Bioassay Results Research Articles

Design, Synthesis, and Antifungal/Antioomycete Activity of Thiohydantoin Analogues Containing Spirocyclic Butenolide.

Novel fungicidal agents were designed based on the combination of two privileged scaffolds, thiohydantoin and spirocyclic butenolide, which are widely found in natural products. The synthesized compounds were characterized by 1H NMR, 13C NMR, and high-resolution electrospray ionisation mass spectrometry. The in vitro antioomycete activity evaluation showed that most of the compounds exhibited excellent inhibitory activities against different developmental stages in the life cycle of pathogenic oomycete Phytophthora capsici. Compound 5j could inhibit the mycelial growth, sporangium production, zoospore release, and cystospore germination significantly with EC50 values of 0.38, 0.25, 0.11, and 0.026 μg/mL, respectively. The in vivo antifungal/antioomycete bioassay results revealed that the series of compounds generally showed outstanding control efficacies against the pathogenic oomycete Pseudoperonospora cubensis, and compounds 5j, 5l, 7j, 7k, and 7l possessed broad-spectrum antifungal activities against the test phytopathogens. The in vivo protective and curative efficacies against P. capsici of the representative compound 5j were excellent, which were better than those of azoxystrobin. More prominently, 5j significantly promoted the biomass accumulation of the root system and reinforced the cell wall by callose deposition. The pronounced upregulation of immune response-related genes indicated that the active oomycete inhibitor 5j also functioned as a plant elicitor. Transmission electron microscopy observation and the enzyme activity test demonstrated that the mechanism of action of 5j was to bind to the pivotal protein, complex III on the respiratory chain, which resulted in a shortage of energy supply. Molecular docking results exhibited that compound 5j appropriately matched with the Qo pocket and had no interaction with the most commonly mutated site Gly-142, which may be of significant benefit in Qo fungicide resistance management. Compound 5j showed great advantages and potential in oomycete control, resistance management, and induction of disease resistance. A further investigation of 5j with a unique structure might have direct implications for the creation of novel oomycete inhibitors against plant-pathogenic oomycetes.

Discovery of Novel Benzoxaborole-Containing Streptochlorin Derivatives as Potential Antifungal Agents.

Streptochlorin is a kind of indole alkaloid derived from marine microorganisms. It is a promising lead compound due to its potent bioactivity in preventing many phytopathogens, as shown in our previous study. To explore the potential applications of this natural product, a series of novel benzoxaborole-containing streptochlorin derivatives were designed and synthesized through a one-step and catalyst-free reaction in water at room temperature. All target compounds were first screened for their antifungal profiles in vitro against six common phytopathogenic fungi. The results of bioassay revealed that most of the designed compounds exhibited more significant antifungal activities against Botrytis cinrea, Gibberella zeae, Rhizoctorzia solani, Colletotrichum lagenarium, and alternaria leaf spot under the concentration of 50 μg/mL, and this is highlighted by compounds 4i and 5f, which demonstrated impressive antifungal effects against G. zeae and R. solani, with their corresponding EC50 values 0.2983 and 0.2657 μg/mL, which are obviously better than positive control flutriafol and boscalid (5.2606 and 1.2048 μg/mL, respectively). Scanning electron microscopy on the hyphae morphology showed that compound 5b might cause mycelial abnormalities of G. zeae. 3D-QSAR studies of CoMFA and CoMSIA were carried out on 29 target compounds with antifungal activity against B. cinrea. The analysis results indicated that introducing appropriate electronegative groups at the 5-position of benzoxaborole and the 4,5-positions of the indole ring could effectively improve the anti-B. cinrea activity. Moreover, compound 5b showed good antifungal activities in vivo against Phytophthora capsici. Molecular docking was further explored to ascertain the practical value of the active compound as a potential inhibitor of LeuRS. The abovementioned results indicate that the designed benzoxaborole-containing streptochlorin derivatives could be further studied as template molecules of novel antifungal agents.

Down-Regulation of Strigolactone Biosynthesis Gene D17 Alters the VOC Content and Increases Sogatella furcifera Infectivity in Rice

DWARF17 (D17/HTD1) is a well-defined rice strigolactone (SL) biosynthesis gene that influences rice tiller development and the production of rice. To investigate whether SLs play a role in the regulation of rice’s defense against the white-backed planthopper (WBPH, Sogatella furcifera), we compared a SL-biosynthetic defective mutant (d17) with WT rice plants. Our olfactory bioassay results revealed that WBPHs are attracted to d17 plants, which may be attributed to changes in rice volatile substances. Hexanal, a volatile substance, was significantly reduced in the d17 plants, and it was demonstrated that it repelled WBPHs at a concentration of 100 μL/L. Compared to the WT plants, WBPH female adults preferred to oviposit on d17 plants, where the egg hatching rate was higher. The transcript level analysis of defense-associated genes in the JA and SA pathways showed that the expression of OsJAmyb, OsJAZ8, OsPR1a and OsWRKY62 were significantly reduced in d17 plants compared to WT plants following WBPH infection. These findings suggest that silencing the strigolactone biosynthesis gene D17 weakens defenses against S. furcifera in rice.

Influence of ozone microbubble enhanced oxidation on mine effluent mixes and Daphnia magna toxicity

The mining industry often must mix different kinds of water on the mine site during pre-treatment or post-treatment before the final discharge of the treated water to the environment. Microbubble ozonation has proven to be efficient in the removal of contaminants of concern from mine water, such as metals, metalloids, and nitrogen compounds, which can persist in the environment and entail toxicity issues. This study evaluated the efficiency of ozone microbubbles combined with lime precipitation on contaminant removal and its impact on toxicity for Daphnia magna with five different mine effluent mixes from an active mine site located in Abitibi-Témiscamingue, QC, Canada. For the non-acidic mixes, two scenarios were tested: first, pre-treatment of metals using lime precipitation and a flocculant was conducted prior to ozonation; and second, ozonation was conducted prior to metals post-treatment using the same precipitation and flocculation technique. Results showed that the NH3–N removal efficiency ranged from 90% for the lower initial concentrations (1.1 mg/L) to more than 99% for the higher initial concentrations (58.4 mg/L). Moreover, ozonation without metals pre-treatment improved NH3–N treatment efficiency in terms of kinetics but entailed abnormal toxicity issues. Results of bioassays conducted on water with metals pre-treatment did not show any toxicity events but showed abnormal toxicity patterns on the mixes treated without metals pre-treatment (diluted effluents were toxic, while undiluted were not). At 50% dilution, the water was toxic, probably due to the potential presence of metal oxide nanoparticles. The confirmation of the source of toxicity requires further investigation.

Two salivary proteins Sm10 and SmC002 from grain aphid Sitobion miscanthi modulate wheat defense and enhance aphid performance.

The grain aphid Sitobion miscanthi is a serious pest of wheat that causes severe economic damage by sucking phloem sap and transmitting plant viruses. Here, two putative salivary effector homologs from S. miscanthi (Sm10 and SmC002) were selected based on sequence similarity to other characterized aphid candidate effectors. These effectors were then delivered into wheat cells separately via the type III secretion system of Pseudomonas fluorescens to elucidate their functions in the regulation of plant defenses and host fitness. The results showed that the delivery of either Sm10 or SmC002 into wheat plants significantly suppressed callose deposition and affected the transcript levels of callose synthase genes. The expression levels of salicylic acid (SA)-associated defense genes were upregulated significantly in wheat leaves carrying either Sm10 or SmC002. Moreover, LC-MS/MS analysis revealed that wheat SA levels significantly increased after the delivery of the two effectors. The results of aphid bioassays conducted on the wheat plants carrying Sm10 or SmC002 showed significant increases in the survival and fecundity of S. miscanthi. This study demonstrated that the Sm10 and SmC002 salivary effectors of S. miscanthi enhanced host plant susceptibility and benefited S. miscanthi performance by regulating wheat defense signaling pathways.

SCREENING OF MARINE BACTERIUM VIBRIO ALGINOLYTICUS STRAIN AS05 FOR THE PRODUCTION OF N-ACYL HOMOSERINE LACTONE-BASED QUORUM SENSING SIGNALING MOLECULES

Marine environments, including aquatic and coastal environments, are highly prevalent of marine bacteria with the highest levels of Vibrio species. Vibrios play a vital role in marine ecology associated with carbon and energy acquisition. The density-dependent quorum sensing (QS) system may regulate certain biological activities in marine bacteria. QS is a conversation system utilized by many bacterial communities to communicate and coordinate through different signalling molecules. N-acyl homoserine lactones (AHLs) are the most important QS signalling molecules widely produced by Gram-negative bacteria. This study aimed to investigate the detection and Identification of AHL-based QS signalling molecules produced by marine bacterium V. alginolyticus strain AS05 isolated from marine water of the Arabian Sea, Karachi, Pakistan. Marine medium Zobell-2216 was used to isolate bacterial strains. Moreover, 16S rRNA analysis was applied to identify AS05 strain. Agar plate bioassay was used to detect the production of AHL signalling molecules using Chromobacterium violaceum CV026 as a biosensor. The Identification of AHLs was made by reversed-phase thin-layer chromatography (RP-TLC) analysis. The NCBI-blast results revealed the identification of the isolated bacterial strain as Vibrio alginolyticus strain AS05 (OQ130030) member of the family of Vibrionaceae under the class of Gammaproteobacteria. The results of agar plate bioassay using CV026 as a biosensor strain revealed highly positive reactions for producing AHL signalling molecules. Moreover, two AHL molecules produced by AS05 bacterial strain were identified as C6-HSL and C-8HSL based on TLC analysis. This study reveals the detection and Identification of two different AHL signalling molecules produced by V. alginolyticus AS05 isolated from marine water of the Arabian Sea, Karachi, Pakistan. This study provides insight into investigating quorum-sensing signalling molecules in the Arabian Sea, Karachi, Pakistan, and marine bacterial species.

New quinazolinone-based Mannich bases: Synthesis and in vitro cytotoxic evaluation

This research presents the synthesis of new quinazolinone-based Mannich bases in good yields via a three-step procedure. The first step is the reaction of 6-hydroxyanthranilic acid 1 with an excess of acetic anhydride at 150°C for 2 h to afford benzoxazinone 2 in 87% yield. Compound 2 is then reacted with 4-aminophenol in DMSO at reflux for 7 h to give compound 3 in 75% yield. Finally, the reaction of 3 with paraformadehyde and secondary amines in ethanol affords new quinazolinone-based Mannich bases 4a-c and 5a-e in 55-70% yields. The structure of Mannich bases have been characterized by NMR and MS spectra. The bio-assay results show that some new Mannich bases exhibited weak to moderate cytotoxic activity against SKLu-1 and MCF-7 cell lines.

Discovery of diversified cassane diterpenoids as potent antibacterial agents from Caesaplinia pulcherrima and their mechanisms.

Natural products play a significant role in the development of novel bactericide candidates. Caesalpinia pulcherrima, a traditional medicine, had anti-inflammatory, antimicrobial, and antifeedant activities, therefore the previous bioassay results of C. pulcherrima implied that its main active ingredients may have potential to be used as botanical bactericides. Bio-guided isolation of C. pulcherrima was conducted to obtain 11 novel cassane diterpenoids (capulchemins A-K) and 10 known sesquiterpenes. Their structures were established by extensive spectroscopic methods and single-crystal X-ray diffraction analyses. Capulchemins A-F possess a rare aromatic C ring, while capulchemin K with a 15,16-degradative carbon skeleton represents a rare group of cassane diterpenes. Capulchemin A exhibited remarkable antibacterial activity against four phytopathogenic bacteria, particularly against Pseudomonas syringae pv. actinidae and Bacillus cereus, with minimal inhibitory concentration values of 3.13 μM. Meanwhile, capulchemin A showed significant control effect on kiwifruit canker in vivo. Further investigation of its mechanism of antibacterial activity revealed that compound 1 was closely related to destroy cell membrane to cause cell death. Additionally, some of those cassane diterpenoids showed potential antifeedant against Mythimna separate walker and Plutella xylostella. Consequently, capulchemin A could have the potential to be used as a template for the development for new eco-friendly NP-based bactericides. These data contribute to a better understanding of the antibacterial activity of cassane diterpenes. Cassane diterpenes have been discovered to be leading to broad application prospects in the development as novel botanical bactericides. © 2023 Society of Chemical Industry.

Volatiles produced by symbiotic yeasts improve trap catches of Carpophilus davidsoni (Coleoptera: Nitidulidae): an important pest of stone fruits in Australia.

Carpophilus davidsoni (Dobson) is an important pest of Australian stone fruit. Current management practices for this beetle include the use of a trap that contains an attractant lure comprised of aggregation pheromones and a 'co-attractant' mixture of volatiles from fruit juice fermented using Baker's yeast, Saccharomyces cerevisiae (Hansen). We explored whether volatiles from yeasts Pichia kluyveri (Bedford) and Hanseniaspora guilliermondii (Pijper), which are closely associated with C. davidsoni in nature, might improve the effectiveness of the co-attractant. Field trials using live yeast cultures revealed that P. kluyveri trapped higher numbers of C. davidsoni compared to H. guilliermondii, and comparative GC-MS of volatile emissions of the two yeasts led to the selection of isoamyl acetate and 2-phenylethyl acetate for further investigation. In subsequent field trials, trap catches of C. davidsoni were significantly increased when 2-phenylethyl acetate was added to the co-attractant, compared to when isoamyl acetate was added, or both isoamyl acetate and 2-phenylethyl acetate. We also tested different concentrations of ethyl acetate in the co-attractant (the only ester in the original lure) and found contrasting results in cage bioassays and field trails. Our study demonstrates how exploring volatile emissions from microbes that are ecologically associated with insect pests can result in more potent lures for use in integrated pest management strategies. Results from laboratory bioassays screening volatile compounds should be treated with caution when making inferences regarding attraction under field conditions.

Interlaboratory Study to Evaluate a Testing Protocol for the Safety of Food Packaging Coatings.

According to European regulations, migration from food packaging must be safe. However, currently, there is no consensus on how to evaluate its safety, especially for non-intentionally added substances (NIAS). The intensive and laborious approach, involving identification and then quantification of all migrating substances followed by a toxicological evaluation, is not practical or feasible. In alignment with the International Life Sciences Institute (ILSI) and the European Union (EU) guidelines on packaging materials, efforts are focused on combining data from analytics, bioassays and in silico toxicology approaches for the risk assessment of packaging materials. Advancement of non-targeted screening approaches using both analytical methods and in vitro bioassays is key. A protocol was developed for the chemical and biological screening of migrants from coated metal packaging materials. This protocol includes guidance on sample preparation, migrant simulation, chemical analysis using liquid chromatography (LC-MS) and validated bioassays covering endocrine activity, genotoxicity and metabolism-related targets. An inter-laboratory study was set-up to evaluate the consistency in biological activity and analytical results generated between three independent laboratories applying the developed protocol and guidance. Coated packaging metal panels were used in this case study. In general, the inter-laboratory chemical analysis and bioassay results displayed acceptable consistency between laboratories, but technical differences led to different data interpretations (e.g., cytotoxicity, cell passages, chemical analysis). The study observations with the greatest impact on the quality of the data and ultimately resulting in discrepancies in the results are given and suggestions for improvement of the protocol are made (e.g., sample preparation, chemical analysis approaches). Finally, there was agreement on the need for an aligned protocol to be utilized by qualified laboratories for chemical and biological analyses, following best practices and guidance for packaging safety assessment of intentionally added substances (IAS) and NIAS to avoid inconsistency in data and the final interpretation.

Anthranilic Diamides Containing Monofluoroalkene Amide Linkers as Potential Insect RyR Activators: Design, Synthesis, Bio-evaluation, and Computational Study.

In order to develop anthranilic diamides with novel chemotypes, a series of anthranilic diamides with acrylamide linkers were designed and synthesized. The results of preliminary bioassays indicated that compounds with a monofluoroalkene amide linker (Z-isomer) exhibited good larvicidal activity against lepidopteran pests. The LC50 values of compound A23 against Mythimna separata and Plutella xylostella were 1.44 and 3.48 mg·L-1, respectively, while those of chlorantraniliprole were 0.08 and 0.06 mg·L-1, respectively. Compound A23 also exhibited the same level of lethal potency against resistant and susceptible strains of Spodoptera frugiperda at 50 mg·L-1. Compound A23 exhibited similar symptoms as chlorantraniliprole in test larvae. Comparative molecular field analysis was conducted to demonstrate the structure-activity relationship. Central neuron calcium imaging experiments indicated that monofluoroalkene compounds were potential ryanodine receptor (RyR) activators and activated calcium channels in both the endoplasmic reticulum and the cell membrane. Molecular docking suggested that A23 had a better binding potency to P. xylostella RyR than chlorantraniliprole. The MM|GBSA dG bind value of A23 with P. xylostella RyR was 117.611 kcal·mol-1. Monofluoroalkene was introduced into anthranilic diamide insecticides for the first time and brought a novel chemotype for insect RyR activators. The feasibility of fluoroalkenes as insecticide fragments was explored.

A novel flavonoid and other constituents from Rubus rosifolius S.Vidal (Rosaceae)

Various reports revealed that chemical constituents from many species of Rubus exhibit diverse biological activities. In this study, a novel flavonoid with a 2-(phenanthren-9-yl)-4H-chromen-4-one structure (1), a 5-phenylthiophene-2-carbaldehyde derivative (5) first isolated from a natural source, together with five known compounds including three polyketides (2–4) and two sesquiterpenoids (6–7) were isolated from a traditional Chinese medicine Rubus rosifolius S.Vidal (Rosaceae). The structures of new compounds were elucidated by detailed spectroscopic analysis including NMR and X-ray single-crystal diffraction. The bioassays results indicated that, compound 1 displayed significant cytotoxicity against human colon cancer cell line HCT116 with IC50 value of 8.6 ± 1.9 μM, and compound 5 exhibited moderate cytotoxicity against human breast cancer cell line MDA-MB-435 with IC50 value of 24.1 ± 0.8 μM.

Dereplication of Gambierdiscusbalechii extract by LC-HRMS and in vitro assay: First description of a putative ciguatoxin and confirmation of 44-methylgambierone

Marine toxins have a significant impact on seafood resources and human health. Up to date, mainly based on bioassays results, two genera of toxic microalgae, Gambierdiscus and Fukuyoa have been hypothesized to produce a suite of biologically active compounds, including maitotoxins (MTXs) and ciguatoxins (CTXs) with the latter causing ciguatera poisoning (CP) in humans. The global ubiquity of these microalgae and their ability to produce (un-)known bioactive compounds, necessitates strategies for screening, identifying, and reducing the number of target algal species and compounds selected for structural elucidation. To accomplish this task, a dereplication process is necessary to screen and profile algal extracts, identify target compounds, and support the discovery of novel bioactive chemotypes. Herein, a dereplication strategy was applied to a crude extract of a G. balechii culture to investigate for bioactive compounds with relevance to CP using liquid chromatography-high resolution mass spectrometry, in vitro cell-based bioassay, and a combination thereof via a bioassay-guided micro-fractionation. Three biologically active fractions exhibiting CTX-like and MTX-like toxicity were identified. A naturally incurred fish extract (Sphyraena barracuda) was used for confirmation where standards were unavailable. Using this approach, a putative I/C-CTX congener in G. balechii was identified for the first time, 44-methylgambierone was confirmed at 8.6 pg cell−1, and MTX-like compounds were purported. This investigative approach can be applied towards other harmful algal species of interest. The identification of a microalgal species herein, G. balechii (VGO920) which was found capable of producing a putative I/C-CTX in culture is an impactful advancement for global CP research. The large-scale culturing of G. balechii could be used as a source of I/C-CTX reference material not yet commercially available, thus, fulfilling an analytical gap that currently hampers the routine determination of CTXs in various environmental and human health-relevant matrices.

Commiphora wildii Merxm. Essential Oil: Natural Heptane Source and Co-Product Valorization.

As an alternative to fossil volatile hydrocarbon solvents used nowadays in perfumery, investigation on essential oil of Commiphora wildii Merxm. oleo gum resin as a source of heptane is reported here. Heptane, representing up to 30 wt-% of this oleo gum resin, was successfully isolated from the C. wildii essential oil, using an innovative double distillation process. Isolated heptane was then used as a solvent in order to extract some noble plants of perfumery. It was found that extracts obtained with this solvent were more promising in terms of sensory analysis than those obtained from fossil-based heptane. In addition, in order to valorize the essential oil depleted from heptane, chemical composition of this oil was found to obtain, and potential biological activity properties were studied. A total of 172 different compounds were identified by GC-MS in the remaining oil. In vitro tests-including hyaluronidase, tyrosinase, antioxidant, elastase and lipoxygenase, as well as inhibitory tests against two yeasts and 21 bacterial strains commonly found on the skin-were carried out. Overall, bioassays results suggest this heptane-depleted essential oil is a promising active ingredient for cosmetic applications.

Design, synthesis and biological evaluation of novel phenylfuran-bisamide derivatives as P-glycoprotein inhibitors against multidrug resistance in MCF-7/ADR cell

The co-administration of anticancer drugs and P-glycoprotein (P-gp) inhibitors was a treatment strategy to surmount multidrug resistance (MDR) in anticancer chemotherapy. In this study, novel phenylfuran-bisamide derivatives were designed as P-gp inhibitors based on target-based drug design, and 31 novel compounds were synthesized and screened on MCF-7/ADR cells. The result of bioassay revealed that compound y12d exhibited low cytotoxicity and promising MDR reversal activity (IC50 = 0.0320 μM, reversal fold = 1163.0), 3.64-fold better than third-generation P-gp inhibitor tariquidar (IC50 = 0.1165 μM, reversal fold = 319.3). The results of Western blot and rhodamine 123 accumulation verified that compound y12d exhibited excellent MDR reversal activity by inhibiting the efflux function of P-gp but not expression. Furthermore, molecular docking showed that compound y12d bound to target P-gp by forming the double H-bond interactions with residue Gln 725. These results suggest that compound y12d might be a potential MDR reveal agent acting as a P-gp inhibitor in clinical therapeutics, and provide insight into design strategy and skeleton optimization for the development of P-gp inhibitors.

Design, Synthesis, and Insecticidal Activity of Novel Isoxazoline Compounds That Contain Meta-diamides against Fall Armyworm (Spodoptera frugiperda).

Fall armyworm (Spodoptera frugiperda) is a major migratory pest around the entire world that causes severe damage to agriculture. We designed and synthesized a series of novel isoxazoline derivatives based on the previously discovered active compound H13 to find new and effective candidates against S. frugiperda. Most of them showed excellent insecticidal activity. In addition, a three-dimensional quantitative structure-activity relationship model was established, and compound F32 was designed and synthesized based on the results. The bioassay result showed that compound F32 exhibited excellent activity against S. frugiperda (LC50 = 3.46 mg/L), which was substantially better than that of the positive control fipronil (LC50 = 78.8 mg/L). Furthermore, an insect γ-aminobutyric acid (GABA) enzyme-linked immunosorbent assay indicated that F32 can upregulate the content of GABA in insects in a manner similar to that of fipronil. Molecular docking showed that the hydrophobic effect and hydrogen-bond interactions are vital factors between the binding of F32 and receptors. All of these results suggest that compound F32 could be employed as a novel isoxazoline lead compound to control S. frugiperda.

First report of entomopathogenic fungi, Aspergillus tamarii (Eurotiales: Trichocomaceae) on Musca domestica (Diptera: Muscidae) larvae

A fungus isolated from mango wasp was found to be pathogenic to houseflies. The isolated fungus was identified as Aspergillus tamarii using morphological characteristics and by comparative nucleotide sequence analysis of ITS regions. Fragments covering the region encoding ITS-1, 5.8S rDNA, and ITS-2 were amplified using the universal primers, ITS1 (TCCGTAGGTGAACCTGCGG) and ITS2 (TCCTCCGCTTATTGATATGC). The results of bioassays against early second instar larva showed dose-dependent mortality. Larvicidal activity was carried out at eight different concentrations viz, 1x106, 1x107, 1x108, 2x106, 2x107, 2x108, 3x106, 3x107, and 3x108 spores/ml. Among the two different methods of bioassays, bait method showed highest mortality. Beauveria bassiana was used as a positive control. Tween 80 (0.05%) was used as negative control. Larval mortality commences from day 3 until pupation in both bait and immersion methods. The least LC50 value observed for bait method was 5.28x107 spores/ml followed by immersion method, 5.12x109 spores/ml. On the other hand, the larva treated with commercial fungal strain, Beauveria bassiana showed an LC50 value of 1.26x108 spores/ml and 1.32x108 spores/ml for bait and immersion methods, respectively. Visual observation of mycosis was noticed on treated larva. Treated larvae had extensive growth of fungal hyphae on the larval surface. Scanning Electron Microscopy studies of treated larvae clearly showed the process of fungal infection. Longitudinal section of the treated larva showed fungal hyphae on the haemocoel.

Design, Synthesis, and Insecticidal Evaluation of New Benzoylureas Containing Carbamate Groups Based on the Bipartite Model of Sulfonylurea Receptor Binding Site

Background: Benzoylureas are the most commonly used chitin synthesis inhibitors. But, the exact target site of benzoylurea insecticides has not been identified. Objective: To study whether benzoylphenylureas analogues with a bipartite model could be designed and synthesized as novel insecticides with improved activities. Methods: Based on the bipartite model of the sulfonylurea receptor binding site and commercial diflubenzuron, a series of novel benzoylureas containing carbamate groups were designed and synthesized via the key intermediate 2,6-difluoro-N-((4-hydroxyphenyl)carbamoyl)benzamide (2). The structures of the target compounds were confirmed by the 1H NMR and high-resolution mass spectrum (HRMS). Results: The results of bioassays indicated that these target compounds possessed good larvicidal activities against a broad spectrum of insects such as oriental armyworm (Mythimna Separata Walker), diamondback moth (Plutella xylostella), and mosquito (Culex pipiens pallens). A compound containing N, N-diisopropyl (3g) exhibited the highest insecticidal activity against oriental armyworm (40% at 10 mg kg-1), which was comparable with that of diflubenzuron. These compounds also had good larvicidal activities against diamondback moth and mosquito; most of these target compounds exhibited comparable larvicidal activities of diamondback moth with diflubenzuron and higher larvicidal activities of mosquito than diflubenzuron. Conclusion: The experimental data above preliminarily proved the rationality of our speculation and design ideology, and BPUs analogues with a bipartite model could improve the interaction with the target.

Screening of Effective Insecticides Against Diaghania Pyloalis in Mulberry Fields

In recent years, with the rapid development of the sericulture industry, the pests of mulberry trees are also increasing. Diaghania pyloalis Walker is one of the main pests of mulberry trees, has strong fecundity and very large food intake, especially in Sichuan and Chongqing areas. In order to find out the insecticides which can effectively control D. pyloalis, the screening test of high-efficiency control efficacy was carried out. In the summer of 2020, the 3rd instar larvae of D. pyloalis were selected as the test objects, and the indoor bioassay of 10 insecticides on D. pyloalis was carried out, and the results of the indoor bioassay were tested by field experiments in the autumn. The results show that 2000 times liquid of Dursban, Spinetoram, Chlorantraniliprole, and 1000 times liquid of Dichlorvos and Phoxim had the best control effect on D. pyloalis. Secondly, 2000 times liquid of Imidacloprid and Chlorfenapyr had the better control effect on D. pyloalis. Finally 2000 times liquid of Pymetrozine and Cyromazine had poor control effect, and 1000 times liquid of Azadirachtin had the worst control effect on D. pyloalis. To control D. pyloalis, 2000 dilution of Dursban and Spinetoram, and 1000 times liquid of Dichlorvos can be used in sericultural production. When using Chlorantraniliprole to control D. pyloalis, the leaves of mulberry should be picked with long interval to avoid affecting the quality of cocoons, and it is not recommended to use Cyromazine, Azadirachtin to control D. pyloalis.

Antioxidant activity, phytotoxicity and allelopathic potential of green walnut (Juglans regia L.) fruit extract

The potential allelopathic effect of a green walnut fruit extract on seed germination and early growth of three weed species (Chenopodium album, Amaranthus retroflexus, Daucus carota) was tested, as well as its phytotoxic effect on seed germination and early growth of maize (Zea mays). Another objective was to analyze the plant extract and assess its antioxidative activity. Antioxidative activity of the plant extract was evaluated based on its ability to neutralize DPPH (2,2-diphenyl-1-picrylhydrazyl) radical and capacity for iron reduction using the FRAP method. Inhibition of the evaluated parameters (total germination and seedling length) decreased proportionally with decreasing concentrations of extract solution of green walnut fruit. The parameters of seedling growth were also found to show greater susceptibility than total seed germination of all three of the tested weed species. Although the seed bioassay results indicated a high inhibitory effect on germination and early growth of the tested weeds, they also revealed phytotoxic activity during early growth of the cultivated Z. mays.