Regulating Fe Homeostasis Research Articles

The bHLH Transcription Factor OsbHLH057 Regulates Iron Homeostasis in Rice

Many basic Helix-Loop-Helix (bHLH) transcription factors precisely regulate the expression of Fe uptake and translocation genes to control iron (Fe) homeostasis, as both Fe deficiency and toxicity impair plant growth and development. In rice, three clade IVc bHLH transcription factors have been characterised as positively regulating Fe-deficiency response genes. However, the function of OsbHLH057, another clade IVc bHLH transcription factor, in regulating Fe homeostasis is unknown. Here, we report that OsbHLH057 is involved in regulating Fe homeostasis in rice. OsbHLH057 was highly expressed in the leaf blades and lowly expressed in the roots; it was mainly expressed in the stele and highly expressed in the lateral roots. In addition, OsbHLH057 was slightly induced by Fe deficiency in the shoots on the first day but was not affected by Fe availability in the roots. OsbHLH057 localised in the nucleus exhibited transcriptional activation activity. Under Fe-sufficient conditions, OsbHLH057 knockout or overexpression lines increased or decreased the shoot Fe concentration and the expression of several Fe homeostasis-related genes, respectively. Under Fe-deficient conditions, plants with an OsbHLH057 mutation showed susceptibility to Fe deficiency and accumulated lower Fe concentrations in the shoot compared with the wild type. Unexpectedly, the OsbHLH057-overexpressing lines had reduced tolerance to Fe deficiency. These results indicate that OsbHLH057 plays a positive role in regulating Fe homeostasis, at least under Fe-sufficient conditions.

IRONMAN peptide interacts with OsHRZ1 and OsHRZ2 to maintain Fe homeostasis in rice.

IRONMAN (IMA) is a family of small peptides which positively regulate plant responses under Fe deficiency. However, the molecular mechanism by which OsIMA1 and OsIMA2 regulate Fe homeostasis in rice is unclear. Here, we reveal that OsIMA1 and OsIMA2 interact with the potential Fe sensors, OsHRZ1 (HAEMERYTHRIN MOTIF-CONTAINING REALLY INTERESTING NEW GENE (RING) AND ZINC-FINGER PROTEIN 1) and OsHRZ2. OsIMA1 and OsIMA2 contain a conserved 17 amino acid C-terminal region which is responsible for the interactions with OsHRZ1 and OsHRZ2. Plants overexpressing OsIMA1 (OsIMA1ox) show increased Fe concentration in seeds and reduced fertility, as observed in the hrz1-2 loss-of-function mutant plants. Moreover, the expression patterns of Fe deficiency inducible genes in the OsIMA1ox plants are the same as those in hrz1-2. Co-expression assays suggest that OsHRZ1 and OsHRZ2 promote the degradation of OsIMA1 proteins. As the interaction partners of OsHRZ1, the OsPRI (POSITIVE REGULATOR OF IRON HOMEOSTASIS) proteins also interact with OsHRZ2. The conserved C-terminal region of four OsPRIs contributes to the interactions with OsHRZ1 and OsHRZ2. An artificial IMA (aIMA) derived from the C-terminal of OsPRI1 can be also degraded by OsHRZ1. Moreover, aIMA overexpressing rice plants accumulate more Fe without reduction of fertility. This work establishes the link between OsIMAs and OsHRZs, and develops a new strategy for Fe fortification in rice.

The miR157-SPL-CNR module acts upstream of bHLH101 to negatively regulate iron deficiency responses in tomato.

Iron (Fe) homeostasis is critical for plant growth, development, and stress responses. Fe levels are tightly controlled by intricate regulatory networks in which transcription factors (TFs) play a central role. A series of basic helix-loop-helix (bHLH) TFs have been shown to contribute to Fe homeostasis, but the regulatory layers beyond bHLH TFs remain largely unclear. Here, we demonstrate that the SQUAMOSA PROMOTER-BINDING PROTEIN-LIKE (SPL) TF SlSPL-CNR negatively regulates Fe-deficiency responses in tomato (Solanum lycopersicum) roots. Fe deficiency rapidly repressed the expression of SlSPL-CNR, and Fe deficiency responses were intensified in two clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated protein 9-generated SlSPL-CNR knock-out lines compared to the wild-type. Comparative transcriptome analysis identified 47 Fe deficiency-responsive genes the expression of which is negatively regulated by SlSPL-CNR, one of which, SlbHLH101, helps regulate Fe uptake genes. SlSPL-CNR localizes the nucleus and interacts with the GTAC and BOX 4 (ATTAAT) motifs in the SlbHLH101 promoter to repress its expression. Inhibition of SlSPL-CNR expression in response to Fe deficiency was well correlated with the expression of the microRNA SlymiR157. SlymiR157-overexpressing tomato lines displayed enhanced Fe deficiency responses, as did SlSPL-CNR loss-of-function mutants. We propose that the SlymiR157-SlSPL-CNR module represents a novel pathway that acts upstream of SlbHLH101 to regulate Fe homeostasis in tomato roots.

OsIRO3 Plays an Essential Role in Iron Deficiency Responses and Regulates Iron Homeostasis in Rice.

Iron (Fe) homeostasis is essential for plant growth and development, and it is strictly regulated by a group of transcriptional factors. Iron-related transcription factor 3 (OsIRO3) was previously identified as a negative regulator for Fe deficiency response in rice. However, the molecular mechanisms by which OsIRO3 regulate Fe homeostasis is unclear. Here, we report that OsIRO3 is essential for responding to Fe deficiency and maintaining Fe homeostasis in rice. OsIRO3 is expressed in the roots, leaves, and base nodes, with a higher level in leaf blades at the vegetative growth stage. Knockout of OsIRO3 resulted in a hypersensitivity to Fe deficiency, with severe necrosis on young leaves and defective root development. The iro3 mutants accumulated higher levels of Fe in the shoot under Fe-deficient conditions, associated with upregulating the expression of OsNAS3, which lead to increased accumulation of nicotianamine (NA) in the roots. Further analysis indicated that OsIRO3 can directly bind to the E-box in the promoter of OsNAS3. Moreover, the expression of typical Fe-related genes was significantly up-regulated in iro3 mutants under Fe-sufficient conditions. Thus, we conclude that OsIRO3 plays a key role in responding to Fe deficiency and regulates NA levels by directly, negatively regulating the OsNAS3 expression.

How Does Rice Defend Against Excess Iron?: Physiological and Molecular Mechanisms.

Iron (Fe) is an essential nutrient for all living organisms but can lead to cytotoxicity when present in excess. Fe toxicity often occurs in rice grown in submerged paddy fields with low pH, leading dramatical increases in ferrous ion concentration, disrupting cell homeostasis and impairing growth and yield. However, the underlying molecular mechanisms of Fe toxicity response and tolerance in plants are not well characterized yet. Microarray and genome-wide association analyses have shown that rice employs four defense systems to regulate Fe homeostasis under Fe excess. In defense 1, Fe excess tolerance is implemented by Fe exclusion as a result of suppression of genes involved in Fe uptake and translocation such as OsIRT1, OsYSL2, OsTOM1, OsYSL15, OsNRAMP1, OsNAS1, OsNAS2, OsNAAT1, OsDMAS1, and OsIRO2. The Fe-binding ubiquitin ligase, HRZ, is a key regulator that represses Fe uptake genes in response to Fe excess in rice. In defense 2, rice retains Fe in the root system rather than transporting it to shoots. In defense 3, rice compartmentalizes Fe in the shoot. In defense 2 and 3, the vacuolar Fe transporter OsVIT2, Fe storage protein ferritin, and the nicotinamine synthase OsNAS3 mediate the isolation or detoxification of excess Fe. In defense 4, rice detoxifies the ROS produced within the plant body in response to excess Fe. Some OsWRKY transcription factors, S-nitrosoglutathione-reductase variants, p450-family proteins, and OsNAC4, 5, and 6 are implicated in defense 4. These knowledge will facilitate the breeding of tolerant crops with increased productivity in low-pH, Fe-excess soils.

BHLH121 Functions as a Direct Link that Facilitates the Activation of FIT by bHLH IVc Transcription Factors for Maintaining Fe Homeostasis in Arabidopsis

Iron (Fe) deficiency is prevalent in plants grown in neutral or alkaline soil. Plants have evolved sophisticated mechanisms that regulate Fe homeostasis, ensuring survival. In Arabidopsis, FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT) is a crucial regulator of Fe-deficiency response. FIT is activated indirectly by basic helix-loop-helix (bHLH) IVc transcription factors (TFs) under Fe deficiency; however, it remains unclear which protein(s) act as the linker to mediate the activation of FIT by bHLH IVc TFs. In this study, we characterize the functions of bHLH121 and demonstrate that it directly associates with the FIT promoter. We found that loss-of-function mutations of bHLH121 cause severe Fe-deficiency symptoms, reduced Fe accumulation, and disrupted expression of genes associated with Fe homeostasis. Genetic analysis showed that FIT is epistatic to bHLH121 and FIT overexpression partially rescues the bhlh121 mutant. Further investigations revealed that bHLH IVc TFs interact with and promote nuclear accumulation of bHLH121. We demonstrated that bHLH121 has DNA-binding activity and can bind the promoters of the FIT and bHLH Ib genes, but we did not find that it has either direct transcriptional activation or repression activity toward these genes. Meanwhile, we found that bHLH121 functions downstream of and is a direct target of bHLH IVc TFs, and its expression is induced by Fe deficiency in a bHLH IVc-dependent manner. Taken together, these results establish that bHLH121 functions together with bHLH IVc TFs to positively regulate the expression of FIT and thus plays a pivotal role in maintaining Fe homeostasis in Arabidopsis.

Oryza sativa POSITIVE REGULATOR OF IRON DEFICIENCY RESPONSE 2 (OsPRI2) and OsPRI3 are involved in the maintenance of Fe homeostasis.

Iron (Fe) is an essential micronutrient for plant growth development and plays a key role in regulating numerous cellular processes. In rice, OsHRZ1, an Fe-binding ubiquitin ligase, is a putative sensor of Fe homeostasis that negatively regulates iron acquisition. Despite its apparent importance, only a single basic-Helix-Loop-Helix (bHLH) transcription factor, OsPRI1, has been identified as a direct target of OsHRZ1. In this study, we identified and functionally characterized OsPRI2 and OsPRI3, two paralogs of OsPRI1, observing that they directly interact with OsHRZ1. Additional analyses suggested that OsHRZ1 promotes the degradation of OsPRI2 and OsPRI3. The translocation of Fe from roots to shoots was impaired in plants with loss-of-function mutations in OsPRI2 or OsPRI3, causing the downregulation of Fe-deficiency-responsive genes. In contrast, overexpression of OsPRI2 and OsPRI3 promotes Fe accumulation and activates the expression of Fe-deficiency-responsive genes. We also provide evidence that OsPRI2 and OsPRI3 bind to the promoters of OsIRO2 and OsIRO3, two key regulators of Fe homeostasis. Moreover, OsPRI2 and OsPRI3 directly induce expression of the metal-nicotianamine transporter, OsYSL2, by associating with the promoter in response to Fe deficiency. Our results provide insights into the complex network regulating Fe homeostasis in rice.

Two bHLH Transcription Factors, bHLH34 and bHLH104, Regulate Iron Homeostasis in Arabidopsis thaliana.

The regulation of iron (Fe) homeostasis is critical for plant survival. Although the systems responsible for the reduction, uptake, and translocation of Fe have been described, the molecular mechanism by which plants sense Fe status and coordinate the expression of Fe deficiency-responsive genes is largely unknown. Here, we report that two basic helix-loop-helix-type transcription factors, bHLH34 and bHLH104, positively regulate Fe homeostasis in Arabidopsis (Arabidopsis thaliana). Loss of function of bHLH34 and bHLH104 causes disruption of the Fe deficiency response and the reduction of Fe content, whereas overexpression plants constitutively promote the expression of Fe deficiency-responsive genes and Fe accumulation. Further analysis indicates that bHLH34 and bHLH104 directly activate the transcription of the Ib subgroup bHLH genes, bHLH38/39/100/101 Moreover, overexpression of bHLH101 partially rescues the Fe deficiency phenotypes of bhlh34bhlh104 double mutants. Further investigation suggests that bHLH34, bHLH104, and bHLH105 (IAA-LEUCINE RESISTANT3) function as homodimers or heterodimers to nonredundantly regulate Fe homeostasis. This work reveals that plants have evolved complex molecular mechanisms to regulate Fe deficiency response genes to adapt to Fe deficiency conditions.

An Exogenous Source of Nitric Oxide Modulates Iron Nutritional Status in Peanut Seedlings (Arachis hypogaea L.)

Iron (Fe) deficiency chlorosis is a common and severe nutritional deficiency in plants, and nitric oxide (NO) is an important signaling molecule in regulating Fe homeostasis in plants. We studied the effect of sodium nitroprusside (SNP, an NO donor) on Fe uptake, translocation, storage, and activation in a greenhouse. The concentrations of active Fe, total Fe, and the ratio of active Fe to total Fe, the activities of key enzymes, and chlorophyll concentration were determined, and resistance to oxidative stress and mineral element distribution in peanut plants grown in Fe sufficiency and Fe deficiency (an absence of Fe and low level of Fe concentration) conditions were also investigated. The results showed that NO significantly increased the concentration of active Fe and the ratio of active Fe to total Fe in Fe-deficient plants, and increased active Fe concentration in leaves and stems of Fe-sufficient plants. NO application also increased Fe translocation from roots to the shoots and the accumulation of Fe in cell organelles and the soluble fraction in leaves, especially in the low-level Fe concentration condition, thus increased available Fe and chlorophyll concentration in leaves of Fe-deficient plants. The activities of key enzymes were regulated by NO, which effectively mitigated oxidative damages by enhancing the activities of antioxidant enzymes (SOD, POD, CAT), increasing H+-ATPase and Ca2+-ATPase activities to balance the ion (Fe, Ca, Mg and Zn) uptake and distribution in Fe-deficient plants. However, NO application had no obvious effect on these variables in Fe-sufficient plants. These results indicated that NO application can improve Fe uptake, translocation, and activation of related enzymes in Fe-deficient plants, thus mitigating the adverse effect of Fe deficiency.

Unraveling the iron deficiency responsive proteome in Arabidopsis shoot by iTRAQ-OFFGEL approach

Iron (Fe) is required by plants for basic redox reactions in photosynthesis and respiration, and for many other key enzymatic reactions in biological processes. Fe homeostatic mechanisms have evolved in plants to enable the uptake and sequestration of Fe in cells. To elucidate the network of proteins that regulate Fe homeostasis and transport, we optimized the iTRAQ-OFFGEL method to identify and quantify the number of proteins that respond to Fe deficiency in the model plant Arabidopsis. In this study, Fe deficiency was created using Fe-deficient growth conditions, excess zinc (Zn), and use of the irt1-1 mutant in which the IRT1 Fe transporter is disrupted. Using the iTRAQ-OFFGEL approach, we identified 1139 proteins, including novel Fe deficiency-responsive proteins, in microsomal fractions isolated from 3 different types of Fe-deficient shoots compared with just 233 proteins identified using conventional iTRAQ-CEX. Further analysis showed that greater numbers of low-abundance proteins could be identified using the iTRAQ-OFFGEL method and that proteins could be identified from numerous cellular compartments. The improved iTRAQ-OFFGEL method used in this study provided an efficient means for identifying greater numbers of proteins from microsomal fractions of Arabidopsis shoots. The proteome identified in this study provides new insight into the regulatory cross talk between Fe-deficient and excess Zn conditions.

Signals from chloroplasts and mitochondria for iron homeostasis regulation

Iron (Fe) is an essential element for human nutrition. Given that plants represent a major dietary source of Fe worldwide, it is crucial to understand plant Fe homeostasis fully. A major breakthrough in the understanding of Fe sensing and signaling was the identification of several transcription factor cascades regulating Fe homeostasis. However, the mechanisms of activation of these cascades still remain to be elucidated. In this opinion, we focus on the possible roles of mitochondria and chloroplasts as cellular Fe sensing and signaling sites, offering a new perspective on the integrated regulation of Fe homeostasis and its interplay with cellular metabolism.

Interleukin-6 and Lipopolysaccharide Modulate Hepcidin mRNA Expression by Hepg2 Cells

Iron homeostasis is controlled by hepcidin (Hpc) as well as other ways. Hpc expression is regulated by iron (Fe) storage and by inflammation, but the joint effect of both stimuli remains unclear. We studied the modulatory role of inflammatory agents (IL6 and LPS) over Hpc and DMT1 mRNA expression in HepG2 cells preloaded with Fe. HepG2 cells were preloaded with different Fe concentrations (holo-Tf or Fe-NTA) and then incubated with IL6 or LPS. We measured intracellular Fe levels by AAS with graphite furnace, transferrin receptor (TfR) by ELISA and mRNA relative abundance of Hpc and DMT1 by qRT-PCR. The maximum effect on Fe uptake was observed in cells incubated with 30ng/ml IL6 (p < 0.01) and 500ng/ml LPS (p < 0.05). In HepG2 cells preloaded with holo-Tf or Fe-NTA and challenged with IL6 and LPS, we observed a decreased: (a) Hpc mRNA relative abundance (two-way ANOVA: p < 0.05 and p < 0.001, respectively), (b) DMT1 mRNA relative abundance and TfR1 protein levels (two-way ANOVA: p < 0.001), and (c) intracellular Fe concentration (two-way ANOVA: p < 0.001 and p < 0.01, respectively) compared to control cells incubated only with Fe (holo-Tf or Fe-NTA). Our results support the idea that Fe storage and inflammation act together to regulate Fe homeostasis and suggest a negative regulation in this hepatic cellular model to prevent excessive increases in Hpc.

Citrate assisted phytoextraction of uranium by sunflowers: Study of fluxes in soils and plants and resulting intra-planta distribution of Fe and U

This study aimed to determine how the citric acid assisted phytoextraction of uranium (U) by sunflowers impacted on the remobilisation of U in soil, its subsequent transfer to plants and its further distribution intra-planta. Consequences of the flux of nutrient elements [iron (Fe) and zinc (Zn)] able to interfere with U during this process were also specifically addressed. A U-contaminated soil receiving different citric acid treatments in terms of dose delivered and frequency of delivery was studied. Dynamics of remobilisation in soil were assessed using DGT (Diffusive Gradient in Thin-film) measurements, and phytoextraction experiments were conducted in a Rhizoplan device. All treatments induced a remobilisation of U and Fe from the soil solid-phase to the soil solution. Consequently, sunflower uptake of U was greatly enhanced, whereas the uptake of Fe was not affected – in accordance with the high regulation of this nutrient in the plant. As for U, the Zn uptake increased due to the citric acid treatment. The DGT-measured concentration correlated well with the concentration taken up by plants for U. Nevertheless, under all conditions, U fluxes to DGT were higher than U fluxes to plants, suggesting that DGT did not mimic the plant uptake mechanism for U. There was no correlation found for Fe, due to its plant uptake regulation. Distribution of these elements in planta was strongly impacted by citric acid, with an increase in translocation from root-to-shoot of both U and Fe, whereas Zn remained mainly in the roots. Such an increase was expected for U but was very surprising for Fe, suggesting that the presence of U in plants may have interfered with mechanisms that regulate Fe homeostasis.

Ceruloplasmin/Transferrin System Is Related to Clinical Status in Acute Stroke

In acute stroke, Iron (Fe) may amplify reperfusion injury by catalyzing the conversion of superoxide and hydrogen peroxide into highly reactive radicals. Transferrin (Tf) is the main protein regulating Fe homeostasis, whereas Ceruplasmin (CP) is a circulating ferroxidase enzyme able to oxidize ferrous ions to less toxic ferric forms. This study aims at investigating whether CP, Copper (Cu), Tf, and Fe play a role in the pathophysiology of acute stroke. We enrolled 35 acute stroke patients and 44 controls. All patients underwent: neurological examination assessed by National Institutes of Health Stroke Scale (NIHSS), ultrasound evaluation of carotid atherosclerosis, brain MRI to quantify ischemic lesion volume and measurement of serum levels of CP, Cu, Tf, Fe, hydro-peroxides, and Total plasmatic antioxidant capacity. In patients, NIHSS scores were associated with Tf (r=-0.48, P=0.004), hydro-peroxides (r=0.34, P=0.046), CP (r=0.43, P=0.012), and lesion volume (r=0.50, P=0.004). Lesion volume was inversely associated with Tf (r=-0.44, P=0.012). CP and hydro-peroxides were also largely related (r=0.81, P<0.001). The model multiple R was 0.57, resulting in a 32.5% of explained NIHSS variance with Tf accounting for 23.4% and CP for 9.1%. CP and Tf levels are representative of clinical status in acute stroke patients. Our findings suggest a protective role of Tf in acute stroke and a possible ambivalent role of CP.

Interaction Between Ozone Exposure and Iron Nutrition in Two Tobacco Cultivars

ABSTRACT The initial objective was to confirm evidence, obtained from field grown plants, for iron (Fe) accumulation in leaves under ozone exposure. Tobacco plants were grown in pots under either open air or growth chamber conditions. The ozone-sensitive cultivar Bel W3 showed symptoms of ozone injury only when grown outside, while the cultivar Virginia never developed symptoms. In both cultivars, basal leaves of plants grown outside had higher concentration of Fe, but not of manganese (Mn) or zinc (Zn), than those from the growth chamber. Results suggest an interference of the oxidative stress with the mechanisms regulating Fe homeostasis. A second objective was to test whether differences in tolerance to ozone correspond with differences in tolerance to Fe toxicity. Iron toxicity was induced by supplying an excess of Fe-EDTA to plants, grown hydroponically in a growth chamber, upon partial root cutting. Symptoms in leaves were more severe in Bel W3 than in Virginia, which suggested that mechanisms of tolerance to ozone were also effective against Fe toxicity. In both cultivars, a good correlation was determined between Fe accumulation and ethylene production in the leaves.

Identification of novel cis-acting elements, IDE1 and IDE2, of the barley IDS2 gene promoter conferring iron-deficiency-inducible, root-specific expression in heterogeneous tobacco plants.

The molecular mechanisms of plant responses to iron (Fe) deficiency remain largely unknown. To identify the cis-acting elements responsible for Fe-deficiency-inducible expression in higher plants, the barley IDS2 (iron deficiency specific clone no. 2) gene promoter was analyzed using a transgenic tobacco system. Deletion analysis revealed that the sequence between -272 and -91 from the translational start site (-272/-91) was both sufficient and necessary for specific expression in tobacco roots. Further deletion and linker-scanning analysis of this region clearly identified two cis-acting elements: iron-deficiency-responsive element 1 (IDE1) at -153/-136 (ATCAAGCATGCTTCTTGC) and IDE2 at -262/-236 (TTGAACGGCAAGTTTCACGCTGTCACT). The co-existence of IDE1 and IDE2 was essential for specific expression when the -46/+8 region (relative to the transcriptional start site) of the CaMV 35S promoter was used as a minimal promoter. Expression occurred mainly in the root pericycle, endodermis, and cortex. When the -90/+8 region of the CaMV 35S promoter was fused, the -272/-227 region, which consists of IDE2 and an additional 19 bp, could drive Fe-deficiency-inducible expression without IDE1 throughout almost the entire root. The principal modules of IDE1 and IDE2 were homologous. Sequences homologous to IDE1 were also found in many other Fe-deficiency-inducible promoters, including: nicotianamine aminotransferase (HvNAAT)-A, HvNAAT-B, nicotianamine synthase (HvNAS1), HvIDS3, OsNAS1, OsNAS2, OsIRT1, AtIRT1, and AtFRO2, suggesting the conservation of cis-acting elements in various genes and species. The identification of novel cis-acting elements, IDE1 and IDE2, will provide powerful tools to clarify the molecular mechanisms regulating Fe homeostasis in higher plants.

Shoot-to-Root Signal Transmission Regulates Root Fe(III) Reductase Activity in the dgl Mutant of Pea.

To understand the root, shoot, and Fe-nutritional factors that regulate root Fe-acquisition processes in dicotyledonous plants, Fe(III) reduction and net proton efflux were quantified in root systems of an Fe-hyperaccumulating mutant (dgl) and a parental (cv Dippes Gelbe Viktoria [DGV]) genotype of pea (Pisum sativum). Plants were grown with (+Fe treated) or without (-Fe treated) added Fe(III)-N,N'-ethylenebis[2-(2-hydroxyphenyl)-glycine] (2 [mu]M); root Fe(III) reduction was measured in solutions containing growth nutrients, 0.1 mM Fe(III)-ethylenediaminetetraacetic acid, and 0.1 mM Na2-bathophenanthrolinedisulfonic acid. Daily measurements of Fe(III) reduction (d 10-20) revealed initially low rates in +Fe-treated and -Fe-treated dgl, followed by a nearly 5-fold stimulation in rates by d 15 for both growth types. In DGV, root Fe(III) reductase activity increased only minimally by d 20 in +Fe-treated plants and about 3-fold in -Fe-treated plants, beginning on d 15. Net proton efflux was enhanced in roots of -Fe-treated DGV and both dgl growth types, relative to +Fe-treated DGV. In dgl, the enhanced proton efflux occurred prior to the increase in root Fe(III) reductase activity. Reductase studies using plants with reciprocal shoot:root grafts demonstrated that shoot expression of the dgl gene leads to the generation of a transmissible signal that enhances Fe(III) reductase activity in roots. The dgl gene product may alter or interfere with a normal component of a signal transduction mechanism regulating Fe homeostasis in plants.