Report Of Onion Yellow Dwarf Virus Research Articles

First Report of Onion Yellow Dwarf Virus on Shallot (Allium cepa var. aggregatum) in China

Allium species are economically important crops in the world. Viruses are among the most important pathogens affecting their yield, especially those belonging to the genera Potyvirus, Carlavirus, and Allexivirus (Katis et al. 2012). Members of the genus Potyvirus are usually the most abundant and cause most of the damage induced. Onion yellow dwarf virus (OYDV) and Leek yellow stripe virus (LYSV) are often found in almost all Allium-cultivating regions and cause significant yield losses worldwide (Katis et al. 2012; Milosevic et al. 2015). In May 2017, severe leaf twisting, yellowing, and plant stunting were observed on shallot (Allium cepa var. aggregatum) in Jilin and Heilongjiang provinces of China. The disease was found in 77% of fields of shallot (total 12,000 ha) in 2017 and 2018. A total of 29 symptomatic plants were collected and tested using double antibody sandwich (DAS)-ELISA kits (DSMZ, Braunschweig, Germany) for the presence of OYDV and LYSV and a triple antibody sandwich ELISA kit (DSMZ) for shallot latent virus (SLV). OYDV was detected in 24 out of 29 shallot samples, and all were negative for LYSV and SLV. The virus was mechanically transmitted from an ELISA-positive sample to 10 plants of shallot using 0.01 M phosphate buffer (pH 7). All 10 mechanically inoculated plants of shallot developed symptoms identical to those observed on the original host plants 21 days postinoculation. All 10 inoculated plants were DAS-ELISA positive for OYDV. Presence of OYDV in ELISA-positive shallot plants was further confirmed by reverse transcription polymerase chain reaction (RT-PCR). Total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany); reverse transcription and PCR were carried out with the PrimeScript II first Strand cDNA Synthesis Kit (Takara, Japan) and Premix Taq (Ex Taq version 2.0) (Takara, Japan). OYDV coat protein (CP) specific primer pair (U: GCCGGCCCAGGGGAGGATG; D: CATTCTGACTCCAAGCAGAG) designed to amplify the complete CP gene was used for amplification. All infected shallot plants yielded an amplicon of the expected size (774 bp), whereas no amplification products were obtained from healthy controls. The RT-PCR product derived from the isolate JL1-3 was sequenced after T vector ligation with a pMD18-T Vector Cloning Kit (Takara, Japan) and submitted to GenBank (accession no. KY347900). Pairwise comparison of the JL1-3 isolate CP sequence with other homologous sequences available in GenBank was conducted, and sequence analysis showed that CP gene of this Chinese isolate shared the highest nucleotide identity of 97 and 95% with the CP gene of OYDV isolates OYDV-AT and AC-41 (GenBank accession nos. JX433020 and Y11826) from Germany and Netherlands, respectively. To our knowledge, this is the first report of OYDV on shallot in China. Further investigation is necessary to prevent the spread of this pathogen to new locations and to new hosts (Naderi Saffar et al. 2013) in China.

FIRST REPORT OF ONION YELLOW DWARF VIRUS INFECTING

Onion (Allium cepa L., family Liliaceae) is one of the most important vegetable crops worldwide. Among all onion diseases, yellow dwarf disease caused by Onion yellow dwarf virus (OYDV) causes significant yield losses (Conci et al., 2003). OYDV (genus Potyvirus, family Potyviridae) is transmitted by aphids in a non-persistent manner and has a host range limited to Allium species and Narcissus. In July 2015, onions with irregular yellow striping, downward leaf curling, and plant stunting were observed in the Tungurahua province of Ecuador. Symptomatic (n=10) and healthy onion samples were screened by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with OYDV polyclonal antibodies (Agdia, USA). All symptomatic onion samples reacted positively to OYDV antibodies in DAS-ELISA. Total RNA was isolated from a single plant with Triazol (Sigma, USA) and used in RT-PCR to amplify a DNA fragment of ca. 350 bp with universal primers designed in the potyviral NIb domain (Zheng et al., 2008). The amplicon was sequenced and the sequence (329 bp, GenBank accession No. KT590400) was analysed by BLAST and compared with the corresponding sequence of OYDV isolates from different countries. The partial NIb gene sequence of isolate OYDV-Ecuador showed a 91.1% and 98.1% maximum identity at the nucleotide and amino acid levels with isolates from Germany ((JX433020) and Italy (KF623533), respectively. A phylogenetic tree constructed with MEGA version 4.1 showed that the OYDV isolate from Ecuador was closely related to isolates from Germany, Italy, Argentina (JX433019) and USA (NC005029), all forming one cluster, whereas isolates from India (FR873734), Poland (KF862691), Japan (AB000474), Egypt (KT225546) and South Korea (AY390253) formed a separate cluster. To the best of our knowledge, this is the first report of OYDV on onion in Ecuador.

FIRST REPORT OF ONION YELLOW DWARF VIRUS IN GARLIC FROM NIGERIA

Garlic (Allium sativum L.) is one of the most important culinary herbs in the world. Several viruses belonging to genera Potyvirus, Carlavirus, and Allexivirus are known to infect garlic (Dijk, 1994; Walkey and Antill, 1989). This study was undertaken to investigate the status of viral infection in Nigerian garlic. Ten garlic bulbs showing mild to severe mosaic symptoms each were collected in March of 2015 from two fields in Kano and Sokoto region of Nigeria. Direct antigen coated (DAC)-ELISA was performed with antisera to Onion yellow dwarf virus (OYDV) (Bioreba, Reinach, Switzerland). All the samples were positive for OYDV. To confirm the presence of OYDV, reverse transcription (RT)-PCR was performed using primers published earlier (Majumder and Baranwal, 2014) and total RNA extracted from 100 mg of leaves with the RNeasy Plant Mini kit (Qiagen, Germany) according to the manufacturer’s instructions. Expected amplicons of ca. 320 bp for OYDV were obtained from all the samples tested, indicating infection by OYDV. Direct sequencing of the PCR products produced 276 bp long nucleotide sequences with 87% identity with sequence of an OYDV isolate from leek in Vietnam (GenBank accession No. DQ925454.1). Sequence obtained from the Nigerian isolate was deposited in GenBank under accession number KU854388. To our knowledge, this is the first report of OYDV in garlic from Nigeria.

First Report of Onion yellow dwarf virus, Garlic common latent virus and Shallot latent virus on Garlic in Poland.

Garlic (Allium sativum L.) is vegetatively propagated and can be affected by a virus complex (1) consisting of two potyviruses, Onion yellow dwarf virus (OYDV) and Leek yellow stripe virus (LYSV), and two carlaviruses, Garlic common latent virus (GCLV) and Shallot latent virus (SLV) (2). OYDV, GCLV, and SLV are economically important viral pathogens of bulb garlic crops in many garlic-growing areas of the world. A general mosaic and yellowing of leaves of four garlic cultivars (Blanko, Harnaś, Jarus, and Mega) was observed in 11 garlic-production fields in the Lodz, Mazowieckie, Małopolska, and Pomorskie regions of Poland in July 2012. ELISA was carried out with extracts from 29 collected garlic leaf samples to detect OYDV, GCLV, and SLV using commercial antiserum (DSMZ, Braunschweig, Germany). Results indicated that 6 samples (20.7%) were infected with OYDV, 25 samples (86.2%) were infected with GCLV, and 23 samples (79.3%) were infected with SLV. The presence of these viruses in garlic leaf samples was confirmed by reverse transcription (RT)-PCR using total RNA extracted using the Spectrum Plant Total RNA kit (Sigma-Aldrich, Munich, Germany) and primers, designed in this study, specific to the whole coat protein gene of OYDV (OYDVF 5'-TAGGGTTGGATTATGATTTCTCGA-3' and OYDVR 5'-TAGTGGTACACCACATTTCGT-3'), GCLV (GCLVF 5'-TTATAGGGACGGCACAAAATCAATCA-3' and GCLVR 5'-AATAGCACTCCTAGAACAACCATT-3') and SLV (SLVF 5'-AATYATTTACAATCGTCCAGCTA-3' and SLVR 5'-ATAATATCAATCAAATMCACACAATT-3'). Amplicons of the expected size were obtained for each virus. The amplified products were purified and sequenced in both directions. Sequence information of the CP genes of 9 OYDV, 12 GCLV, and 7 SLV isolates has been submitted to NCBI-GenBank with accession numbers KF862683 to KF862710. Sequence analysis showed that the coat protein gene of OYDV shared 86% identity with the coat protein gene of OYDV isolate MS/SW1 from Australia (GenBank Accession No. HQ258894). Comparison of the coat protein gene sequences of Polish GCLV isolates with those available in GenBank showed 85 to 91% sequence identities. Multiple sequence alignment revealed 84% nucleotide identity between the Polish isolate of SLV and an SLV isolate from Chinese garlic (AF314147) formerly referred to as Garlic latent virus (3). To the best of our knowledge, this is the first report of OYDV, GCLV, and SLV in garlic plants in Poland. The accurate identification of viruses present in garlic plants will help to use the appropriate strategies to reduce viral incidence in garlic-growing areas.

First Report of Onion yellow dwarf virus and Leek yellow stripe virus in Garlic in Turkey.

Garlic (Allium sativum L.) is one of the most important Allium spp. plants that are widely cultivated throughout the world. A significant reduction in yield and quality due to virus infection is now a serious economic problem (1). In many cases, garlic plants are infected with a variety of viruses, but elimination of these viruses is difficult because this crop is propagated through bulbs. Potyviruses, carlaviruses, and allexiviruses have been detected in diseased garlic. Onion yellow dwarf virus (OYDV) and Leek Yellow Stripe Virus (LYSV), genus Potyvirus, family Potyviridae, are two important viral pathogens of garlic. Virus diseases of garlic are widespread in the world, causing serious damage to yields and quality of the crop. The East Mediterranean Region produces 14% of the garlic production of Turkey (110,000 t). A survey was done in garlic fields in Adana, Mersin, Kahramanmaras, Hatay, and Gaziantep provinces of Turkey where virus-like symptoms were noted in samples collected during the 2007-2008 growing season. Leaf and bulb samples were taken from 202 plants with leaf yellow stripe, mosaic, enations, and deformation or dwarfism symptoms. ELISA was performed with antibodies from Agdia (Elkhart, IN). Results indicated that 57 samples (28.2%) were infected with OYDV and 43 samples (21.2%) were infected with LYSV. In addition, 23 samples were determined to be infected by both viruses. All ELISA-positive samples and 10 ELISA-negative samples were analyzed by reverse transcription-PCR with primers 1OYDV-G (5' TTA CAT TCT AAT ACC AAG CA 3') and 2OYDV-G (5' GCA GGA GAT GGG GAG GAC GC 3') for the detection of OYDV and primers 1LYSV (5' TCA CTG CAT ATG CGC ACC AT 3') and 2LYSV (5' GCA CCA TAC AGT GAA TTG AG 3') for the detection of LYSV. These primers were previously reported to be specific for the coat protein genes of OYDV and LYSV, respectively (2). Products of the expected size (774 bp for OYDV and 1,020 bp for LYSV) were amplified only from the ELISA-positive samples of the respective viruses, confirming infections by OYDV and LYSV. To our knowledge, this is the first report of OYDV and LYSV in garlic in Turkey.

First Report of Onion yellow dwarf virus, Leek yellow stripe virus, and Garlic common latent virus in Garlic in Oregon.

A general mosaic and yellowing of leaves of three cultivars of garlic (Allium sativum L., Late, Early, and Germinador) were observed in two seed-production fields in Morrow County, OR in June 2005. Approximately 50% of plants within the 50-ha fields were symptomatic. With recent findings of Onion yellow dwarf virus (OYDV), Leek yellow stripe virus (LYSV), and Garlic common latent virus (GCLV) in Washington (2), 45 composite samples of 10 leaves each from symptomatic (mosaic and yellowing) and nonsymptomatic plants were analyzed with a GCLV-specific antiserum (Agdia Inc., Elkhart, IN). All samples of 'Germinador' were infected regardless of symptoms, whereas 6.7% of all 'Late' and 'Early' samples were positive. GCLV infection was verified by reverse transcription (RT)-PCR using primers specific to the coat protein gene of GCLV followed by cloning and sequencing of the cloned amplicon. To determine the presence of a potyvirus, all composite samples were also tested with a general potyvirus antiserum (Agdia) and all samples from symptomatic plants were found to be positive. Representative positive samples from each cultivar were then tested by RT-PCR using degenerate, potyvirus group specific primers (3), and an amplicon of the expected size was obtained. To confirm which potyvirus was present, amplicons were cloned and sequenced, and sequence comparisons indicated that the representative samples were infected with OYDV. All symptomatic samples from the three cultivars were positive for OYDV when tested by RT-PCR using primers specific to its coat protein gene (1). Additionally, 53.3 and 6.7% of 'Early' and 'Late' samples, respectively, were also positive when tested with LYSV-specific primers (4). LYSV infection was further verified through cloning and sequencing of the cloned amplicon. Because this garlic is grown for seed, studies are being initiated to determine if current season spread occurs and yields are reduced. To our knowledge, this is the first report of OYDV, LYSV, and GCLV in garlic in Oregon.