Report Of Bacterial Leaf Spot Research Articles

First report of bacterial leaf spot caused by Pseudomonas cichorii on Monstera adansonii in Hawai'i, USA.

Monstera adansonii is a popular ornamental house plant prized for its small size and unique leaf fenestrations. In Hawai'i, it is also sold as cut foliage (combined value ~$21K; USDA NASS 2019). In January 2022, yellow chlorotic lesions that progressed to greyish-black and, finally, to brown necrotic lesions were observed primarily along the margins of fenestrations on M. adansonii foliage at a plant nursery in Hilo, HI. All 100 variegated specimens in 4-inch pots were infected, exhibiting symptoms along the lighter yellowish-white margins. The green, unvariegated variety planted along a fence for cut foliage exhibited an infection rate of 10%. Symptomatic leaf tissue was disinfected for 1 minute in a 10% bleach solution. Tissue from the margins of leaf spots was subsequently dissected, soaked in sterile distilled water for 1 hour, and plated on Luria-Bertani (LB) agar. Plates contained nearly pure cream-colored bacterial colonies with undulate margins. Isolates were established from single colonies. One isolate (BCB001) was transferred to King's medium B (KMB) and culture fluorescence was observed under 365 nm UV light. Isolate BCB001, which was gram-negative, was identified as Pseudomonas cichorii based on the LOPAT scheme (Schaad et al. 2001). A partial 16S rRNA gene product (495 bp) using primers Y1/Y3 (Cruz et al. 2001) was sequenced and compared in GenBank (accession no. OQ875210) and was 100% identical to multiple accessions of P. cichorii in the NCBI database. Bacterial identity was further confirmed using the P. cichorii-specific primers Hrp1a/Hrp2a (Cottyn et al. 2011) to amplify and sequence a 790 bp fragment (accession no. OQ850761), which was identical to accession no. MH396007, a P. cichorii isolate recovered from Thai basil in Hawai'i. To prove pathogenicity, strain BCB001 was grown on LB agar for 48 h at 27°C and suspended in sterile water at 107-108 CFU/ml. Four healthy, 2-month-old unvariegated M. adansonii plants produced from cuttings were syringe inoculated following the protocol of Wang et al. (2022). Leaves were injected with sterile water using the same methods and acted as negative controls. Plants were placed in clear plastic bags and held at 24°C with 12 h light for 48 hours in a growth chamber, after which time the plants were removed from the bags and incubated under the same conditions for the remainder of the experiment. Leaf spots were not present on any of the control leaves or on noninjected leaves of the plants after five days of incubation. Grey to black, water-soaked leaf spots 0.84 - 15.24 mm in diameter were present on all injected leaves (96% of the injection sites) 2 days post-inoculation (DPI), which were identical to the original diseased samples. At 5 DPI, spots became dark brown to black with a yellow halo, and the affected tissue was completely collapsed. Bacterial colonies were consistently re-isolated from the lesion margins of inoculated plants and morphologically (LB and KMB) and molecularly (Hrp) identified as P. cichorii, thus fulfilling Koch's postulates. To the best of our knowledge, this is the first report of bacterial leaf spot caused by P. cichorii on M. adansonii in Hawai'i. Since M. adansonii is an ornamental plant that is prized for its leaves, leaf spots caused by P. cichorii can reduce the marketability of inventory. To avoid further spread, increasing plant spacing to improving airflow, decreasing the amount of watering, avoiding mist irrigation, and carefully removing and discarding diseased leaves are suggested.

First Report of Bacterial Leaf Spot on Muskmelon Caused by Pseudomonas syringae pv. syringae in China.

Muskmelon (Cucumis melo L.) is one of the most widely cultivated and economically important fruit crops in the world. In January 2023, muskmelon leaves of cultivar 'Sheng Gu' were observed with irregularly shaped spots in four nurseries in Wanxiang Village, Pudong District of Shanghai, China. Initial symptoms were irregular soaking on the leaves, which progressed to rotting and necrotic spots. The disease incidence of melon seedlings in different nurseries ranged from 10 to 25%. To isolate and identify the causal agent, the small pieces of lesion tissues (5×5 mm) from symptomatic leaves were sterilized in 75% ethanol for 30 s and rinsed three times with sterile water. Following that, tissues were crushed with sterile glass rod in a sterile 2.0 mL centrifuge tube containing 100 μl of sterile water. The suspension was serially diluted before being spread on Luria-Bertani (LB) medium. After 48 h of incubation at 28°C, the cream-colored bacterial colonies from the 10-4 dilution were tiny and purified by streaking on new LB plates. To confirm the species identity of the bacterial isolates, genomic DNA was extracted from four independent representative colonies from different diseased plants, and several conserved genes were amplified and sequenced, including the 16S rRNA gene with primers 27F/1492R, gyrB gene with primers gyrBFor2/gyrBRev2, and rpoD gene with primers rpoDFor2/rpoDRev2 (Lelliot et al. 1966; Murillo et al. 2011). The results showed that the four colonies were identical. Using BLAST analysis in GenBank, the 16S rDNA (accession no. OQ659765, 1,402 bp), the gyrB (accession no. OQ708618, 911 bp), and rpoD sequences (accession no. OQ708619, 798 bp) showed 99.86-100% homology with 99-100% coveage as the corresponding gene sequences in the P. syringae pv. syringae strain HS191 (accession no. CP006256.1). The bacterial isolate was designated as P. syringae pv. syringae strain PDTG. Phylogenetic tree analysis of 16S rDNA, gyrB and rpoD genes further verified that the bacteria isolate was in close proximity to P. syringae pv. syringae. Additionally, all four isolates were detected in PCR with P. syringae pv. syringae specific primers, PsyF/ PsyR (Borschinger et al. 2016; Guilbaud et al. 2016). Ten two weeks old healthy 'Sheng Gu' muskmelon seedlings were inoculated by spraying with a bacterial suspension of 108 CFU/ml, and ten additional healthy plants treated with sterilized water served as the control. The inoculated plants were maintained at 25°C and 75% relative humidity for 7 days in artificial climate room. Water-soaked rot, similar as those seen in the nurseries, appeared on leaves 7 days after inoculation (dai), while the leaves of control plants remained healthy. The bacteria were re-isolated from rot of inoculated leaves and confirmed as the original pathogen by PCR with the PsyF/ PsyR primers and the 16S rRNA gene sequences. To our knowledge, this is the first report of P. syringae pv. syringae causing bacterial leaf spot on muskmelon in China, and this report expands the host range of P. syringae pv. syringae.

First report of bacterial leaf spot on Hami melon caused by Pseudomonas aeruginosa in China.

Hami melon (Cucumis melon var. saccharinus) is an economically important crop all over the world. It is being extensively planted in greenhouse in the southwest part of Hainan province, China. A new bacterial leaf spot was observed in a 20 hm2 Hami melon plantation in Huangliu town, Ledong county, Hainan province, in January 2022. The incidence of the disease was approximately 5%. Symptoms were irregularly shaped, brown lesions with yellow haloes on mature leaves, and first appeared as small, dark-green, water-soaking spots. Specimens from the lesion margin were disinfected by submersion in 0.1% mercuric chloride for 1 min, then soaked with 75% alcohol for 30 s, and rinsed with sterilized distilled water. The tissues were then ground in 2 ml of sterile water and allowed to stand for 5min. The supernatant was streaked onto nutrient agar (NA) and incubated for 48h at 30°C. Colonies were round, smooth, colorless, nearly transparent, bead-shaped at first, and then became lightly blue. After being cultured for days on NA at 30℃, the bacteria can turn the media brown. Yellow green pigments (pyoverdin) that fluoresce under ultraviolet light could be produced by the isolates in the Luria Broth. The bacteria were gram-negative, rod shaped with a single polar flagellum, 0.4 to 1.1 × 1.4 to 3.4 µm. Its physiological and biochemical characteristics were as follows: positive for the oxidase, aerobic, arginine dihydrolase, gelatin liquefaction, denitrification, lipase, growth at 41℃, utilization of mannitol, and production of pyocyanin tests; negative for the hydrolysis of starch, levan formation, lecithinase, growth at 4℃, growth in media supplemented with 8.5% NaCl, and utilization of maltose, xylose, and ethylene glycol tests. The 16S rRNA (1,437 bp), gyrB (1,181 bp), and rpoB genes (1,510 bp) were amplified with 27F/1492R (Zhang et al. 2016）, UP-1s/UP-2sr（Hannula M，2007）, and rpoB-F/rpoB-R (Ogier, JC. et al., 2019) primer sets respectively. One of the 5 isolates collected was sequenced. A BLASTn search of GenBank revealed that the sequence of 16S rRNA gene (OQ918303) had 99.7% identity and 98% coverage comparing with the best hit Pseudomonas aeruginosa strain DSM 50071(NR_117678.1), and both gyrB (OR261077) and rpoB (OR261078) had 99.9% identity and over 98% coverage comparing with P. aeruginosa E90 (CP044006.1). A pathogenicity test was conducted by spraying a suspension of the bacteria (108 CFU/mL) onto 10 Hami melon seedlings with two true leaves. Controls were inoculated with sterile water. All inoculated plants were maintained at 28℃ with 80 to 85% relative humidity in a greenhouse. Dark-green, water soaking spots appeared on the cotyledon and stems of treated seedlings 3-5 days after inoculation, and dark green lesions with halos were observed on the true leaves at the same time. Symptoms did not occur on the control plants. The bacteria which were re-isolated from the inoculated plants were confirmed as P. aeruginosa based on the 16S rRNA gene sequence. The bacterium was not isolated from control plants. P. aeruginosa has been reported to cause disease on a variety of plants including tomato (Zhang et al., 2021), poplar (Liu, et al., 2019), ginseng (Gao et al., 2014), tinda (Mondal et al., 2012), onion (Abd-Alla et al., 2011), tobacco (Yu et al., 2008) and sweet basil (Walker et al., 2004). As far as we know, this is the first report of P. aeruginosa causing leaf spot on Hami melon in China.. This report will contribute to the recognition and diagnosis of the new disease for the Hami melon growers.

First Report of Bacterial Leaf Spot of Red Maple Caused by Pseudomonas syringae pv. syringae in Tennessee.

Red maple (Acer rubrum L.) is an economically important ornamental nursery plant grown for its aesthetic value. In May 2022, field and container-grown red maple 'October Glory' plants exhibited severe leaf spots in a commercial nursery in Warren Co., Tennessee. Leaf spots were brown-to-black color with a yellow halo (Fig. 1a). Disease severity was about 40% of leaf area and incidence was 60-70% of 10,000 plants. Symptomatic leaf tissues were surface sterilized with 0.525% sodium hypochlorite for 1 min and washed twice with sterilized water. Bacterial colonies, cream colored and circular with smooth margins, were obtained on King's B (KB) and nutrient agar media after 3 days of incubation at 28°C. Bacteria were gram-negative and fluorescent on KB under UV light. The biochemical and physiological test results were negative for cytochrome C oxidase, pectolytic activity on potato slices, and arginine dehydrolase, but positive for gelatin liquefaction, aesculin hydrolysis, and levan production. The BIOLOG test was positive for the utilization of D-galactose, D-galacturonic acid, D-galactonic acid lactone, D-gluconic acid, and was negative for the utilization of β-methyl-D-glucoside, N-acetyl-D-glucosamine, α-hydroxybutyric acid, D-glucose-6-phosphate, α-keto-butyric acid, and α-keto-glutaric acid. To confirm the bacterial identity, total genomic DNA was extracted using DNeasy PowerLyzer Microbial Kit directly from pure cultures (strains FBG1662 and FBG4230). The small subunit ribosomal RNA (16S rRNA), RNA polymerase sigma factor (rpoDp and rpoDs), citrate synthase (gltA), DNA gyrase (gyrB) genes were amplified and sequenced by primers 8F/1492R (Galkiewicz et al. 2008), rpoDpF/R, rpoDsF/R, gltAF/R, and gyrBF/R (Sarkar and Guttman 2004), respectively. The sequences of the two strains (GenBank accession nos. 16S: OP962145 and OP948281; rpoDp: OP998258 and OP957300; rpoDs: OP998259 and OP957299: gltA: OP998256 and OP957301; gyrB: OP998257 and OP957302) were >99% similar (100% coverage) to the complete genome of Pseudomonas syringae pv. syringae (CP026568) in the NCBI database. A phylogenetic analysis was performed and confirmed the identity using concatenated sequences of gltA, gyrB, rpoDp, rpoDs, and 16S of P. syringae pv. syringae and other closely related taxa retrieved from GenBank (Fig. 2). Based on morphological and molecular identification, both bacterial strains were identified as P. syringae pv. syringae. Pathogenicity test was conducted by spray inoculation of ten one-year-old red maple 'October Glory' with bacterial suspension (107 CFU/ml) using bacterial strain FBG4230. Ten plants were sprayed with sterilized water as control. All plants were covered with clear plastic for 24 h and incubated in a greenhouse at 21 to 23°C, 70%RH, 16-h photoperiod. At seven days after inoculation, brown-to-black leaf spots surrounded by yellow halo were developed on all inoculated plants (Fig. 1b), while the control plants remained symptomless. The bacterium was re-isolated from the inoculated plants and it was 100% identical to P. syringae pv. syringae using biochemical tests as well as sequence analysis. P. syringae has been reported pathogenic in red maple causing leaf spot in Oregon (Malvick and Moore, 1988). To our knowledge, this is the first report of bacterial leaf spot caused by P. syringae pv. syringae in red maple in Tennessee. Identification of this bacterial pathogen on red maple is crucial in developing timely management practices.

First Report of Bacterial Leaf Spot on Spinach (Spinacia oleracea) Caused by Pseudomonas sp. in South Carolina.

A large grower of Brassica leafy greens and spinach in South Carolina observed a severe outbreak of leaf spot on 150 hectares of spinach (Spinacia oleracea) in Orangeburg County, SC in 2013. The entire field was lost due to the outbreak. Symptoms appeared on 8-week old plants as tan to white necrotic spots with black centers, water-soaking and no discernable chlorotic borders. Lesions varied from 2 mm to 1 cm in diameter and often coalesced to cover >50% of the leaves. Symptomatic spinach plants cv. Vancouver were collected in 2013 from the field. Bacterial streaming was evident from the border of necrotic lesions under magnification. Lesion border regions were excised, surface-disinfested with 0.5% NaOCl, macerated in sterilized distilled water and streaked onto nutrient agar (NA) and Pseudomonas Agar F (PAF). Bacterial growth was observed on NA and PAF; several single colonies were selected and re-streaked onto PAF. Colonies fluoresced blue under UV light after 48 h at 28oC. Two of the strains were subjected to 16S rRNA sequencing (GenBank accessions OM983506 and OM983507) and Fatty Acid Methyl Ester (FAME) analysis (MIDI LABS, Newark, DE). FAME results had a best similarity index (0.788) to Pseudomonas cichorii/viridiflava. The 16S sequences were queried to Pseudomonas type-strains in GenBank resulting in best matches: P. ovata (99.23% identity with 99% coverage) and P. maditerranea (99.04% identity with 100% coverage). Additionally, sequences had 97.33% identity with 100% coverage as a P. cichorii type strain, and only 96.86% identity with 97% coverage as a P. viridiflava type strain. These two strains were tested for pathogenicity on the spinach cv. Vancouver. Bacteria were grown on PAF for 48 h, and a bacterial suspension was prepared with sterile distilled water with the addition of 0.001% Latron (Plant Health Technologies, Boise, ID) and adjusted to an optical density of 0.4 at OD600. Six-week-old plants (eight plants) were sprayed with the bacterial suspension to runoff, placed at 100% relative humidity for 72 h, and then put in a growth chamber at 25oC with a 12 h diurnal light cycle for 10 days. Eight plants of 'Vancouver' were sprayed with water and 0.001% Latron as controls. Both strains were pathogenic on 'Vancouver' and caused symptoms similar to those observed in the field. Symptoms were not observed on negative controls. The same bacterial colonies were recovered from the lesions on inoculated plants, fulfilling Koch's postulates. Comparative rep-PCR analysis using the BOXA1R primer (Versalovic et al. 1994) showed both strains had identical DNA-banding profiles. All identification methods used indicate that this is a different Pseudomonas species from the one reported on spinach in California by Koike et al (2002). The top producers of spinach in SC stopped large-scale production in 2014 as a result of this pathogen. In 2020, due to inability of processors to obtain sufficient quantities of spinach, SC growers again planted the crop. Growers experienced yield losses due to similar symptoms on the crop. BOX-PCR of isolated strains of bacteria from these plants showed a DNA banding pattern similar to the 2013 strains.

First Report of Bacterial Leaf Spot on Tobacco Caused by Pseudomonas psychrotolerans in China.

Tobacco (Nicotiana tabacum) is an economically important crop, and its productivity is challenged due to pathogen infection. In 2020 and 2021, a previously uncharacterized disease was observed on field grown tobacco (Variety NC102) in Zhucheng City, Shandong Province, China (119°7'14" E, 36°0'58" N), where tobacco has been grown for decades. The disease can be found throughout the growth period of tobacco and mainly occurred from fast growing period (about 13-16 leaves) to leaf maturity stage. In severely diseased areas, the incidence rate can reach 100%. The symptoms first began as chlorotic water stain like small spots, then the spots merged into larger irregular necrotic maculae around the chlorotic halos. Small pieces of symptomatic leaves from 10 different infected plants were collected for pathogen isolation. The small pieces of discolored leaves were surface sterilized with 75% ethanol for 40s and washed with sterile water for three times. The sterilized leaves were ground with a glass rod with 1mL sterile water, and 100 μL suspensions were spread on nutrient agar medium then incubated at 28oC for 48 hours. Yellow round colonies with undulating edges were showed up on nutrient agar medium 48 hours later. Three isolates were randomly picked up from each of the 10 plates for subsequent analysis. After purification and culture on nutrient agar plate, the 16S rRNA gene of the 30 isolates were amplified with primers 27F and 1492R and the amplicons were sequenced and analyzed by sequence alignment. The sequence alignment results showed that the 16S rRNA nucleotide identity of the 30 isolates were 100%. One typical isolate named ZC5 was selected for subsequent analysis, and the resulting 16S rRNA sequence was deposited at GenBank, NCBI under accession OK092624. The 16S rRNA sequence identity with those of P. psychrotolerans strain K3-2 (KY882083) and M3-1 (KY882120) were 100%, respectively. The phenotypic analysis by Biolog Gen Ⅲ indicated that the bacterial isolate (ZC5) showed highest similarity (98.3%) with strain Pseudomonas oryzihabitans. P. oryzihabitans and P. psychrotolerans have a high degree of homology in the phylogenetic relationship based on the phylogenetic analysis of three concatenated sequences of gyrB, rpoB and rpoD genes (Mulet et al. 2010). The gyrB (ON462356), rpoB (ON462355), rpoD (ON462357) gene of isolate ZC5were also amplified and sequenced by using primers gyrB-For/gyrB-Rev, rpoB-For/rpoB-Rev and rpoD-For/rpoD-Rev (Hauser et al. 2004), respectively. While P. psychrotolerans and P. oryzihabitans form the same clade in phylogenies, strains of P. psychrotolerans do form a unique sub-clade. Isolate ZC5 clustered more closely with the type strain of P. psychrotolerans LMG 21977 in the phylogenetic tree. Therefore, based on the concatenated sequences of three genes (gyrB, rpoB and rpoD), the isolate ZC5 was confirmed as P. psychrotolerans. Based on morphological, Biolog characteristics and phylogenetic analysis, the isolate was identified as P. psychrotolerans. The tobacco plants at fast growing stage were selected for pathogenicity tests. Pathogenicity tests were conducted by injecting 10 μL bacterial suspension (108cfu/mL) of ZC5 into tobacco leaves with a syringe. Sterile water was inoculated into the tobacco leaves in the same way as the control. Six plants were selected for pathogenicity tests each time and five leaves of each tobacco plant were inoculated, and the tests were repeated three times. To simulate disease conditions in the natural environment, the inoculated plants were moved outdoors. The average temperature was 32°C during the day and 20°C at night. To maintain humidity, the tobacco leaves were sprayed with water every two days. Symptoms appeared on the pathogen inoculated leaves seven days after inoculation, whereas the control treatment remained symptomless. The pathogens were reisolated from diseased leaves and identified as P. psychrotolerans based on morphological, molecular and phylogenetic analysis, which fulfilled Koch's postulates. To our knowledge, this is the first report of tobacco bacterial leaf spot caused by P. psychrotolerans.

First Report of Bacterial Leaf Spot of Ficus benghalensis Caused by Pseudomonas cichorii in Pakistan.

Ficus benghalensis L. belongs to the family Moraceae, native to Asia and commonly known as Banyan. It has been identified as an important medicinal tree due to its antioxidant, anti-diabetic, and anti-inflammatory properties (Singh et al., 2009; Thite et al., 2014). In March 2021, leaf spots were observed on Banyan trees in the Kharian forest zone, District Gujrat, Punjab Province, Pakistan. Initial symptoms on leaves were irregular, water-soaked, and light brown lesions. The lesions turned dark brown at the centre, and the margins gradually turned yellow. The average size of lesions was 12 to 20 × 8 to 13 mm. The lesions coalesced and produced necrotic areas on the leaf (Figure 1). Samples (n=34) were collected based on symptoms and infected leaf segments were excised into small pieces (10-20 mm), surface disinfected with 1% NaClO for 10 seconds and rinsed three times with sterilized distilled water (SDW). Ten pieces/sample were mashed and soaked in 1.5 ml SDW to obtain a suspension. Later, 10 µL of the suspension was streaked on Nutrient agar (NA) and King's B medium (KBM) and incubated for 72 h at 30°C. After 72 h bacterial colonies appeared on NA and KBM medium. Each colony was re-streaked for three times to obtain the purified colonies. Morphological and biochemical characteristics of isolated bacterial cultures were performed by following the method of Schaad et al. (2001). Bacterial colonies appeared pale yellow to creamy, smooth, and circular with undulated margins on both NA and KBM medium. The colonies produced a fluorescent blue colour on KBM under the UV light. Isolated bacterial cultures were positive for oxidase, negative for levan production and arginine dihydrolase. Based on these characteristics, the pathogen was identified as Pseudomonas species. For molecular identification, 16S rRNA and rpoB genes were amplified and sequenced using the following primers: 27F/1492R (Lane, 1991) and LAPS/LAPS27 (Ait Tayeb et al. 2005), respectively. All the isolates were identified as P. cichorii after BLASTn analysis. The sequences of isolate BLS-01 obtained in this study were deposited in GenBank with accession No. OK397593 for 16S rRNA and OK423684 for rpoB exhibiting 100 % similarity with P. cichorii Accession No. MK356431 for 16S rRNA and JQ267563 for rpoB. A pathogenicity test was performed on healthy Banyan seedlings to fulfil Koch's postulates. Leaves from seedling plants were inoculated with 3 mL of BLS-01 suspension (108 CFU/ml) by spraying the inoculum on leaves using a sterilized spray bottle. The leaves sprayed with sterilized distilled water served as control (Figure 2). The experiment was performed three times following the same protocol as described above. Symptoms that appeared on inoculated leaves after 7-10 days were similar to the symptoms observed on original infected Banyan tree leaves in the forest zone. Control leaves remained asymptomatic during the whole experiment. The pathogen from the artificial infected leaves was re-isolated and identified as P. cichorii based on morphological, biochemical, and molecular characteristics. To our knowledge, this is the first report of leaf spot of F. benghalensis caused by P. cichorii in Pakistan.

Pseudomonas cichorii causing leaf spot disease on Banxia (Pinellia ternata) in China.

Banxia (Pinellia ternata) is an important Chinese medicinal material in the family Araceae and is a widely grown herb in China. In September 2021, a leaf spot disease was observed on Banxia field, with an incidence rate of 35 to 40 % in a 4-ha field, in Zhongxiang City, Hubei Province of China. Symptoms were observed as yellow-white centers, water-soaked edges, irregular lesions, and gradually developed into a yellowish-brown center and a dark-brown edge. Necrotic spots gradually increased, leading to leaf chlorosis and plant death. Margins of leaf lesions were excised form diseased tissue and were plated on nutrient agar (NA) using serial dilution. Growth on NA was predominantly cream-colored circular bacterial colonies with undulated margins. Characterization of three randomly chosen bacterial isolates (JYB1, JYB7 and JYB8) suggests they are Gram-negative, levan negative, arginine dihydrolase negative, oxidase positive, potato soft rot positive, and tobacco hypersensitive positive. Isolates were identified as Pseudomonas cichorii based on the LOPAT scheme (Cottyn et al. 2009). Taxonomic positioning was confirmed genetically by PCR analysis using primers set: 16S rRNA gene universal primers 27F/1492R (Weisburg et al. 1991) and hrcRST gene specific primers Hcr1/Hcr2 (Cottyn et al. 2011). Homology search of 16S rRNA gene sequences (GenBank accessions: JYB1, MZ749668; JYB7, MZ823822; and JYB8, MZ823823) indicated 99.93 % (1396 bp) identity with P. cichorii strains (GenBank accessions: MK356431, JX913785, MZ723344). Similarly, comparison of the hrcRST locus (GenBank accessions: JYB1, MZ977010; JYB7, MZ977011; and JYB8, MZ977012) shared 99.38% (812 bp) with P. cichorii strains (GenBank accessions: CP007039, CP074349, GU324131). Koch's postulate was performed on healthy 30-day-old Banxia plants to confirm pathogenicity of the isolated strains. Leaves were injected with 50 μL bacterial suspensions (1x108 cfu/ml) by sterile syringe. The negative control was inoculated with sterile water. The inoculated Banxia plants were incubated at 28 °C, 70 to 80 % relative humidity, and exhibited water-soaked lesions on the leaf surface within two days around the inoculation sites. Within seven days, all leaves withered and plants died. In contrast, control plants remained healthy and symptomless. The pathogen was consistently reisolated from diseased plants and morphologically and molecularly identified as P. cichorii, while no bacterial colonies were isolated from the control plants, fulfilling Koch's postulates. To our knowledge, this is the first report of bacterial leaf spot caused by P. cichorii on Banxia in China. As one of the main producing areas of Banxia in China, Jianghan Plain of Hubei Province has a planting area of nearly 20 square kilometers. The occurrence of this bacterial disease has the potential threat to the Banxia industry, more research is needed for breeding disease resistance and for developing chemical control.

First Report of Bacterial Leaf Spot Caused by Pseudomonas syringae pv. aptata on Swiss Chard, Beta vulgaris subsp. vulgaris, in Arizona.

Arizona is an important region of the USA for winter production of baby leaf crops such as spinach (Spinacia oleracea), table beet (Beta vulgaris subsp. vulgaris Condivita Group), and Swiss chard (B. vulgaris subsp. vulgaris Cicla Group). In the winter of 2019, severe leaf spots were observed at 80% incidence and 40% severity per plant in a 1-ha baby leaf Swiss chard crop of an (unknown cultivar) in Arizona. The lesions were circular to irregular, necrotic, water-soaked, and 1 to 5 mm in diameter. Symptomatic leaf sections (1-cm2) were surface-sterilized with 0.6% NaOCl, rinsed, and macerated in sterilized, deionized water. An aliquot of each macerate was streaked onto King's B (KB) agar medium. Cream-colored, non-fluorescent colonies typical of Pseudomonas were isolated consistently, and all were non-fluorescent. A dozen isolates selected randomly were all negative for potato soft rot, oxidase, and arginine dihydrolase, and positive for levan production and tobacco hypersensitivity, which is typical of fluorescent P. syringae isolates, but can also include non-fluorescent strains (Lelliot et al. 1966). Three isolates were tested for pathogenicity on the table beet cv. Red Ace and Swiss chard cv. Silverado. Strain Pap009 of P. syringae pv. aptata (Psa), demonstrated previously to be pathogenic on Swiss chard and table beet, served as a positive control strain (Derie et al. 2016; Safni et al. 2016). Each isolate was grown inoculated into medium 523 broth and incubated on a shaker at 175 rpm overnight at 25°C. Each bacterial suspension was adjusted to an optical density (OD) of 0.3 at 600 nm (108 CFU/ml), and diluted in 0.0125M phosphate buffer to 107 CFU/ml. Thirty-day-old seedlings grown in Redi-Earth Plug and Seedling Mix in a greenhouse at 22 to 26°C were inoculated by rubbing the abaxial and adaxial leaf surfaces of each plant with a cotton swab dipped in inoculum to which Carborundum had been added (0.06 g/10 ml). The negative control plants were treated similarly with phosphate buffer with Carborundum. The experiment was set up as a randomized complete block design with 4 replications per treatment and 6 seedlings per experimental unit. In both trials, leaf spots resembling those on the original plants developed on all table beet and Swiss chard plants inoculated with the Arizona isolates and Pap009, but not on negative control plants. Disease severity was greater on Swiss chard (average 39% leaf area with spots) than on table beet (14%). Re-isolates obtained from inoculated seedlings using the same method as the original isolations resembled Psa. Multilocus sequence analysis (MLSA) was carried out for the original three Arizona isolates and the re-isolates using DNA amplified from the housekeeping genes gyrB, rpoD, gapA, and gltA (Hwang et al. 2005; Sarkar and Guttman 2004). Sequence identities of these genes of the Arizona isolates (GenBank accession numbers MW291615 to MW291618 for strain Pap089; MW291619 to MW291622 for Pap095; and MW291623 to MW291626 for Pap096 for gltA, gyrB, rpoD, and gapA, respectively) and the re-isolates ranged from 98 to 100% with those of Psa pathotype strain CFBP 1617 in the PAMDB database (Almeida et al. 2010; Altschul et al. 1997). Based on Koch's postulates, colony characteristics, and MLSA, Psa was the causal agent of leaf spots in the Arizona Swiss chard crop. To our knowledge, this is the first report of bacterial leaf spot on chard in Arizona. The pathogen could have been introduced on infected seed as Psa is readily seedborne and seed transmitted.

First report of bacterial leaf spot disease on sunflower (Helianthus annuus) caused by Pseudomonas viridiflava in South Korea.

In September 2019, bacterial leaf spot symptoms were observed on sunflowers in an experimental field in Eumseong, South Korea. The leaves of infected plants initially showed irregular brown spots surrounded by haloes; as the disease progressed, the spots became enlarged and darkened (eXtra Fig. 1a). At the flowering stage, leaves became dry and showed signs of blight including defoliation; dark brown spots were also observed on sunflower stems and petioles but not on floral discs (eXtra Fig. 1b). Disease incidence ranged from 5% to 30% in three surveyed plots of the field. Symptomatic leaf tissue was surface-sterilized, macerated with sterile distilled water, and cultured on nutrient agar plates at 28°C for 48 h. After incubation, nine bacterial isolates, representing individually collected samples from each field, were selected for further study. All nine isolates were Gram-negative and fluorescent pigments produced under UV on King's medium B. With the LOPAT test, the isolates were levan negative, oxidase negative, positive for pectinolytic activity, arginine dihydrolase negative, and positive for tobacco hypersensitivity. Based on 16s rRNA sequences, all isolates shared 100% identity with Pseudomonas viridiflava strain KNOX209.1 (GenBank accession no. AY604847). The 16s rRNA sequences of nine isolates were deposited in GeneBank (accession nos. MT393747, MW446479 to MW446486). Based on the phylogenetic analysis of the 16s rRNA, all isolates were grouped with P. viridiflava strains isolated from globe artichoke, Chinese cabbage, and rape (Myung et al. 2010, Sanver et al. 2019, and Liu et al. 2019). The isolates CPB 19362, CPB 19366 and CPB 19372, which represent each plot were selected for further phylogenetic analysis and pathogenicity assays. The identity of these isolates was confirmed by sequences of housekeeping genes of the gyrase B subunit (gyrB) and RNA polymerase σ70 factor (rpoD) (Yamamoto et al. 2000) (GenBank accession nos. MT409400, MW446487 and MW446494 for gyrB and MT409401, MW446495 and MW446502 for rpoD). Based on the phylogenetic analyses of gyrB and rpoD, the three isolates belong to the same clade as the P. viridiflava pathotypes and were distinguished from P. syringae complex (eXtra Fig. 2). These results indicated that the bacteria isolated from the spots on the sunflower plants were P. viridiflava strains. To confirm the pathogenicity, bacterial suspensions (approximately 108 CFU/mL) of three representative isolates sprayed onto 4-week-old sunflower (cv. Common) seedlings separately until runoff occurred. Sterile distilled water was used as a control and inoculated in the same manner. After inoculation, plants were covered with transparent plastic bags at room temperature for 24 h. Plastic bags were then removed and plants were grown on a plant growth shelf at 25°C in 50% relative humidity. The leaves of plants inoculated with the bacterial suspensions developed small brown spots after 24 h. After 3 days, brown spots surrounded by chlorotic or necrotic areas were observed on infected leaves (eXtra Fig. 1c). These spots gradually increased in size and formed brown lesions with haloes similar to those of infected field-grown plants (eXtra Fig. 1d), but not on the controls treated with sterile water. The pathogenicity test was repeated three times. Isolates recovered from infected leaves showed the same morphological, biochemical, and molecular characteristics as the original isolates from field samples. To our knowledge, this is the first report of bacterial leaf spot on sunflower caused by P. viridiflava in South Korea.

First report of bacterial leaf spot of Hydrangea in retail nurseries in Belgium caused by strains assigned to a new Xanthomonas hortorum clade

First report of bacterial leaf spot of <i>Hydrangea</i> in retail nurseries in Belgium caused by strains assigned to a new <i>Xanthomonas hortorum</i> clade

First report of bacterial leaf spot on Chenopodium quinoa caused by Pseudomonas syringae in Colombia

Quinoa (Chenopodium quinoa) has become a food of great importance in the last decade, and it is considered by the Food and Agriculture Organization (FAO) as the grain of the twenty-first century. This plant is considered as a pseudo-cereal with high protein content and digestibility, as well as balanced content of essential amino acids, therefore having multiple beneficial properties for patients with obesity, dyslipidemia and diabetes. Even though this plant can grow under different abiotic and extreme biotic conditions, its production can be affected by diverse pathogens. Here, we show the pathogenicity of Pseudomonas syringae, a Gram-negative bacillus, by isolating pathogenic strains of P. syringae from leaves of C. quinoa cv. piartial with induced necrotic spots at 2–5 days post-inoculation. The bacteria was identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) using a Bruker Daltonik MALDI Biotyper system. Our results constitute the first report in Colombia of the pathogenic P. siryngae in quinoa.

First Report of Bacterial Leaf Spot of Cucurbita pepo Caused by Erwinia persicina in China.

In February 2020, the common symptoms of water-soaked spots on Cucurbita pepo L. cotyledon were observed in Guangrao county in Shandong province, China. Field investigation showed that 40% of the Cucurbita pepo cotyledons in an area of approximately 0.8 ha were infected. The disease resulted in a severe loss in seedling production. Samples of C. pepo with water-soaked leaf spots were collected and prepared for pathogen analysis. Symptomatic cotyledon tissue was surface disinfested in 75% ethanol for 30 sec, then rinsed three times in sterilized water. Bacteria were released in sterile water in Petri dish for 2 min by cutting symptomatic tissue into small sections and stirring the plant tissue mixture fully. The diffusate was streaked onto plates containing nutrient agar (NA) and plates were incubated at 28℃ for 2 days. Three representative isolates were purified eventually from each of the plates. Colonies on NA were small, round and with smooth margins. All bacterial isolates characterized as gram-negative, white to cream color, and pink pigment was formed on the plates over long-term culture. The isolates were positive for catalase, Voges-Proskauer, potato rot, methyl red, acetoin production, nitrate utilization and citrate utilization, and acid production from maltose, glucose, melezitose, sucrose, D-arabinose, D-trehalose, cellobiose, lactose, raffinose, mannitol, D-sorbitol, melibiose and xylitol. KOH production was demonstrated according to strand formation within the potassium hydroxide test (Suslow et al. 1982). Isolates were negative for oxidase, arginine dihydrolase, phenylalanine deaminase, gelatinase, esculine, indole production and H2S production. Total genomic DNA was extracted from isolate XHL2002230201 with TIANamp Bacteria DNA Kit (TIANGEN). Universal primers 27F and 1492R (Monciardini et al. 2002) were used in PCR to amplify a 1,307-bp DNA fragment of the 16S rRNA region for molecular identification. Furthermore, four additional housekeeping genes (gyrB, atpD, rho, and rpoS) were selected and amplified using specially designed primers. The amplification products of 16S rRNA were sequenced and submitted to GenBank under accession number (MT568607.1). Sequence analysis showed 99% similarity to Erwinia persicina strains B57 (LM651373.1) and B64 (CI789_17875) by BLAST search in GenBank database (Gálvez et al. 2015; Cho et al. 2019). A phylogenetic tree was constructed, and the taxonomic position of strain XHL2002230201 was determined from the multilocus sequence analysis (MLSA) on 16S rRNA and other four housekeeping genes with E. persicina and not with other closely related Erwinia species. Pathogenicity tests and re-isolation and re-identification of the bacteria were performed to confirm the isolate and fulfill the Koch' postulates. The strain XHL2002230201 suspensions (108 CFU ml-1) were spray inoculated onto fifteen Cucurbita pepo seedlings with two true leaves, and the same number of control plants were inoculated with water. Experiments were repeated three times. All inoculated plants were kept in a moist chamber placed in a greenhouse at 28℃. Initial symptoms were observed on leaves of inoculated plants at 5 days post-inoculation, whereas no symptoms appeared on the plants inoculated with sterile distilled water. Based on morphological and biochemical characteristics, phylogenetic analysis, and Koch's postulates, the bacterial isolates were identified as E. persicina. To our knowledge, this is the first report of E. persicina causing leaf spot disease on Cucurbita pepo in China.

First Report of Bacterial Leaf Spot Caused by Xanthomonas arboricola Infecting Saucer Magnolia in Tennessee

First Report of Bacterial Leaf Spot Caused by <i>Xanthomonas arboricola</i> Infecting Saucer Magnolia in Tennessee

Bacterial leaf spot on Convolvulus arvensis caused by Pseudomonas sp.

Field bindweed (Convolvulus arvensis) is considered as one of the most destructive weeds in the fields and gardens worldwide. In summer 2017, during the investigation carried out in Mazandaran province, a significant number of field bindweed indicated the leaf spot symptoms. Hence, the samples were collected and brought to the phytobacteriology lab for further examination. Then, isolation, purification and biochemical characterization of fifteen isolates were performed based on the standard bacteriological methods. The pathogenicity test of selected isolates on field bindweed plant were evaluated as positive. In order to validate the results, partial of 16S rRNA region were sequenced and phylogenetic trees constructed as well. According to the phenotypic and molecular characteristics, field bindweed isolates were identified as Pseudomonas sp. To the best of the authors’ knowledge, the present study is the first report of bacterial leaf spot on Convolvulus arvensis caused by Pseudomonas sp. in Iran.

First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in Japan

First Report of Bacterial Leaf Spot of Coriander Caused by <i>Pseudomonas syringae</i> pv. <i>coriandricola</i> in Japan

First Report of Pseudomonas syringae pv. aptata Causing Bacterial Leaf Spot on Common Beet (Beta vulgaris) in Ohio

In July 2017, common beet leaves (cv. Red Ace) from an open field in Erie County, Ohio, showing foliar blight symptoms were received by the OSU Vegetable Pathology Laboratory. Another beet sample (cv. Boro) from Wayne County, Ohio, displaying the same symptoms was received in June 2018. Symptoms consisted of pale brown circular water-soaked necrotic lesions, 2 to 3 mm in diameter, surrounded by a red halo. Bacterial streaming was observed from the lesions when viewed microscopically. Pieces of symptomatic tissue ∼0.25 cm² were surface sterilized in 70% ethanol for 30 s, rinsed in sterile water, placed in 100 µl of sterile water, and minced with a sterile blade. After 30 s, 10 µl of the resulting suspension was streaked onto Pseudomonas F agar medium (PF) and incubated in the dark for 48 h at 28°C. White creamy colonies fluorescent on PF when exposed to UV light were selected. Isolates from both samples were gram negative, oxidase negative, arginine dihydrolase negative, levan positive, and caused a hypersensitive reaction 24 h after infiltration into tobacco (Nicotiana tabacum) leaves. None of the isolates caused soft rot when inoculated at 10⁷ CFU/ml onto sterile potato slices. Box PCR (Louws et al. 1994) profiles were similar for strain SM200-2017 (Erie County) and SM61-2018 (Wayne County), with an additional band in SM200-2017. Both strains were subjected to whole-cell DNA extraction and multilocus sequence analysis of the housekeeping genes sigma factor 70, rpoD; glyceraldehyde-3-phosphate dehydrogenase, gapA; DNA gyrase B, gyrB; and citrate synthase, gltA (Hwang et al. 2005). Sequences were compared with those of the reference pathotype strain Pseudomonas syringae pv. aptata (Psa) CFBP 1617 deposited in the PAMDB database (Almeida et al. 2010). Both SM200-2017 (MK085510) and SM61-2018 (MK085511) showed 100% identity to the rpoD gene. SM200-2017 gapA sequence (MK085516) shared 99% homology with the gapA sequence of Psa CFBP 1617, and SM61-2018 gapA sequence (MK085517) was 100% identical. Similarly, the gyrB sequences from SM200-2017 (MK085515) and SM61-2018 (MK085514) were 99 and 100% similar to Psa CFBP 1617, respectively. No match was found for SM200-2017 and SM61-2018 gltA sequences (MK085512 and MK085513, respectively) when compared with those of Psa CFBP 1617. However, the sequences were 100% identical to Psa sequence KX226440 (Arabiat et al. 2016) deposited in the NCBI database. Koch’s postulates were confirmed in a greenhouse by spray inoculating 4-week-old beet seedlings (cv. Red Ace) with 10⁶ CFU/ml water suspensions of SM200-2017 or SM61-2018, or with sterile water. Plants were maintained at 27°C with a 14-h photoperiod, in plastic bags for the first 48 h. Symptom development was monitored daily. Water-soaked necrotic lesions similar to those observed on the original samples appeared 10 days after inoculation, whereas mock-inoculated plants did not show any symptoms. Symptomatic leaves were collected and processed as described above. Colonies with the same morphology on PF and with the same biochemical characteristics previously described were isolated. Box PCR profiles matched those of the original strains. To our knowledge, this is the first report of bacterial leaf spot of beet caused by Psa in Ohio. Common beets are cultivated throughout Ohio and can be severely affected under disease-conducive environmental conditions.

First Report of Pseudomonas cichorii Causing Bacterial Leaf Spot on Sweet Basil (Ocimum basilicum) in New Jersey

An estimated 500 acres of basil varieties are grown annually for fresh and wholesale markets in New Jersey. In July 2018, leaf spot disease symptoms were observed on several sweet basil cultivars and breeding lines grown in university field trials at the Rutgers Agricultural Research and Extension Center near Bridgeton, NJ. Disease incidence was less than 10%; no differences in susceptibility were observed between varieties or breeding lines of sweet basil within the field. Symptoms were observed as irregularly shaped blackened necrotic spots on leaf margins ranging from 2 to 7 mm in diameter, which coalesced as lesions expanded over time. Margins of diseased tissue were excised, macerated in sterile water, and then quadrant streaked for single-colony isolations onto nutrient agar and King’s medium B agar (KMB) (Schaad et al. 2001). Cream-colored circular bacterial colonies with undulated margins predominated growth on both agar media. Colonies on KMB fluoresced blue under 365-nm UV light. Two representative isolates recovered from separate diseased plants, Pc112 and Pc521, were selected for further characterization. Both isolates tested positive for oxidase, negative for levan production, and induced a strong hypersensitive response on tobacco, consistent with descriptions for Pseudomonas cichorii (Lelliott et al. 1966). Taxonomic positioning was confirmed genetically by PCR analysis using two primer sets: 16S rRNA gene universal primers 27F/1492R and Hcr1 (TTCTCCTGTTCGTGCTGGTC)/Hcr2 (CGAATACTCGGCATCGGGAA) primers constructed to amplify a 520-bp region of the pathogenicity gene cluster hrcRST in P. cichorii (Cottyn et al. 2011). Comparisons of 16S rRNA gene sequences (GenBank accessions: Pc112, MK501752; and Pc521, MK501753) indicated both shared 100% identity (1,412 bp) with each other and 99.93% (1,411/1,412 bp) identity with several P. cichorii strains within the GenBank database, including strain Pc-Gd-5 causing pith necrosis of tomato in China (KU923374) and strain MAFF 302698 causing fruit rot on okra from Japan (AB724286). Similarly, comparison of the hrcRST locus (GenBank accessions: Pc112, MK507763; and Pc521, MK507764) shared 100% (397 bp) identity to each other and 98.99% (395/397 bp) with P. cichorii strain P16-51 (MG518230) isolated from Plumeria pudica in Hawaii. Koch’s postulates were performed on 10-week-old sweet basil cultivar Rutgers Devotion DMR (VDF Specialty Seeds, Momence, IL) plants grown in 12-cm pots (n = 3 seedlings/isolate) to confirm pathogenicity. Bacterial suspensions (1 × 10⁷ CFU/ml) were injected (0.1 ml) into the internodal region of the stem between the second and third leaves and also pressure infiltrated into the two lowermost leaves on both sides of the petiole. Sterile water was used to inoculate negative control plants. Blackened necrosis developed within 72 h around bacteria-inoculated regions of stems and leaves, which expanded beyond original inoculation points within 1 week. In contrast, control plants remained healthy and symptomless. Although similar symptoms on basil have been observed by New Jersey growers in previous years, the cause was never confirmed. To our knowledge, this is the first report of bacterial leaf spot caused by P. cichorii on Ocimum basilicum in the state. Because bacterial leaf spot caused by P. cichorii poses a significant threat to sweet basil production in the United States, further research on selecting and breeding natural sources of resistance and chemical control is needed.

First Report of Bacterial Leaf Spot Caused by Pseudomonas viridiflava on Chinese Cabbage in China

First Report of Bacterial Leaf Spot Caused by <i>Pseudomonas viridiflava</i> on Chinese Cabbage in China

First report of bacterial leaf spot on calla lily (Zantedeschia spp.) caused by Pseudomonas viridiflava in Iran

First report of bacterial leaf spot on calla lily (Zantedeschia spp.) caused by Pseudomonas viridiflava in Iran