Restriction Fragment Length Patterns Research Articles

Genetic Predisposition to Type II Diabetes in the Hispanic Population of Orange County in Relation to SNP rs1333051 on the CDKN2 Gene

Thirty‐four million individuals cope with diabetes within the United States, 95 percent of which have Type II Diabetes (T2D). Hispanics are particularly affected by diabetes and being the largest minority in the U.S., it is a significant public health issue. Since there is a diverse genetic variation between different ethnicities, researchers study genes through single nucleotide polymorphism (SNPs) to determine an individual's risk of developing T2D. The SNP rs1333051 located on the CDKN2 gene correlates with T2D. Evidence shows a nucleotide change of A allele by T allele. The allele A is also reported to be associated with coronary heart disease in T2D patients. The project’s primary goal is to find the prevalence of SNP rs133051 in 24 controls and 23 diabetic patients in the Hispanic population of Orange County. DNA was extracted, taken from a buccal swab sample, and subjected to a polymerase chain reaction (PCR), followed by gel electrophoresis to confirm PCR products. Enzymatic digestion was done using Bsrl to detect the alleles based on restriction fragment length patterns. The alleles A and T were identified in both groups. However, the allele T was predominant in the diabetic group. External factors possibly play a larger role than genetic factors. To know more about the association of the T allele, increasing the number of samples and applying statistical analysis is necessary. The overall knowledge in the identification of SNPs associated with T2D allows for preventative measures to be taken within the Hispanic population at risk for this disease.

Prevalence of Rs149483638 SNP on the IGF2 Gene and Its Correlation with Type 2 Diabetes in Hispanic Populations

Overall, American adults have a 10.5% risk of having diabetes during theirlifetime but for the Hispanic American adult, the risk is over 12.5% comparedto 7.5% in non-Hispanic whites. Hispanic Americans are a mixed groupcomprising of Mexicans, Cubans, Puerto Ricans, South and Central Americans,and other Spanish communities. This disease is very damaging and a challengeto manage for anyone. It is the seventh-largest cause of death in the UnitedStates in 2017. Detecting single nucleotide polymorphism (SNPs), in thehuman genome can help in determining an individual's risk of obtaining type 2diabetes. Recent studies with SNP rs149483638 have shown that the IGF2gene is associated with the identification of insulin that regulates growth andmetabolism in the human body. IGF2 is found in many tissues where it issynthesized and released into the periphery, with the highest levels in theliver. IGF2 facilitates ß-cell proliferation and survival in the pancreas. Thealleles shown in this SNP is the C>T allele change. The goal of this research wasto detect the prevalence of SNP rs149483638 by buccal swab samples in 25controls and 26 patients. DNA extraction followed by PCR and restrictionfragment length pattern using the BstNI enzyme was used to detect theprevalence of this SNP and its association with Diabetes. We found the allele C& T very predominant in the diabetes group. The allele C was also found in thecontrol group. We need to increase the sample size in the control group inorder to assess the risk of this SNP in diabetes type 2.

Identification of four Thunnus tuna species using mitochondrial cytochrome b gene sequence and PCR-RFLP analysis

Sequence analysis and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique were used to identify the species of Thunnus thynnus, T. alalunga, T. obesus and T. albacares. Genetic variation of 376bp fragments in mitochondrial cytochrome b gene of 4 Thunnus species captured from northern Pacific Ocean, northern Atlantic Ocean and Indian Ocean was analyzed. The restriction enzymes and restriction fragment length pattern in each Thunnus species were obtained. It was found that the 376bp fragment of cytochrome b gene in T. obesus showed the obvious divergence of 4.235% different from other 3 species. The highest interspecific similarity ranged 98.687~99.674% between T. thynnus and T. alalunga. PCR-RFLP by using 3 specific restriction enzymes Bsp1286, Hinc Ⅱ and Rsa Ⅰ could precisely and quickly identify the species of the 4 common Thunnus species. Furthermore, this technique successfully detected the species of 12 samples of commercial tuna fillets (sashimi).

Molecular markers of anti-malarial drug resistance in southwest Ethiopia over time: regional surveillance from 2006 to 2013.

BackgroundDrug resistance is one of the main reasons of anti-malarial treatment failures and impedes malaria containment strategies. As single nucleotide polymorphisms (SNPs) have been found to correlate with anti-malarial drug resistance, the surveillance strategy includes continuous monitoring of known molecular markers and detection of new mutation patterns. With the introduction of artemisinin-based combination therapy, selection of specific patterns has been observed worldwide.MethodsFrom March to June 2013, whole blood was collected on filter paper from microscopically malaria positive patients in Jimma zone (District), southwestern Ethiopia. Plasmodium falciparum, Plasmodium vivax and mixed infections were included. SNPs were investigated by conventional or real-time PCR, restriction fragment length pattern analysis or sequencing. Results were compared to molecular patterns from Ethiopian isolates in 2004, 2006 and 2008/9.ResultsPlasmodium falciparum, P. vivax, and mixed infections were molecularly confirmed in 177, 80, and 14 samples, respectively. In P. falciparum, mutations in the pfcrt, pfmdr 1and pfATP 6 (SERCA) gene were investigated. Whereas the mutation in the pfcrt gene at codon 76 K was still found in 95.6 % of all samples, the pfmdr 1 86 T mutation fell to 1.2 % (2/163) in 2013 compared to 9 % in 2008/9 and 86 % in 2006 (P <0.001). The pfmdr 1 184 F mutation dominated with 100.0 % (172/172) in 2013. Sequencing of the recently reported PF3D7_1343700 kelch propeller domain showed no mutation at codon 476. First sequencing data of the pvmdr 1 gene from Jimma region revealed a prevalence of the mutations 976 F and 1076 L in 72.7 % (16/23) and 100.0 % (19/19) of the isolates, respectively.ConclusionSince the introduction of artemether-lumefantrine (AL) in Jimma, Ethiopia, in 2006, the prevalence of certain SNPs associated with AL use has increased. Markers for chloroquine resistance in P. vivax were highly frequent. Continuous molecular and clinical surveillance are of paramount importance.Electronic supplementary materialThe online version of this article (doi:10.1186/s12936-015-0723-2) contains supplementary material, which is available to authorized users.

First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan.

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) 'Tainung No. 1' is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5'TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3'/5'CGCAGTTT CTGGAGGATATTAAG3'/5'TCGCATGCCACTTCCTCAGT3') were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia.

Highly Acidic C-Terminal Region of Cytomegalovirus pUL96 Determines Its Functions during Virus Maturation Independently of a Direct pp150 Interaction

Tegument proteins pp150 and pUL96 function at a late step in cytomegalovirus (CMV) maturation. Here, we show that pp150 interacts directly with pUL96; however, the N-terminal region of pp150 and the C-terminal region of pUL96, which are critical for these proteins to function, are not required for this interaction. Moreover, the largely dispensable C-terminal region of pp150 is critical for pp150-pUL96 interaction. To further study the role of pUL96, several point and clustered mutations were engineered into the CMV Towne bacterial artificial chromosome (Towne-BAC) genome, replacing the conserved negatively charged C-terminal residues of pUL96. Although individual point mutations (E122A, D124A, and D125A) reduced virus growth slightly, the clustered mutations of 122EVDDAV127 significantly reduced virus growth, produced small syncytial plaque phenotypes, and impacted a late stage of virus maturation. When the UL96 C-terminal alanine conversion mutant (B6-BAC) virus was serially passaged in cell culture, it gained a plaque size comparable to that of Towne-BAC, displayed an altered restriction fragment length pattern, and replicated with increased growth kinetics. Whole-genome sequencing of this passaged virus (UL96P10) and the similarly passaged Towne-BAC virus revealed major differences only in the RNA4.9 and UL96 regions. When one of the mutations in the UL96 coding region was engineered into the B6-BAC virus, it significantly increased the plaque size and rescued the virus growth rate. Thus, accumulation of compensatory mutations only in UL96 in this revertant and the specific involvement of functionally dispensable regions of pp150 in the pUL96-pp150 interaction point toward a role for pUL96 in virus maturation that does not depend upon pp150. Human cytomegalovirus causes significant medical problems in newborns, as well as in people with low immunity. In this study, we investigated the functions of two essential virus proteins, pp150 and pUL96, and determined the impact of their mutual interaction on virus replication. These studies provide valuable information that is critical for the development of targeted antiviral therapies.

An up-date on the differentiation of Brachyspira species from pigs with nox-PCR-based restriction fragment length polymorphism

Different Brachyspira (B.) species colonize the porcine intestinal tract, some of which are pathogens of significant clinical and economic importance.In 2002 we published a novel molecular method for differentiation of Brachyspira species from pigs based on the amplification of the nox-gene and the generation of species-specific restriction patterns (nox-RFLP) using the enzymes BfmI and DpnII (Rohde et al., 2002). We applied this method for identification in addition to biochemical testing in doubtful cases until 2008. Since 2009 we have used it as the first line method of identification. The current study documents the results of examining 2050 Brachyspira isolates collected from January 2009 to December 2011. In addition to identifying isolates with previously described patterns, four novel restriction fragment length patterns were observed, and isolates with these patterns could be assigned to the species B. intermedia and the B. innocens/murdochii complex on the basis of their phenotypic properties and by nox-sequence analysis.In 2007 a potentially new Brachyspira species, “B. suanatina”, was described in Swedish pigs (Råsbäck et al., 2007). From the published nox-gene sequence it could be expected that this Brachypira species should show a new restriction pattern making nox-RFLP a suitable technique for identification of “B. suanatina”. In this study the new restriction fragment length pattern could be demonstrated in one of the strains described by Råsbäck et al. (AN4859/03). Nevertheless, no isolates with this new pattern corresponding to “B. suanatina” were identified amongst the 2050 Brachyspira isolates examined from northern Germany.

Allele and Genotype Frequencies ofCYP2C9Within an Iranian Population (Mazandaran)

Cytochrome P450 2C9 (CYP2C9) is a polymorphic enzyme responsible for the metabolism of different drugs, some with low therapeutic index. The frequency of functionally important mutations and alleles of the gene coding for CYP2C9 shows wide ethnic variations. The present study aimed to determine the prevalence of the most common allelic variants of the CYP2C9 enzyme and to predict the genotype frequency in the Mazandarani ethnic group among the Iranian population. Genotyping of CYP2C9 allelic variants was carried out in 103 unrelated subjects by polymerase chain reaction and restriction fragment length pattern analysis. The frequencies for CYP2C9 alleles *1, *2, and *3 were 78%, 12%, and 10%, respectively. No subjects were found carrying the CYP2C19*11 allele. The frequencies of CYP2C9 genotypes *1/*1, *1/*2, *1/*3, *2/*2, *2/*3, and *3/*3 were 61%, 19%, 16%, 1.5%, 2.5%, and 0.0%, respectively. The result of the present study showed that the two inactive alleles of CYP2C9 accounted for 22% of CYP2C9 alleles in our sample versus 1.5%-29% reported in other populations. The frequencies of the studied alleles resulted in significant differences between our sample and African and Eastern Asian populations.

Phylogenetic relationships of Phytophthora andina, a new species from the highlands of Ecuador that is closely related to the Irish potato famine pathogen Phytophthora infestans

Phylogenetic relationships of Phytophthora infestans sensu lato in the Andean highlands of South America were examined. Three clonal lineages (US-1, EC-1, EC-3) and one heterogeneous lineage (EC-2) were found in association with different host species in genus Solanum. The EC-2 lineage includes two mitochondrial (mtDNA) haplotypes, Ia and Ic. Isolates of P. infestans sensu lato EC-2 fit the morphological description of P. infestans but are different from any genotypes of P. infestans described to date. All isolates of P. infestans sensu lato from Ecuador were amplified by a P. infestans specific primer (PINF), and restriction fragment length patterns were identical in isolates amplified with ITS primers 4 and 5. The EC-1 clonal lineage of P. infestans sensu lato from S. andreanum, S. columbianum, S. paucijugum, S. phureja, S. regularifolium, S. tuberosum and S. tuquerense was confirmed to be P. infestans based on sequences of the cytochrome oxidase I (cox I) gene and intron 1 of ras gene. The EC-2 isolates with the Ic haplotype formed a distinct branch in the same clade with P. infestans and P. mirabilis, P. phaseoli and P. ipomoeae for both cox I and ras intron 1 phylogenies and were identified as the newly described species P. andina. Ras intron 1 sequence data suggests that P. andina might have arisen via hybridization between P. infestans and P. mirabilis.

Identification of cyanobacteria by polymorphisms of PCR-amplified ribosomal DNA spacer region

Abstract The 16S-23S ribosomal DNA spacer region of selected cyanobacterial strains was amplified by the polymerase chain reaction using primers to conserved flanking sequences. Single or multiple rDNA amplification products were generated depending on the strain and primer pair. Species could generally be distinguished on the basis of size heterogeneity of the products. Analysis of restriction digests of the amplified rDNAs indicated polymorphisms useful in identification. Four enzymes ( Hin fI, Dde I, Alu I, Taq I) generated restriction fragment length patterns that could discriminate between the cyanobacteria to the taxonomic levels of genus and species. This approach should prove useful in the rapid identification of cyanobacteria.

Comparison of ectomycorrhizas of Quercus garryana (Fagaceae) on serpentine and non‐serpentine soils in southwestern Oregon

The diversity of ectomycorrhizal communities associated with Quercus garryana on and off serpentine soils was compared and related to landscape-level diversity. Serpentine soils are high in magnesium, iron, and heavy metals and low in fertility. In plant communities on serpentine soils, a high proportion of flowering plant species are endemic. At three sites with paired serpentine and nonserpentine soils in southwestern Oregon, we sampled Q. garryana roots and categorized ectomycorrhizas by morphotyping and by restriction fragment length patterns. Ectomycorrhizas were abundant at all sites; no single fungal species dominated in the ectomycorrhizas. Of 74 fungal species characterized by morphotype and pattern of restriction fragment length polymorphisms, 46 occurred on serpentine soils, and 32 were unique to serpentine soil. These species are potentially endemic to serpentine soil. Similarities in species composition between paired serpentine and nonserpentine soils were not significantly lower than among three serpentine sites or among three nonserpentine sites. We conclude that mycorrhizal communities associated with oaks on serpentine soil do not differ in species richness or species evenness from those on neighboring nonserpentine soil.

Molecular identification of Campylobacter concisus.

A 1.6-kb DNA fragment isolated from a Campylobacter concisus genomic library gave C. concisus-specific restriction fragment length patterns when it was used as a probe in hybridization studies. All of the strains tested, including type strains and clinical isolates, contained a 0.5-kb HindIII fragment that hybridized to the probe. DNA sequencing of the 1.6-kb fragment identified three open reading frames (ORFs). One of the ORFs encodes the carboxy terminus of GyrB, and the translational products of ORF2 and ORF3 showed similarity to hypothetical proteins, previously identified in Campylobacter jejuni. DNA-DNA hybridization studies with a fragment internal to ORF3 showed that this sequence was responsible for the signal observed with the 0.5-kb HindIII fragment. A rapid PCR assay was developed and evaluated. Primers that annealed to the extremities of the 1.6-kb fragment were used to obtain an amplicon of the correct size from both reference and clinical strains of C. concisus.

Frequency of cytochrome P450 2C9 mutant alleles in a Korean population.

To determine the frequencies of CYP2C9 variants in the Korean population and compare them with the frequencies in other ethnic populations. Genotyping of CYP2C9*2 and CYP2C9*3 allelic variants was carried out in 574 Korean subjects by PCR and restriction fragment length pattern analysis. Thirteen of 574 subjects (2.3%) were heterozygous for CYP2C9*3 (Ile359Leu), but no subjects with a CYP2C9*2 allele or homozygous for CYP2C9*3 were identified. The allele frequency of CYP2C9*3 in Korean subjects (0.0113, 95% CI 0.0066-0.0193) was similar to that of other East Asian populations, but was considerably lower than that of Caucasian populations. CYP2C9*3 seems to be an allelic variant related to the functional polymorphism of CYP2C9, but this variant is rarely seen among Koreans compared with Caucasians. Routine genotyping of the CYP2C9*2 allele is considered to be unnecessary in Korean and East Asians, because this allele appears to be extremely rare or absent in these populations.

A novel multiresistant Streptococcus pneumoniae serogroup 19 clone from Washington State identified by pulsed-field gel electrophoresis and restriction fragment length patterns.

In 1997, a cluster of multiresistant invasive serogroup 19 pneumococcus infections, including two fatalities, was reported in Washington State. Further investigation identified other cases. Fourteen Washington Streptococcus pneumoniae isolates, four from Alaska, and eight isolates from eastern Canada with reduced penicillin susceptibility (MIC of > or =1 microg/ml) were included in the study. Pulsed-field gel electrophoresis (PFGE) with ApaI, SacII, and SmaI restriction enzymes and IS1167 and mef restriction fragment length polymorphism (RFLP) pattern analysis were performed. Twenty of the 26 isolates had identical or related PFGE patterns, with two or all three enzymes, and identical or related IS1167 RFLP patterns, indicating that they were genetically related. These 20 isolates contained the mef gene conferring erythromycin resistance and had identical mef RFLP patterns. The PFGE and RFLP patterns were distinct from those of six multiresistant clones previously described and suggest that a new multiresistant clone has appeared in Washington, Alaska, and eastern Canada. This newly characterized clone should be included in the Pneumococcal Molecular Epidemiology Network.

Influence of Viral Load and Alanine Aminotransferase on Viral Genetic Heterogeneity in Patients with Chronic Hepatitis C Virus Infection

Background/Aim: Hepatitis C virus (HCV) populations in vivo consist of genetically different heterogeneous mixtures defined as ‘quasispecies’, which vary in the hypervariable region 1 (HVR1) mostly. To further address the role of quasispecies diversity in hepatitis C infection, this study aimed to evaluate the influence of ALT, viral load and genotypes on quasispecies heterogeneity in patients with HCV infection. Methods: Thirty-six chronic hepatitis C patients with high levels of alanine aminotransferase (ALT) were studied. None of them received any antiviral therapy. HCV RNA serum levels, genotype and genetic heterogeneity were determined by branched-chain DNA assay, restriction fragment length patterns and RT-PCR single-strand conformational polymorphism analysis of HVR1, respectively. Results: Twenty-eight patients had genotype 1b (28/36; 78%), 6 patients had genotype 1a (6/36; 17%), 1 patient was 2a (1/36; 3%) and genotype could not be determined in 1 patient. The patients were categorized into two groups according to the number of bands representing the dominant strains in the circulation: group A with 2 bands having 1 strain (14/36 patients; 39%) and group B with more than 2 bands indicating more than 1 strain (22/36 patients; 61%). The serum viremia and ALT levels for these groups were 11 ± 8.8 and 5.3 ± 4.6 mEq/ml (p < 0.05), and 79 ± 20, and 127 ± 80 IU/l (p < 0.05), respectively. Conclusion: The results of this study suggest that hepatitis C patients having 1 dominant strain in the circulation may show a relatively weaker immune response resulting in lower ALT and higher viremia levels, whereas patients with high degrees of virus quasispecies diversity have higher ALT levels and a more active immune response causing the selection of new genome variants and depressing viral replication partly.

Correlation between genotype and phenotype of the human arylamine N-acetyltransferase type 1 (NAT1).

Arylamine N-acetyltransferase 1 (NAT1) conjugates several aromatic amines and their N-hydroxylated metabolites by N- or O-acetylation. NAT1 genotype and phenotype is known to be variable in human populations. In this study, we set out to measure the functional relevance of the frequent NAT1 gene variants for the activity in human red blood cells. Healthy German volunteers (N = 314) were genotyped for NAT1 alleles *3, *4, *10, *11, *14, and *15 using polymerase chain reactions and restriction fragment length pattern analysis, and NAT1 enzyme kinetic parameters were measured in a subset of 105 individuals using p-aminobenzoic acid as specific substrate. There was no functional difference between NAT1 alleles *4 and *10. In particular, there was no trend of increasing activity from NAT1*4/*4 to *4/*10 and *10/*10. Carriers of the NAT1 *11 and *14 alleles had a statistically significant lower enzyme activity compared with carriers of the *3, *4, or *10 alleles. Compared with the wild-type genotype NAT1*4/*4, activity of the NAT1*11/*11, NAT1*11/*10, and NAT1*11/*4 genotypes was reduced by 20.7%, 35.7%, and 31.5%, respectively. Activity of the NAT1*10/*14 and NAT1*4/*14 genotypes was reduced by 49.8% and 55.6%, respectively. The difference in NAT1 activity between the *4/*11 and *4/*14 genotypes was also significant (P < 0.01). The carrier of the NAT1*15/*15 genotype had no detectable enzyme activity. In conclusion, functional consequences of NAT1 mutations were tested in a large population. Activity in carriers of NAT1 alleles *3, *4, and *10 did not differ, alleles NAT1*11 and *14 appeared to be low activity alleles, and allele NAT1*15 had no activity.

Frequency of cytochrome P450 CYP2C9 variants in a Turkish population and functional relevance for phenytoin.

The genetically polymorphic cytochrome P450 enzyme CYP2C9 metabolizes many important drugs. We studied the frequency of the amino acid variants cysteine144 (CYP2C9*2 ) and leucine359 (CYP2C9*3 ) in a Turkish population and the correlation between genotype and phenotype using phenytoin as probe drug. CYP2C9 alleles *2 and *3 were measured in 499 unrelated Turkish subjects by PCR and restriction fragment length pattern analysis. Phenotyping was performed in a subgroup of 101 volunteers with a single oral dose of 300 mg phenytoin and concentration analysis in serum drawn 12 h after dosage. CYP2C9 allele frequencies in 499 unrelated Turkish subjects were 0.794 for CYP2C9*1, 0.106 for CYP2C9*2 and 0. 100 for CYP2C9*3. Mean phenytoin serum concentrations at 12 h after dosage were 4.16 mg l-1 (95% CI 3.86-4.46) in carriers of the genotype CYP2C9*1/1, 5.52 mg l-1 (4.66-6.39) in CYP2C9*1/2, and 5.65 mg l-1 (4.86-6.43) in CYP2C9*1/3. These differences were significant and accounted for 31% of total variability in phenytoin trough levels. Mean 12 h concentration ratios of 5-(para-hydroxyphenyl)-5-phenylhydantoin/phenytoin (p-HPPH/P) were 0. 43 (0.39-0.47) for CYP2C9*1/1 compared with 0.26 (0.21-0.31) for CYP2C9*1/2, 0.14 (0.13-0.14) for CYP2C9*2/2, 0.21 (0.18-0.24) for CYP2C9*1/3, and 0.02 for CYP2C9*3/3; all mutant genotypes were significantly different compared with CYP2C9*1/1. Frequency of the two CYP2C9 variants in Turkish subjects was in a similar range as in other Caucasian populations. A significant proportion of the interindividual variability in phenytoin trough levels is explained by the genotypes. The 12 h serum concentrations after a single phenytoin dose may be used for routine phenotyping of CYP2C9 mediated metabolic clearance and the p-HPPH/P ratios may be even more sensitive indicators of CYP2C9 activity.

Gliricidia Little Leaf Disease in Costa Rica.

Gliricidia sepium is a multipurpose, legume tree species native to Central America and Mexico with wide social and economic importance. Gliricidia little leaf disease (GLLD) is associated with infection by a phytoplasma and is manifested by one or more symptoms, including leaflet yellowing, leaflet size reduction, shortened internodes, and shoot proliferation, often leading to branch die-back or death of young trees. Trees with symptoms were seen in fences and natural stands in the Nicoya Peninsular and on road sides west of San Jose, Costa Rica. Shoot samples were collected from eight symptom-bearing trees in different locations and from two healthy-looking trees in the southeast where no GLLD symptoms were observed. DNA from each sample was used as template in polymerase chain reaction (PCR) with universal phytoplasma rRNA gene primers P1 and P7 (1). DNA from a GLLD-infected tree from Honduras, and a pigeon pea witches'-broom infected Cajanus cajan from Florida, served as positive controls, while DNA from healthy G. sepium and C. cajan seedlings were used as negative controls. A 1.8-kb PCR product, indicative of presence of phytoplasma DNA, was amplified from all symptom-bearing tree samples and positive control DNAs, but not from DNA from the apparently healthy trees or seedlings. Restriction fragment length pattern analysis of PCR products with a range of endonucleases showed no difference between the Honduran and Costa Rican phytoplasma isolates. The distribution and symptom types observed in Costa Rica suggest that GLLD has recently arrived from Nicaragua and is spreading southeast. Reference: (1) L. Kenyon et al. Plant Pathol. 47:671, 1998.

Note: Serologic and genomic relatedness of group XIV spiroplasma isolates from a lampyrid beetle and tabanid flies: an ecologic paradox

Spiroplasma group XIV strain EC-1T and other isolates from the lampyrid beetle Ellychnia corrusca form a serogroup with tabanid spiroplasma strains (TC-1 and TS-1). It was hypothesized that similarities among these strains reflect a transmission cycle in which lampyrid beetles serve as overwintering hosts and tabanid adults become infected and transmit a homogeneous population of spiroplasma strains during spring, summer and autumn. In the present study, variations in restriction fragment length patterns suggest the presence of multiple genovars. Genotypic analysis may therefore be a companion to serology in elucidating spiroplasma diversity, and may provide clues to strain host range.

Identification of cyanobacteria by polymorphisms of PCR-amplified ribosomal DNA spacer region

The 16S-23S ribosomal DNA spacer region of selected cyanobacterial strains was amplified by the polymerase chain reaction using primers to conserved flanking sequences. Single or multiple rDNA amplification products were generated depending on the strain and primer pair. Species could generally be distinguished on the basis of size heterogeneity of the products. Analysis of restriction digests of the amplified rDNAs indicated polymorphisms useful in identification. Four enzymes ( HinfI, DdeI, AluI, TaqI) generated restriction fragment length patterns that could discriminate between the cyanobacteria to the taxonomic levels of genus and species. This approach should prove useful in the rapid identification of cyanobacteria.