Resistant Mycobacterium Tuberculosis Isolates Research Articles

Discordant results between Xpert MTB/RIF assay and Bactec MGIT 960 culture system regarding the detection of rifampin-resistant Mycobacterium tuberculosis isolates in Wenzhou, China.

This study aimed to assess the possible causes of discordant results between Xpert MTB/RIF (Xpert) and Bactec MGIT 960 Culture System (MGIT960) regarding rifampicin (RIF) susceptibility in Mycobacterium tuberculosis. Patients with previous RIF-resistant tuberculosis who were admitted to Wenzhou Central Hospital from January 2020 to December 2022 were enrolled. The isolates obtained from these patients were subjected to RIF susceptibility tests using Xpert and MGIT960, and the minimum inhibitory concentration (MIC) of RIF was determined by the MYCOTB MIC plate test. Additionally, molecular docking and molecular dynamics (MD) simulations were performed to evaluate the binding efficacy of rpoB and RIF based on rpoB mutations detected in the isolates with discordant RIF susceptibility results. A total of 28 isolates with discordant RIF susceptibility test results were detected, 15 of them were RIF susceptible with MICs ≤ 0.5 µg/mL. Twelve out of 15 isolates contained borderline RIF resistance-associated mutations [L430P (n = 6), H445N (n = 6)], 1 isolate had D435Y and Q429H double mutation, and the remaining 2 isolates had a silent (Q432Q) mutation. Compared with the affinity of RIF toward the wild type (WT) (-45.83 kcal/mol) by MD, its affinity toward L452P (-55.52 kcal/mol), D435Y (-47.39 kcal/mol), L430P (approximately -69.72 kcal/mol), H445N (-49.53 kcal/mol), and Q429H (-55.67 kcal/mol) increased. Borderline RIF resistance-associated mutations were the main cause for the discordant RIF susceptibility results between Xpert and MGIT960, and the mechanisms of the resistance need further investigated.IMPORTANCEThis study is aimed at assessing discordant results between Xpert MTB/RIF (Xpert) assay and Bactec MGIT 960 Culture System (MGIT960) regarding the detection of rifampicin (RIF)-resistant Mycobacterium tuberculosis isolates in Wenzhou, China. The discordant results of RIF between these two assays were mainly caused by borderline RIF resistance-associated mutations, subsequently by silent mutations of rpoB. Borderline RIF resistance- associated mutations detected in our study were demonstrated to not be affected by the affinity of rpoB and RIF by molecular dynamics, and the mechanism of resistance was needed to be clarified. For the discordant results of RIF by Xpert and MGIT960 that occurred, rpoB DNA sequencing was recommended to investigate its association with resistance to RIF.

Novel mutation in efflux pump Rv1258c (Tap) gene in drug resistant clinical isolates of Mycobacterium tuberculosis in Iran.

Tuberculosis (TB) remains a serious public health problem worldwide. Drug-resistant TB is considered a major and growing global threat. Despite the great variety of described mutations in Mycobacterium tuberculosis (MTB) resistance genes, the mechanisms of drug resistance are still controversial. Recently, a report on the role of efflux pump genes in drug resistance added to this complexity. Therefore, a thorough understanding of efflux pump genes in drug-resistant TB clinical isolates is needed. We performed molecular analysis of the efflux pump gene (Rv1258c) in 33 drug-resistant and 20 drug-sensitive clinical MTB isolates by sequencing the amplicons' targets in both the forward and reverse directions. A novel mutation of the Rv1258c gene was identified at G442A (Ala148Thr) in rifampicin mono-resistant clinical strain, as compared to the H37Rv reference strain. In addition, a cytosine nucleotide insertion was found between the positions 580 and 581 (denominated Tap580) in two drug-sensitive strains at identical gene positions. These results indicated the possibility of mutation in the efflux pump genes and the important role of Tap efflux pump genes in drug-resistant MTB isolates. However, further research is required to determine the direct association of these mutations with resistant MTB.

A precision overview of genomic resistance screening in Ecuadorian isolates of Mycobacterium tuberculosis using web-based bioinformatics tools.

Tuberculosis (TB) is among the deadliest diseases worldwide, and its impact is mainly due to the continuous emergence of resistant isolates during treatment due to the laborious process of resistance diagnosis, nonadherence to treatment and circulation of previously resistant isolates of Mycobacterium tuberculosis. In this study, we evaluated the performance and functionalities of web-based tools, including Mykrobe, TB-profiler, PhyResSE, KvarQ, and SAM-TB, for detecting resistance in 88 Ecuadorian isolates of Mycobacterium tuberculosis drug susceptibility tested previously. Statistical analysis was used to determine the correlation between genomic and phenotypic analysis. Our results showed that with the exception of KvarQ, all tools had the highest correlation with the conventional drug susceptibility test (DST) for global resistance detection (98% agreement and 0.941 Cohen's kappa), while SAM-TB, PhyResSE, TB-profiler and Mykrobe had better correlations with DST for first-line drug analysis individually. We also identified that in our study, only 50% of mutations characterized by the web-based tools in the rpoB, katG, embB, pncA, gyrA and rrs regions were canonical and included in the World Health Organization (WHO) catalogue. Our findings suggest that SAM-TB, PhyResSE, TB-profiler and Mykrobe were efficient in determining canonical resistance-related mutations, but more analysis is needed to improve second-line detection. Improving surveillance programs using whole-genome sequencing tools for first-line drugs, MDR-TB and XDR-TB is essential to understand the molecular epidemiology of TB in Ecuador. Tuberculosis, an infectious disease caused by Mycobacterium tuberculosis, most commonly affects the lungs and is often spread through the air when infected people cough, sneeze, or spit. However, despite the existence of effective drug treatment, patient adherence, long duration of treatment, and late diagnosis have reduced the effectiveness of therapy and increased drug resistance. The increase in resistant cases, added to the impact of the COVID-19 pandemic, has highlighted the importance of implementing efficient and timely diagnostic methodologies worldwide. The significance of our research is in evaluating and identifying a more efficient and user-friendly web-based tool to characterize resistance in Mycobacterium tuberculosis by whole-genome sequencing, which will allow more routine application to improve TB strain surveillance programs locally.

Isoniazid Resistance Level and Associated Resistance Conferring-mutations in Rifampicin Resistant Mycobacterium tuberculosis

Background: Multidrug resistant tuberculosis (MDR-TB) is a global public health problem causing treatment failure. Rifampicin (RIF) resistance has been used as a surrogate marker for MDR-TB diagnosis, but level of isoniazid (INH) resistance and associated resistance conferring mutations for INH in rifampicin-resistant TB cases are little known. Objective: The objective of this study was to determine level of isoniazid resistance and associated resistance conferring mutations in rifampicin resistant Mycobacterium tuberculosis (MTB) in sputum samples. Methods: A total 53 RIF resistant MTB isolates in sputum, detected by Xpert-MTB RIF assay were enrolled in the study. Culture positive samples were tested by BACTEC MGIT 960 system and level of isoniazid resistance was determined, defined as minimum inhibitory concentration of INH of >0.4 µg/mL and 0.1-0.4 µg/mL as high level and low level INH resistance respectively. Distribution of mutation in katG (codon 315) and inhA promoter (-5, -8, -15 and -16) genes by Real-time PCR among the different degrees of INH resistance was investigated. Results: Among the growth positive isolates, 68.8% of the resistant isolates had high level INH resistance, where katG was found to be the prominent mutation, with or without combined with inhA mutation. Positive predictive value (PPV) of katG mutation was 84.6% in detecting a high level of INH resistance. Low level resistance was present in 31.3% isolates, conferring mutation in inhA and katG in equal percentage (40%), but no detectable mutations were found in 20% low level INH resistant MTB isolates. The PPV of inhA mutation was 33.3% in detection low level resistance. Conclusion: Most of the INH resistant isolates conferred high level resistance and were associated with katG mutation. Evaluation of level INH resistance before using high dose INH will help to avoid dose dependent toxicity and to determine an appropriate treatment regimen. Bangladesh Medical Res Counc Bull 2023; 49(2): 120-125

Pattern of InhA and KatG mutations in isoniazid mono resistant Mycobacterium tuberculosis isolates from Odisha

We conducted a retrospective analysis of the line probe assay (LPA) data during January to December 2019, from 8 districts of Odisha. The prevalence of Hr-TB (isoniazid resistance only) was 1.53% (50/3272) with a range of 0–3.4% in the 8 districts. Of the 50 Hr-TB strains, katG mutation and inhA mutations were seen in 74% (37/50) and 26% (13/50) strains respectively. S315T1 and C15T were common mutations in katG and inhA respectively. Since these mutations are closely related to high- or low degree resistance to INH, it has therapeutic implications.

Comparative genomics of drug-resistant strains of Mycobacterium tuberculosis in Ecuador

BackgroundTuberculosis is a serious infectious disease affecting millions of people. In spite of efforts to reduce the disease, increasing antibiotic resistance has contributed to persist in the top 10 causes of death worldwide. In fact, the increased cases of multi (MDR) and extreme drug resistance (XDR) worldwide remains the main challenge for tuberculosis control. Whole genome sequencing is a powerful tool for predicting drug resistance-related variants, studying lineages, tracking transmission, and defining outbreaks. This study presents the identification and characterization of resistant clinical isolates of Mycobacterium tuberculosis including a phylogenetic and molecular resistance profile study by sequencing the complete genome of 24 strains from different provinces of Ecuador.ResultsGenomic sequencing was used to identify the variants causing resistance. A total of 15/21 isolates were identified as MDR, 4/21 as pre-XDR and 2/21 as XDR, with three isolates discarded due to low quality; the main sub-lineage was LAM (61.9%) and Haarlem (19%) but clades X, T and S were identified. Of the six pre-XDR and XDR strains, it is noteworthy that five come from females; four come from the LAM sub-lineage and two correspond to the X-class sub-lineage. A core genome of 3,750 genes, distributed in 295 subsystems, was determined. Among these, 64 proteins related to virulence and implicated in the pathogenicity of M. tuberculosis and 66 possible pharmacological targets stand out.Most variants result in nonsynonymous amino acid changes and the most frequent genotypes were identified as conferring resistance to rifampicin, isoniazid, ethambutol, para-aminosalicylic acid and streptomycin. However, an increase in the resistance to fluoroquinolones was detected.ConclusionThis work shows for the first time the variability of circulating resistant strains between men and women in Ecuador, highlighting the usefulness of genomic sequencing for the identification of emerging resistance. In this regard, we found an increase in fluoroquinolone resistance. Further sampling effort is needed to determine the total variability and associations with the metadata obtained to generate better health policies.

Detection of Isoniazid and Rifampin Resistance in Mycobacterium tuberculosis Clinical Isolates from Sputum Samples by High-Resolution Melting Analysis.

The effective management of multidrug-resistant tuberculosis (MDR-TB) and the need for rapid and accurate screening of rifampin (RIF) and isoniazid (INH)-resistant Mycobacterium tuberculosis (Mtb) isolates are the most fundamental and difficult challenges facing the global TB control. The present study aimed to compare the diagnostic accuracy of high-resolution melting-curve analysis (HRMA) in comparison to multiplex allele-specific PCR (MAS-PCR) and xpert MTB/RIF as well as the conventional drug-susceptibility test (DST) and gene sequencing for the detection of INH and RIF resistance in the Mtb isolates. In the present study, a total of 431 Mtb isolates including 11 MDR (%2.55), 7 INH resistance (%1.62), two RIF resistance (%0.46), and 411 sensitive isolates were phenotypically confirmed. HRMA assay identified katG gene mutations and the mabA-inhA promoter region in 15 of 18 INH-resistant samples and rpoB gene mutations were successfully evaluated in 11 out of 13 RIF-resistant samples. The sensitivity and specificity of the HRMA method were 83.3% and 98.8% for INH and 84.6% and 99% for RIF, respectively. The most common mutation in RIF-resistance-determining region (RRDR) occurred at codon 531 (TCG → TTG)(84.6%) and then at codon 513 (CAA → GTA)(7.6%) and 526 (CAC → TAC) (7.6%), which resulted in the amino-acid changes. Also, 88.8% of INH-resistant samples had mutations in the katG gene and the mabA-inhA promoter region, of which the highest mutation occurred at codon 315 (AGC → ACC) of the katG gene. In conclusion, all these results indicated that the sensitivity and specificity of the HRM method were increased when the katG gene and the mabA-inhA promoter region were used as a target.

MGIT sensitivity testing and genotyping of drug resistant Mycobacterium tuberculosis isolates from Mizoram, Northeast India

PurposeTuberculosis, a crucial infectious disease is still a health concern globally. India is among the countries with high MDR-TB burden. Currently, sputum smear microscopy using Ziehl Neelsen stain and GeneXpert are the only diagnostic means in Mizoram. This study was done to characterize local tuberculosis strains circulating in Mizoram. MethodsSputum was cultured using MGIT 960 and DST was performed for Streptomycin, Isoniazid, Rifampicin, Ethambutol and Pyrazinamide. GeneXpert test was done simultaneously. DNA was extracted using Trueprep AUTO v2, molbio diagnostics. Antibiotic Resistance Genes and LSP were amplified and sequenced. ResultsSer315Thr was the most common mutation in katG among MDR-TB isolates. GeneXpert probes A and D drop out upon sequencing showed L511P, H526Q and H526L mutation. The L511P and H526Q mutations were seen in new and treated cases. Discrepancy between MGIT 960 and GeneXpert were observed. LSP-PCR revealed that Indo-Oceanic, East-African Indian, Euro-American and Beijing lineages were found in Mizoram. ConclusionThis study provides mutation information on the resistant genotypes detected with GeneXpert as well as MGIT 960. It also provides information on the lineages of Mycobacterium tuberculosis circulating in the state. Utilization of sequencing technologies is essential in diagnostic laboratories to rule out discrepant results and as a cautionary measure to prevent wrong diagnosis and treatment.

Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.

Rescue of susceptibility to second-line drugs in resistant clinical isolates of Mycobacterium tuberculosis.

Aim: Antibiotic resistance is one of the biggest threats to global health, and this study aimed better understand how the efflux pumps are related to this process in tuberculosis clinical isolates. Results: The combination of antibiotics plus efflux pumps (EP) inhibitors was able to restore the susceptibility of clinical isolates in 100% of aminoglycosides resistance and 33.3% of the fluoroquinolones resistance. The relative expression of EPgenes in pre-extensively drug-resistant isolates showed an increase of up to 1000-times. Conclusion: The rescue of susceptibility in the presence of EPinhibitors, the increased of activity and expression of the EPgenes alert that the inhibition of EPcan reduce the selection of resistant strains and improvetreatment.

DETECTION OF FLUOROQUINOLONE RESISTANCE IN MYCOBACTERIUM TUBERCULOSIS ISOLATE CAUSED BY MUTATION IN THE GYRA GENE

Drug-resistant tuberculosis is a public health concern. TB that is drug-resistant to rifampin and isoniazid is known as MDR-TB, whereas XDR-TB is MDR-TB that is also resistant to second-line medicines, such as fluoroquinolones (levofloxacin, ofloxacin, and moxifloxacin). rifampin-resistant tuberculosis (RR-TB), of which 78 percent had multidrug-resistant tuberculosis (MDR-TB) (MDR-TB). Fluoroquinolones are a class of broad-spectrum antimicrobials that have become increasingly popular in recent years. Fluoroquinolones have activity against Mycobacterium tuberculosis both in vitro and in vivo. Fluoroquinolones might cause resistance if they are used inappropriately or excessively. According to several investigations, the majority of fluoroquinolone-resistant M. tuberculosis isolates (approximately 50-90 percent) had mutations in the gyrA gene QRDR Quinolone Resistance Determination Region. However, the genetic involvement of various gyrA gene mutations in resistant Mycobacterium TB isolates against fluoroquinolone resistance remains an unknown gyrA gene mutation pattern in resistant Mycobacterium tuberculosis isolates. In the previous investigation, mutations in the gyrA gene were discovered at codons 90 and 94.

Characterization of embB mutations involved in ethambutol resistance in multi-drug resistant Mycobacterium tuberculosis isolates in Zambia

BackgroundEthambutol (EMB) is an important anti-tuberculosis drug used in the management of multi-drug resistant tuberculosis (MDR-TB). Mutations in embB are the major mechanism of resistance. This study investigated embB mutations among MDR-TB isolates and analyzed their correlations with phenotypic drug susceptibility testing (DST) in Zambia. MethodA total of 132 MDR-TB isolates were collected from January 2014 to April 2017 and characterized using MGIT 960 systems, embB sequencing, and spoligotyping. ResultsOut of 61 phenotypically EMB resistant isolates, 53 had mutations in embB. Among the 71 EMB susceptible isolates, 47 had embB mutations. Sensitivity of embB mutations was 86.9% while specificity was 33.8%. CAS1_Kili (SIT21) had high odds of having embB mutations, particularly, G918A (Met306eIl) (Odds ratio 16.7, p < 0.0001). ConclusionMolecular EMB resistance testing by DNA sequencing can improve detection of EMB resistance among MDR-TB patients in Zambia. Additionally, CAS1_Kili was associated with embB amino acid substitution Met306Ile suggesting transmission. A detailed investigation to track and determine transmission hotspot area for MDR-TB could help optimize control strategies.

The evaluation of second line drug susceptibilities and molecular epidemiological profiles of multidrug resistance Mycobacterium tuberculosis isolates isoleted from different region of Turkey

Introduction: This study was planned to determine the second line drug resistance and molecular epidemiological profiles of multidrug resistant Mycobacterium tuberculosis isolates isolated from different geographical regions of Turkey.&#x0D; Material and Method: In our study, 63 MDR M. tuberculosis isolates were evaluated for the drug susceptibility sent from different tuberculosis laboratories of Turkey. Secondary antituberculosis drugs resistance was evaluated by indirect proportion method. Epidemiological origins were evaluated by using IS6110-RFLP and spoligotyping methods. &#x0D; Results: Cycloserine, ethionamide, capreomycin, thiacetozone, ofloxacin, kanamsin and paraaminosalicylic acid resistance rates were 15.87%, 19.04%, 7.93%, 6.34%, 11.11%, 12.69% and 6.34.%, respectively. According to spoligotyping results, 11 different patterns were obtained, including 52 isolates consisting of 5 clusters and 11 patterns consisting of a single isolate. When we compared our results with the spoligotype database in the world; 42 of 52 isolates forming 5 clusters were identified as predefined spoligotypes (LAM7-TUR, LAM9, T clade). 10 isolates showed the characteristics of the U spoligotype family. Of the 11 isolates that produced 11 different patterns, 8 were Haarlem and T spoligotypes. It was found that 2 isolates had the characteristics of Orphan and 1 isolate had the characteristics of BOV family. &#x0D; Conclusion: In our study, LAM7-TUR, LAM9, T clade spoligotype families are common in our country and in the world were determined.

Heterogeneous Streptomycin Resistance Level Among Mycobacterium tuberculosis Strains From the Same Transmission Cluster.

Widespread and frequent resistance to the second-line tuberculosis (TB) medicine streptomycin, suggests ongoing transmission of low fitness cost streptomycin resistance mutations. To investigate this hypothesis, we studied a cohort of 681 individuals from a TB epidemic in Portugal. Whole-genome sequencing (WGS) analyses were combined with phenotypic growth studies in culture media and in mouse bone marrow derived macrophages. Streptomycin resistance was the most frequent resistance in the cohort accounting for 82.7% (n = 67) of the resistant Mycobacterium tuberculosis isolates. WGS of 149 clinical isolates identified 13 transmission clusters, including three clusters containing only streptomycin resistant isolates. The biggest cluster was formed by eight streptomycin resistant isolates with a maximum of five pairwise single nucleotide polymorphisms of difference. Interestingly, despite their genetic similarity, these isolates displayed different resistance levels to streptomycin, as measured both in culture media and in infected mouse bone marrow derived macrophages. The genetic bases underlying this phenotype are a combination of mutations in gid and other genes. This study suggests that specific streptomycin resistance mutations were transmitted in the cohort, with the resistant isolates evolving at the cluster level to allow low-to-high streptomycin resistance levels without a significative fitness cost. This is relevant not only to better understand transmission of streptomycin resistance in a clinical setting dominated by Lineage 4 M. tuberculosis infections, but mainly because it opens new prospects for the investigation of selection and spread of drug resistance in general.

Comparison of toxin-antitoxin expression among drug-susceptible and drug-resistant clinical isolates of Mycobacterium tuberculosis.

Mycobacterium tuberculosis (MTB), the causative agent of tuberculosis (TB), is a significant global public health threat. Besides extensive multidrug resistance, MTB possesses several properties for long-term viability in the host as well as stress adaptation and resistance in harsh conditions. The role of toxin-antitoxin (TA) systems in disseminating and maintaining antimicrobial resistance in bacterial populations has also been demonstrated. This study aimed to evaluate differences in expression of MazEF (a well-known TA system) related genes (mazE3, mazF3, mazE6, and mazF6) amongst drug-susceptible and resistant MTB isolates in Iran. A total of 20 confirmed clinical isolates of MTB including 10 drug-susceptible and 10 drug-resistant (nine MDR, and one XDR) species were included in this study. M. tuberculosis H37Rv was used as the standard strain. RNA extraction, cDNA synthesis, and relative quantitative real-time PCR were performed according to the standard procedures. Our analysis indicated significant enhanced expression of the mazE6 antitoxin gene in drug-susceptible isolates compared to drug-resistant isolates and the standard strain. The expression of the mazF6 toxin gene was also increased in drug-susceptible isolates compared with the standard strain. In drug-resistant isolates, the expression levels of mazF3 and mazF6 genes were significantly higher than that in the susceptible isolates and the standard strain. In this study, there was significant overexpression of mazE6 in drug-susceptible isolates. As well, mazF3 and F6 were overexpressed in drug-resistant isolates when compared with the standard strain. The changes in expression levels of MazEF6 associated genes were greater than that of MazEF3 in both groups of isolates.

Genetic variability in multidrug-resistant Mycobacterium tuberculosis isolates from patients with pulmonary tuberculosis in North India

BackgroundInformation on the genetic variability of drug resistant isolates of Mycobacterium tuberculosis is of paramount importance to understand transmission dynamics of disease and to improve TB control strategies. Despite of largest number of multidrug-resistant (MDR) tuberculosis cases (1, 30,000; 27% of the global burden), strains responsible for the expansion or development of drug-resistant Mycobacterium tuberculosis infections have been poorly characterized in India. Present study was aimed to investigate the genetic diversity in MDR isolates of Mycobacterium tuberculosis in North India.ResultsSpacer oligonucleotide typing (spoligotyping) was performed on 293 clinical MDR isolates of Mycobacterium tuberculosis recovered from cases of pulmonary tuberculosis from North India. Spoligotyping identified 74 distinct spoligotype patterns. Comparison with an international spoligotype database (spoldb4 database) showed that 240 (81.91%) and 32 (10.92%) strains displayed known and shared type patterns, while 21 (7.16%) strains displayed unique spoligotype patterns. Among the phylogeographic lineages, lineage 3 (East African-Indian) was found most predominant lineage (n = 159, 66.25%), followed by lineage 2 (East Asian; n = 34, 14.16%), lineage 1 (Indo-Oceanic; n = 30, 12.50%) and lineage 4 (Euro American; n = 17, 7.08%). Overall, CAS1_DEL (60.41%; SITs 2585, 26, 2694, 309, 381, 428, 1401, 141, 25, 1327) was found most pre-dominant spoligotype pattern followed by Beijing (14.16%; SITs255, 260, 1941, 269) and EAI3_IND (5.00%; SITs 298, 338, 11). The demographic and clinical characteristics were not found significantly associated with genotypic lineages of MDR-M.tuberculosis isolates recovered from pulmonary TB patients of North India.ConclusionsPresent study reveals high genetic diversity among the Mycobacterium tuberculosis isolates and highlights that SIT141/CAS1_Del followed by SIT26/ Beijing lineage is the most common spoligotype responsible for the development and transmission of MDR-TB in North India. The high presence of shared type and unique spoligotype patterns of MDR strains indicates epidemiological significance of locally evolved strains in ongoing transmission of MDR-TB within this community which needs to be further monitored using robust molecular tools with high discriminatory power.

Small Animal Model of Post-chemotherapy Tuberculosis Relapse in the Setting of HIV Co-infection.

Tuberculosis relapse following drug treatment of active disease is an important global public health problem due to the poorer clinical outcomes and increased risk of drug resistance development. Concurrent infection with HIV, including in those receiving anti-retroviral therapy (ART), is an important risk factor for relapse and expansion of drug resistant Mycobacterium tuberculosis (Mtb) isolates. A greater understanding of the HIV-associated factors driving TB relapse is important for development of interventions that support immune containment and complement drug therapy. We employed the humanized mouse to develop a new model of post-chemotherapy TB relapse in the setting of HIV infection. Paucibacillary TB infection was observed following treatment with Rifampin and Isoniazid and subsequent infection with HIV-1 was associated with increased Mtb burden in the post-drug phase. Organized granulomas were observed during development of acute TB and appeared to resolve following TB drug therapy. At relapse, granulomatous pathology in the lung was infrequent and mycobacteria were most often observed in the interstitium and at sites of diffuse inflammation. Compared to animals with HIV mono-infection, higher viral replication was observed in the lung and liver, but not in the periphery, of animals with post-drug TB relapse. The results demonstrate a potential role for the humanized mouse as an experimental model of TB relapse in the setting of HIV. Long term, the model could facilitate discovery of disease mechanisms and development of clinical interventions.

Anti-tuberculosis activity of bio-active compounds from Lantana camara L., Euphorbia hirta L., Mukia maderaspatana (L.) M. Roem, and Abutilon indicum (L.)

IntroductionTuberculosis (TB) is a major cause of morbidity and mortality and deserves global attention to identify new effective drugs. The present in-vitro study is an attempt to explore the anti-TB potential of selected, commonly available, and well-known medicinal plants, namely, Lantana camara L., Euphorbia hirta L., Mukia maderaspatana (L.) M. Roem, and Abutilon indicum (L.) Sweet known to have proven antimicrobial activity. MethodsThe cold extraction procedure was adopted for preparing the methanolic crude extracts from the four selected medicinal plants.The anti-tuberculosis activity of methanolic crude extracts of the plants was tested against multi-drug resistant (MDR) clinical isolates of Mycobacterium tuberculosis (Mtb) and Mtb H37Rv using luciferase reporter phage (LRP) assay. The minimum inhibitory concentration (MIC) of the selected potent compounds was estimated using the broth dilution method. ResultsThe phytochemical and gas chromatography-mass spectrometry (GC–MS) analyses showed that phytocompounds that have been reported earlier exhibit anti-TB activity are abundant. The LRP assay revealed the heightened inhibitory activity of methanolic crude extracts and individual fractions against the tested clinical and laboratory Mtb strains. MICs of the selected plant fractions against Mtb strains were found to be in a range of 400–1600 μg/mL in which Mukia maderaspatana (L.) M. Roem showed the lowest MIC of 400 μg/mL and this was validated by two different methods. ConclusionThe four medicinal plants examined as potential sources for anti-TB drug formulations initially look promising. Further investigation combining these plants should be considered as they may provide the basis for developing future treatment for TB.

The burden of pre-extensively and extensively drug-resistant tuberculosis among MDR-TB patients in the Amhara region, Ethiopia.

BackgroundThe emergence of pre-extensively and extensively drug-resistant tuberculosis (Pre-XDR/XDR-TB) is the major hurdle for TB prevention and care programs especially in developing countries like Ethiopia. The less emphasis on universal access to laboratory techniques for the rapid diagnosis of TB and drug susceptibility testing (DST) makes the management of MDR-TB a challenge. Early detection of second line anti-TB drugs resistance is essential to reduce transmission of Pre-XDR/XDR-TB strains and adjusting the treatment regimen in MDR-TB.ObjectiveTo determine the prevalence and resistance pattern of Pre-XDR- and XDR-TB among MDR-TB patients in the Amhara region, Ethiopia.MethodsA cross sectional study was carried out in nine MDR-TB treatment centers in the Amhara region. Sputum samples were collected from all pulmonary rifampicin resistant (RR) or MDR-TB patients prior to anti-TB treatment. Lӧwenstein-Jensen (LJ) culture, Ziehl Neelsen (ZN) smear, MTBDRplus and MTBDRsl assays were performed according to the standard procedures. Data were analyzed using SPSS 20 software. Chi-square and/or Fishers exact test was employed.ResultsOverall, 6.3% of MDR-TB isolates were resistant to at least one second line drugs. Pre-XDR-TB and XDR-TB isolates accounted 5.7% and 0.6% respectively. Moreover, 3.4% were resistant to FQs and 3.4% were resistant to second line injectable drugs. All isolates were susceptible for low level kanamycin. Almost all pre-XDR-TB strains (90%) were previously treated with anti-TB drugs. Drug resistant Mycobacterium tuberculosis isolates were disproportionately distributed in districts of the Amhara region and the majorities were concentrated in urban areas.ConclusionsThe high proportion of MDR-TB patients resistant to at least one second line drug is alarming. Strengthening the laboratory facilities to monitor pre-XDR and XDR-TB patients is crucial. The TB programs need to give emphasis on the effective and rational use of second line drugs for newly diagnosed MDR-TB patients to prevent the emergence of pre-XDR/XDR-TB strains.

Resistance Sniffer: An online tool for prediction of drug resistance patterns of Mycobacterium tuberculosis isolates using next generation sequencing data

The effective control of multidrug resistant tuberculosis (MDR-TB) relies upon the timely diagnosis and correct treatment of all tuberculosis cases. Whole genome sequencing (WGS) has great potential as a method for the rapid diagnosis of drug resistant Mycobacterium tuberculosis (Mtb) isolates. This method overcomes most of the problems that are associated with current phenotypic drug susceptibility testing. However, the application of WGS in the clinical setting has been deterred by data complexities and skill requirements for implementing the technologies as well as clinical interpretation of the next generation sequencing (NGS) data. The proposed diagnostic application was drawn upon recent discoveries of patterns of Mtb clade-specific genetic polymorphisms associated with antibiotic resistance. A catalogue of genetic determinants of resistance to thirteen anti-TB drugs for each phylogenetic clade was created. A computational algorithm for the identification of states of diagnostic polymorphisms was implemented as an online software tool, Resistance Sniffer (http://resistance-sniffer.bi.up.ac.za/), and as a stand-alone software tool to predict drug resistance in Mtb isolates using complete or partial genome datasets in different file formats including raw Illumina fastq read files. The program was validated on sequenced Mtb isolates with data on antibiotic resistance trials available from GMTV database and from the TB Platform of South African Medical Research Council (SAMRC), Pretoria. The program proved to be suitable for probabilistic prediction of drug resistance profiles of individual strains and large sequence data sets.