has been corrected.In the Supplemental Material, in Table S2, the reverse PCR primer sequence for HIF‐1α was incorrect. This primer sequence has been corrected.In the Supplemental Material, in Figure S3C, the immunofluorescence image for CD31 in mesenteric artery smooth muscle cells was incorrect. This figure has been corrected.The authors regret the errors.The online version of the article has been updated and is available here: https://www.ahajournals.org/doi/full/10.1161/JAHA.121.023678. Previous Back to top Next FiguresReferencesRelatedDetailsRelated articlesEndothelial Transient Receptor Potential Canonical Channel Regulates Angiogenesis and Promotes Recovery After Myocardial InfarctionXin Wen, et al. Journal of the American Heart Association. 2022;11 April 4, 2023Vol 12, Issue 7Article InformationMetrics Copyright © 2023 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley BlackwellThis is an open access article under the terms of the Creative Commons Attribution‐NonCommercial‐NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.https://doi.org/10.1161/JAHA.121.027660PMID: 36974768 Originally publishedMarch 28, 2023 PDF download

In silico evaluation and selection of the best 16S rRNA gene primers for use in next-generation sequencing to detect oral bacteria and archaea

BackgroundSequencing has been widely used to study the composition of the oral microbiome present in various health conditions. The extent of the coverage of the 16S rRNA gene primers employed for this purpose has not, however, been evaluated in silico using oral-specific databases. This paper analyses these primers using two databases containing 16S rRNA sequences from bacteria and archaea found in the human mouth and describes some of the best primers for each domain.ResultsA total of 369 distinct individual primers were identified from sequencing studies of the oral microbiome and other ecosystems. These were evaluated against a database reported in the literature of 16S rRNA sequences obtained from oral bacteria, which was modified by our group, and a self-created oral archaea database. Both databases contained the genomic variants detected for each included species. Primers were evaluated at the variant and species levels, and those with a species coverage (SC) ≥75.00% were selected for the pair analyses. All possible combinations of the forward and reverse primers were identified, with the resulting 4638 primer pairs also evaluated using the two databases. The best bacteria-specific pairs targeted the 3-4, 4-7, and 3-7 16S rRNA gene regions, with SC levels of 98.83–97.14%; meanwhile, the optimum archaea-specific primer pairs amplified regions 5-6, 3-6, and 3-6, with SC estimates of 95.88%. Finally, the best pairs for detecting both domains targeted regions 4-5, 3-5, and 5-9, and produced SC values of 95.71–94.54% and 99.48–96.91% for bacteria and archaea, respectively.ConclusionsGiven the three amplicon length categories (100-300, 301-600, and >600 base pairs), the primer pairs with the best coverage values for detecting oral bacteria were as follows: KP_F048-OP_R043 (region 3-4; primer pair position for Escherichia coli J01859.1: 342-529), KP_F051-OP_R030 (4-7; 514-1079), and KP_F048-OP_R030 (3-7; 342-1079). For detecting oral archaea, these were as follows: OP_F066-KP_R013 (5-6; 784-undefined), KP_F020-KP_R013 (3-6; 518-undefined), and OP_F114-KP_R013 (3-6; 340-undefined). Lastly, for detecting both domains jointly they were KP_F020-KP_R032 (4-5; 518-801), OP_F114-KP_R031 (3-5; 340-801), and OP_F066-OP_R121 (5-9; 784-1405). The primer pairs with the best coverage identified herein are not among those described most widely in the oral microbiome literature.BaWjngsRiAeBWt8MJdkB1wVideo

Development of PCR-RFLP for the detection of benzimidazole resistance polymorphisms in isotype 1 β-tubulin gene of Trichostrongylus colubriformis

Trichostrongylus spp. is a predominant gastrointestinal strongyle in small ruminants and the development of benzimidazole resistance in this species can significantly contribute to the overall resistance status in farms. The objective of the present study was to develop PCR-RFLP for genotyping Trichostrongylus colubriformis larvae for benzimidazole resistance polymorphisms at codons 167, 198 and 200 in the isotype 1 β-tubulin gene. A 246 bp region of the isotype 1 β-tubulin gene containing the three codons was amplified by semi-nested PCR. A modified reverse primer was used in the semi-nested PCR for substituting the third nucleotide downstream of codon 200 (C) with nucleotide T to create a restriction site for identifying the polymorphism at codon 200. Restriction endonuclease mapping of the 246 bp product was done and the restriction enzymes HpyCH4III, HpyCH4V and RsaI were selected for the identification of SNPs at codons 200, 198 and 167, respectively. RFLP with HpyCH4III yielded 147 and 99 bp fragments in the susceptible genotype (SS) and 147, 67 and 32 bp fragments in the resistant genotype (rr) at codon 200. HpyCH4V was expected to cut the 246 bp semi-nested PCR product into 205 and 41 bp fragments in the resistant genotype at codon 198, while the susceptible genotype yielded an uncut 246 bp product. RFLP with RsaI was expected to give two fragments of sizes 199 and 47 bp in the susceptible genotype and three fragments of sizes 199, 25 and 22 bp in the resistant genotype. A total of 150 T. colubriformis larvae were genotyped at the three codons. Benzimidazole resistance-associated SNPs were found at codon 200 while no polymorphism was identified at codons 167 and 198. Twenty eight per cent of the larvae genotyped were found to be homozygous resistant (rr, TAC/TAC), 60.67 per cent homozygous susceptible (SS, TTC/TTC) and 11.33 per cent heterozygous (rS, TTC/TAC) at codon 200 of isotype 1 β-tubulin gene. The overall frequency of the resistant allele (r, TAC) was 0.337 and that of the susceptible allele (S, TTC) was 0.663. The present study forms the first report of PCR-RFLP for genotyping T. colubriformis in goats at the three benzimidazole resistance-associated codons.

Mitochondrial DNA D-loop Genetic Relatedness and Characterization of Nile Tilapia (Oreochromis niloticus Linnaeus, 1758) from Lakes Alau and Bako, Northeast, Nigeria

This study investigated the genetic relatedness and characterization of Nile tilapia (Oreochromis niloticus) populations from Lake Bako, Mambilla Plateau and Lake Alau, Maiduguri using Mitochondrial DNA (mtDNA) D-loop sequences. Blood samples were collected from each individual of and preserved on an FTA card. DNA was extracted from the card using Aqualex extraction kits. Polymerase Chain Reaction was performed using a commercially available decamer primer: FISH COMUM D-LOOP F (5’-GGATTYTAACCCYTRCCC -3’) and (R:) as the forward primer and C. zilli_rev (5′ – AGTAAAGTCAGGACCAAGCC – 3′) as reverse primer. The results showed that, in total 117 variable sites were observed and Hap_1_Hap_40 was detected. Lake Alau population has 65.50 % A+T and 34.5% G+C, while 65.5% and 34.9% were the nucleotide composition of Lake Bako population. Both populations have 1.00 Haplotypes diversity. The nucleotide diversity observed in Lake Bako population is 0.0342, while 0.0285 were recorded in Lake Bako population. The average number of nucleotide differences of 26.61053 and 31.98421 were observed in Lakes Bako and Alau populations, respectively with and overall value of 29.996. The Neighbour-Joining phylogenetic tree revealed two major clusters. The genetic variation among population is 95.31%and within population is 4.69%. Populations of O. niloticus in Lakes Bako and Alau are genetically different. Lake Bako population seemed to have intact genetic structure. Both populations have high genetic diversity, hence have high potential for genetic improvement and conservation.

Design of Specific Primer for Methallothionein Gene of Tor Fish (Tor tambra)

The use of heavy metal biomarkers is needed to detect and integrate heavy metals at the molecular level. Metallothionein gene is a gene that is expressed in fish organs that have been heavily polluted. The aim of the study was to find specific primers for methallothionein of tor fish. Detection of the metallothionein gene expression in PCR instruments requires a primer in the form of a short chain DNA sequence as a specific target DNA identifier. The primer design was performed in silico using the NCBI site and multiple-aligned using Geneious Prime bioinformatic software. Primers were designed according to the conserved region of these genes. The primers specificity was checked using Primer BLAST tools in NCBI. The results showed that the forward primer 1 (5'- GAT TGC GCC AAG ACT GGA ACT –3') and reverse primer 1 (5' – ATC ACG TTG ACC TCC TCA CTG -3') qualified as good primers with an amplicon size 186 bp.

Correction: Temporal and spatially controlled APP transgene expression using Cre-dependent alleles

There were errors in Disease Models & Mechanisms (2022) 15, dmm049330 (doi:10.1242/dmm.049330).The authors recently discovered that one of the Cre-dependent transgenic mouse lines used in the study is not correctly described within the article. The mouse line labelled as R26-APP in the paper was originally described as containing both the Swedish and Iberian mutations, but carries only the Iberian mutation. This was discovered by The Jackson Laboratory when they sequenced through the complete insert to confirm the allele before entering the line into their repository for distribution. The authors also discovered an unintended point mutation located just outside the Aβ domain, M647T by APP695 numbering (M722T by APP770 numbering). They propose that the model should be identified as R26-APPIbe rather than as R26-APP.A diagram of the allele that appears in Fig. 2A has been corrected:In addition, a section describing the cloning methods in the Materials and Methods has been updated. The corrected and original versions are shown below:‘Cloning of R26-LSL-hAPPIbe transgene’ section (corrected). Human APPIbe 695 amino acid cDNA was generated in two steps. The N-terminal 1592 nucleotides of huAPP695 were cut from pcDNA3.1-sAPPα (a gift from Hui Zheng, BCM) with HindIII and SacI and subcloned into the same sites of transfer plasmid L4440 (Addgene, #1654). The remaining fragments were amplified from a human cDNA library using a two-step PCR method. Both PCR products contained the Ibe mutation as well as an overlap region needed to serve as an extended template for the second PCR. The first C-terminal fragment was amplified using hAPP C-terminus forward primer 5′-AACGAAAACCACCGTGGAGCT-3′ and Ibe reverse primer 5′-AAGGTGATGACGAACACTGTCG-3′. The second C-terminal fragment was amplified by Ibe forward primer 5′-CGACAGTGTTCGTCATCACCTT-3′ and hAPP C-terminus reverse primer 5′-GCGCGGATATCCTAGTTCTGCATCTGCTCAAAG-3′. The complete hAPP695Ibe C-terminus was then amplified from a mixture of the two shorter products using hAPP CT forward primer and hAPP CT reverse primer. The purified huAPPIbe C-terminal PCR fragment was digested with EcoRV and SacI and ligated into the EcoRV/SacI sites of L4440-APP(1-1592), resulting in L4440-APPIbe. The complete huAPPIbe sequence was transferred into an intermediary expression plasmid, which was digested with MluI and FseI and cloned into an Ai3-derived ROSA26 targeting vector (Madisen et al., 2010) to generate the final transgene construct pJJ-hAPPIbe. The modified Ai3 targeting vector retained the original Ai3 Cre-dependent CAG-loxP-stop-loxP sequence but removed the PGK-DTA negative selection cassette and shortened the 3′ targeting arm to reduce the overall vector size. All restriction enzymes were purchased from New England Biolabs (Ipswich, MA, USA).‘Cloning of R26-LSL-hAPPSwe/Ibe transgene’ section (original). Human APPSwe/Ibe 695 amino acid cDNA was amplified from the pBR322-APPSwe/Ind plasmid used to generate the Tg CRND8 mouse model (Chishti et al., 2001) (a gift from David Westaway, University of Alberta, Canada) with primers that converted the original Indiana mutation V717F into the Iberian mutation I716F (point mutation numbering is for the standard human APP 770 amino acid isoform). The N-terminus of APPSwe/Ibe 695 was amplified using the forward primer 5′-GGCCGGCCGCCACCATGCTGCCCGGTTTGGCACT-3′ and reverse primer 5′-AAGGTGATGACGAACACTGTCG-3′; the C-terminus was amplified using the forward primer 5′-CGACAGTGTTCGTCATCACCTT-3′ and reverse primer 5′-GCGCGACGCGTCTAGTTCTGCATCTGCTCAAAGAA-3′. The resulting hAPPSwe/Ibe fragments were combined by amplification using the forward primer 5′-GGCCGGCCGCCACCATGCTGCCCGGTTTGGCACT-3′ and reverse primer 5′-GCGCGACGCGTCTAGTTCTGCATCTGCTCAAAGAA-3′. The complete hAPPSwe/Ibe 695 cassette was digested with MluI and FseI, and cloned into an Ai3-derived ROSA26 targeting vector (Madisen et al., 2010) that had been cut with the same enzymes to generate the final transgene construct pJJ-hAPPSwe/Ibe. The modified Ai3 targeting vector retained the original Cre-dependent CAGloxP-stop-loxP sequence but removed the PGK-DTA negative selection cassette and shortened the 3′ targeting arm to reduce the overall vector size. All restriction enzymes were purchased from New England Biolabs (Ipswich, MA, USA).Throughout the paper, where the text refers to R26-APP, R26-APPSwe/Ibe or ROSA26-CAG-LSL-APPSwe/Ibe, corrections have been made to R26-APPIbe or ROSA26-CAG-LSL-APPIbe. The model will still be distributed by The Jackson Laboratory as stock #037319, but using the line name R26-APPIbe. The study results and conclusions remain unaffected.Both the online full-text and PDF versions have been updated. The authors apologise to readers for these errors and any inconvenience they may have caused.

Isolation and Identification of Xylella fastidiosa that Cause Oleander Leaf Scorch

During spring of 2022, leaf scorchsymptom was observed in Nerium oleander plant in Erbil city. Surveys were carried out in three main Erbil streets (60-meter, 120 meter and Qasmlo) to determine the occurrence and distribution of oleander leaf scorch. Oleander leaf scorch (OLS) is a disease caused by xylem limited bacterium Xylella fastidiosa. The percentage of plants with Oleander leaf scorch infection ranged usually between 23-91%, and the disease was assessed the highest disease rate based on disease rating scale was recorded in 60-meter street is 91.95%, Qasmlo street is 89.07% and the lowest disease rate was observed in 120-meter street is 23.17%. In this study the bacterium was detected after isolated in laboratory as Gram stain test was performed and the isolated bacterium was Gram negative, rod shaped, non-flagellate and non-motile also identified by PCR were performed with two primers forward primer 16S (AGAG TTTG ATCC TGGC TCAG) and reverse primer 16S (GGCT ACCT TGTT ACGA CTT), amplified a 1200 bp fragment from the isolated OLS. The Analysis of BLAST revealed that the highest identity number query sequences were (100%) identified and submitted in GenBank and have taken accession number Xylella fastidiosa subsp. Sandyi (ON131099) and Xylella fastidiosa subsp. Sandyi (ON131100) also the phylogenetic results show the each identified bacteria are grouped in one clade with other sequences were stored in NCBI GenBank. This is a first report of a ‘Xylella fastidiosa.in Erbil city.

Fine-scale evaluation of two standard 16S rRNA gene amplicon primer pairs for analysis of total prokaryotes and archaeal nitrifiers in differently managed soils.

The advance of high-throughput molecular biology tools allows in-depth profiling of microbial communities in soils, which possess a high diversity of prokaryotic microorganisms. Amplicon-based sequencing of 16S rRNA genes is the most common approach to studying the richness and composition of soil prokaryotes. To reliably detect different taxonomic lineages of microorganisms in a single soil sample, an adequate pipeline including DNA isolation, primer selection, PCR amplification, library preparation, DNA sequencing, and bioinformatic post-processing is required. Besides DNA sequencing quality and depth, the selection of PCR primers and PCR amplification reactions arguably have the largest influence on the results. This study tested the performance and potential bias of two primer pairs, i.e., 515F (Parada)-806R (Apprill) and 515F (Parada)-926R (Quince) in the standard pipelines of 16S rRNA gene Illumina amplicon sequencing protocol developed by the Earth Microbiome Project (EMP), against shotgun metagenome-based 16S rRNA gene reads. The evaluation was conducted using five differently managed soils. We observed a higher richness of soil total prokaryotes by using reverse primer 806R compared to 926R, contradicting to in silico evaluation results. Both primer pairs revealed various degrees of taxon-specific bias compared to metagenome-derived 16S rRNA gene reads. Nonetheless, we found consistent patterns of microbial community variation associated with different land uses, irrespective of primers used. Total microbial communities, as well as ammonia oxidizing archaea (AOA), the predominant ammonia oxidizers in these soils, shifted along with increased soil pH due to agricultural management. In the unmanaged low pH plot abundance of AOA was dominated by the acid-tolerant NS-Gamma clade, whereas limed agricultural plots were dominated by neutral-alkaliphilic NS-Delta/NS-Alpha clades. This study stresses how primer selection influences community composition and highlights the importance of primer selection for comparative and integrative studies, and that conclusions must be drawn with caution if data from different sequencing pipelines are to be compared.