You have accessJournal of UrologyProstate Cancer: Markers1 Apr 20112297 NOVEL BIOMARKERS FOR AGGRESSIVE PROSTATE CANCER Christhunesa Christudass, Andrew Lelin, Alan Partin, Jun Luo, and Robert Veltri Christhunesa ChristudassChristhunesa Christudass Baltimore, MD More articles by this author , Andrew LelinAndrew Lelin Baltimore, MD More articles by this author , Alan PartinAlan Partin Baltimore, MD More articles by this author , Jun LuoJun Luo Baltimore, MD More articles by this author , and Robert VeltriRobert Veltri Baltimore, MD More articles by this author View All Author Informationhttps://doi.org/10.1016/j.juro.2011.02.2542AboutPDF ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareFacebookTwitterLinked InEmail INTRODUCTION AND OBJECTIVES A gene discovery project identified several differentially expressed sequenced tags (ESTs) by Arbitrarily-primed Differential Analysis (ADA) of RNA from primary prostate cancer (PCa) Stage T2b prostatectomy tissue. Three ESTs were identified from the human genome sequence: UC-31 (673bp) or TMEFF1(Tomoregulin-1); UC38 (166bp) or Calcium channel, voltage-dependent, l type, alpha 1d subunit (CACNA1D); and UC-28 (600bp) or Prostate Overexpressed Breast and Prostate-1 (PBOV-1)genes. These three genes were confirmed as being overexpressed in PCa using relative quantitative RT-PCR normalized using the β-actin gene. We confirmed differential expression and extended our findings using real time qRT-PCR. We are developing a ‘molecular biomarker panel' that when the biomarkers are differentially expressed in PCa prognostic accuracy will improve. METHODS Benign and tumor RNA samples were received from Dr. Jun Lou and cDNA was generated with 50ng of RNA using iScript cDNA synthesis kit (Bio Rad Laboratories) in a PTC-100 thermal cycler. following the manufacturer's protocol. The real-time PCR was done using the gene specific primers in a iCycler instrument (Bio Rad Laboratories) using SsoFast EvaGreen supermix kit following the manufacturer's protocol. The primers used for PBOV1 are: GCTCTTACCATTCTGCTACAAGG (forward) and CATGGTCAAGTGTGTCTGCAAGG (reverse). The primers used for TMEFF1 are: AACACTCCAAGTGTGGACCCTG (forward) and GGAACTCCCATCAGAAGCACAC (reverse). For calculating relative expression, a portion of β-actin was also amplified using a validated primer set from OriGene (Rockville, MD). The results were normalized by keeping the lowest normal value as one and graphs were then plotted. RESULTS The pre-qualifying data were developed using real time qRT-PCR, demonstrated significant overexpression of TMEFF1, CANCNA1D, and PBOV-1 genes in radical prostatectomy specimens from Johns Hopkins Hospital. In a set of five normal (benign area of cancer gland) and 18 PCa tumors of various Gleason Grades, the increased expression of the three gene panel in combination, enhanced the prognostic accuracy of identifying aggressive PCa. The Figure illustrates the concept for 2/3 biomarkers, where TMEFF1 and PBOV-1 are differentially regulated in the test samples. CONCLUSIONS A set of three cancer-associated genes over-expressed in PCa when combined provide prognostic evidence of an aggressive phenotype. Next, we will use quantitative IHC (qIHC) with antibodies to confirm our results in a progression PCa tissue microarray (TMA). © 2011 by American Urological Association Education and Research, Inc.FiguresReferencesRelatedDetails Volume 185Issue 4SApril 2011Page: e921 Advertisement Copyright & Permissions© 2011 by American Urological Association Education and Research, Inc.MetricsAuthor Information Christhunesa Christudass Baltimore, MD More articles by this author Andrew Lelin Baltimore, MD More articles by this author Alan Partin Baltimore, MD More articles by this author Jun Luo Baltimore, MD More articles by this author Robert Veltri Baltimore, MD More articles by this author Expand All Advertisement Advertisement PDF downloadLoading ...