Recombinant Human Granulocyte Colony-stimulating Factor Research Articles

Establishment of the Safe and Efficient CRISPR/Cas9-RNP Based Gene-Correction Platform of ELANE Mutations in iPSCs of Severe Congenital Neutropenia (CN) Patients with No Response to G-CSF and High Risk to Develop Leukemia

Severe congenital neutropenia (CN) is a monogenic pre-leukemia bone marrow failure syndrome characterized by an absolute neutrophil count (ANC) below 500 cells per microliter and recurrent, life-threatening bacterial infections. Treatment with recombinant human granulocyte colony-stimulating factor (rhG-CSF) increases ANC in the majority of CN patients and dramatically improves the quality of life. However, some CN patients do not respond or respond only poorly to G-CSF and should be treated by bone marrow transplantation (BMT). In some cases, “G-CSF no-responder” CN patients fail to engraft bone marrow transplant and no therapeutic options for these patients remain. Therefore, establishment of the alternative therapeutic approaches for these patients is indispensable.Many underlying genetic defects have been identified in CN. Autosomal dominant ELANE mutations have been identified in a majority of CN patient. Some ELANE mutations (e.g. p.A57V, p.C151Y, p.G214ter) are associated with no response or poor response to G-CSF therapy or high frequency of leukemia development.In the present study, we established a DNA- and virus-free clinical-grade gene correction approach of these phenotypically severe ELANE mutations in induced pluripotent stem cells (iPSCs) of CN patients using CRISPR/Cas9-based technology. We used ribonucleoprotein (RNP) form of CRISPR Cas9 as a safe tool to correct ELANE mutations. For this, we generated and characterized iPSCs from ELANE -CN patients harboring p.C151Y and p.G214ter ELANE mutations. We used embryoid body (EB)-based hematopoietic differentiation method to evaluate granulocytic differentiation of CN-patients specific iPSCs. Granulocytic differentiation was studied by absolute live cell counts, FACS analysis of myeloid-specific surface markers expression levels, CFU assay, cell morphology of cytospin preparations and nitroblue tetrazolium (NBT) assay. We found markedly diminished granulocytic differentiation of ELANE -CN iPSCs (ELANE mutations p.C151Y and p.G214ter), as compared to healthy individuals. We designed and generated repair templates and specific Crispr-RNA (crRNA) for the fourth (GGGACGCCGCCTGGGCAACG) and fifth (GGACGAAGGAGGCAATTTCG) exons of ELANE for correction of mutations p.C151Y and p.G214R, respectively and made efficient Crispr-Cas9 Ribonucleoprotein (RNP) complexes to edit the mutations along with ssODN repair templates.We further established gentle and efficient transfection of iPSCs from CN patients with ELANE -mutations specific-CRISPR/Cas9 ribonucleoprotein (RNP) complexes. We also developed simple and fast screening method for the selection of the ELANE gene corrected single iPSCs clones using restriction fragment length polymorphism (RFLP) analysis and Cas9 in vitro digestion technique. Selected clones were further analyzed for granulocytic differentiation. Up to now, we compared myeloid differentiation of iPSCs generated from healthy individuals with iPSCs from one CN- ELANE patient (p.C151Y) before- and after correction of ELANE mutation. We found that correction of ELANE mutation resulted in fully normalized granulocytic differentiation, that was in line with normalized levels of ELANE mRNA, correction of previously increased unfolded protein response (UPR)-activated gene expression, such as CHOP, ATF4, BIP, and reduction of elevated STAT5A levels in the ELANE corrected cells.Taken together, we established a safe and efficient CRISPR/Cas9-RNP based ELANE gene-correction platform of iPSCs of ELANE -CN patients that may provide novel stem cell-based therapy for CN patients with high risk of leukemia development as well as for G-CSF-non-responsive patients. This platform may be also applied for treatment of patients with other monogenic bone marrow failure syndromes. DisclosuresNo relevant conflicts of interest to declare.

Effects of CSF3R mutations on Myeloid Differentiation and Proliferation of Hematopoietic Cells of Congenital Neutropenia Patients

Over the last 25 years, with the clinical approval of recombinant human granulocyte colony-stimulating factor (rhG-CSF) remarkable progress has been achieved in the therapy of severe congenital neutropenia (CN). Nevertheless, CN patients have a high rate of transformation to myelodysplasia (MDS) or acute myeloid leukemia (AML). This risk is especially high in the group of patients who harbor acquired G-CSFR mutations, suggesting that these mutations are involved in the leukemogenesis. Deep sequencing of the intracellular part of G-CSFR allowed us to identify a subset of CN patients with a high mutant allele frequency (MAF) of G-CSFR mutations in the granulocytic compartment. We performed CSF3R mutation analysis of myeloid colonies from colony forming unit (CFU) assay of BM and CD34+ samples of 3 ELANE -CN patients, in which the percentage of granulocytes with G-CSFR mutation varied between 22.6% and 81%. Average number of sequenced colonies per CFU sample was 18. Intriguingly, we found that only cell clones with WT G-CSFR were grown in CFU assay. We hypothesized that lack of G-CSFR mutant clones in CFU assay is due to abnormal signaling downstream of truncated G-CSFR. To compare myeloid differentiation of G-CSFR mutant and WT G-CSFR hematopoietic cells, we generated ELANE -CN patient-derived induced pluripotent stem cells (CN-iPSCs) and performed CRISPR/Cas9 genome editing of CSF3R . Using 2 different sgRNAs specific for the intracellular region of G-CSFR, we introduced nucleotide indels at amino acid positions 740 and 735 (NP_000751.1) in CN-iPSCs. Subsequently, homozygous and heterozygous CN-iPSCs clones with truncated distal part of cytoplasmic domain of G-CSF receptor and subsequent loss of 3 out of 4 conserved tyrosine residues were generated.We compared myeloid differentiation of healthy donor iPSCs (HD-iPSCs), CN-iPSCs and CN-iPSCs with heterozygous and homozygous truncated G-CSF receptor (G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs, respectively). Absolute cell count during myeloid differentiation (18-32 day) of HD-iPSCs, G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs didn't differ significantly (p>0.05). In contrast, absolute cell count was found to be elevated from day 25 to day 32 of differentiation when G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs hematopoietic progenitors were compared with CN-iPSCs-derived hematopoietic cells (p<0.05). FACS analysis of CN-iPSCs derived hematopoietic progenitors with and without truncated G-CSF receptor using a panel of hematopoietic markers (KDR, CD34, CD235a, CD41a, CD45 and CD33) showed no difference in percentage of early progenitors (CD34+/KDR+), E/MK precursors (CD41a+CD235a+/ CD45-), CD34+/CD45+ and CD34+/CD43+ cells. Intriguingly, we observed increase in percentage of CD34+/CD43+ (p<0.01), CD33+/CD45+ (p<0.05) and CD41a+CD235a+/ CD45- (p<0.05) cells at day 14 of myeloid differentiation of G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs versus HD-iPSc. As expected, relative number CD14+ and CD16+ cells were not changed upon myeloid differentiation of hematopoietic progenitors with mutant G-CSFR but relative levels of CD15+ and CD15+/CD16+ were negatively affected by homozygous and heterozygous G-CSFR mutations. Next, CFU assay of hematopoietic progenitors derived from G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs produced markedly less colonies than HD- and CN-iPSCs derived hematopoietic cells. Cell morphology analysis also confirmed the reduced number of mature granulocytes seen after myeloid differentiation of G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs. Finally, reprogramming of BM cells from CN patients into iPSCs followed by mutation analysis of single cell derived iPSCs clones allowed us to identify iPSCs with naturally acquired G-CSFR mutations. Preliminary results revealed reduced myeloid differentiation of these cells, which is in line with data generated from G-CSFR*HET CN-iPSCs and G-CSFR*HOM CN-iPSCs.Using a combination of patient CN-iPSCs and CRISPR/Cas9 gene editing we were able to recapitulate main features of G-CSFR mutant versus G-CSFR WT CN cells - defective neutrophil differentiation and increased proliferation of human hematopoietic progenitors. Since virtually all studies of truncated G-CSFR receptor signaling have been performed in murine cytokine-responsive myeloid cell lines, our approach is more suitable to explore human aberrant G-CSF receptor signaling in depth. DisclosuresNo relevant conflicts of interest to declare.

Comparability of Pharmacodynamics and Immunogenicity of B12019, a Proposed Pegfilgrastim Biosimilar to Neulasta

IntroductionB12019 is being developed as a biosimilar to Neulasta (INN pegfilgrastim), a pegylated, long-acting form of recombinant human granulocyte-colony stimulating factor (G-CSF) for the prevention of chemotherapy-induced neutropenia. A clinical development program, based on scientific advice from EMA, consisting of two clinical studies was conducted with B12019 to confirm the biosimilarity to EU-authorised Neulasta as established by analytical, functional and preclinical data. Pharmacokinetic (PK) and pharmacodynamic (PD) comparability between Neulasta and B12019 had been shown in a previous study (Blood 2016 128:5079). Here, the results of the second clinical study are presented.MethodsStudy B12019-102 investigated the immunogenicity and PD comparability of B12019 and Neulasta at a reduced dose (3 mg). This dose was selected because it is considered more sensitive to detect potential differences in PD between B12019 and Neulasta as compared to the clinical dose of 6 mg. The study was designed as a multiple-dose, randomized, double-blind, three-period, two-sequence cross-over study in 96 healthy volunteers. A hierarchical ADA test strategy with a highly sensitive screening assay followed by four parallel epitope-specific, confirmatory assays was established. Primary study endpoints were AUEC0-last of the absolute neutrophil count (ANC) for PD after cross-over and anti-drug antibody rate (ADA) for immunogenicity after repeat dosing.Results •The number of ADA-positive subjects was very low for both, B12019 and Neulasta. No imbalance was observed between the study drugs after repeated dosing.•Neither anti-filgrastim nor neutralising antibodies were detected for B12019 or Neulasta.•82 subjects were included in the model-based PD comparison. PD comparability was demonstrated, with the AUEC0-last geometric mean ratio with a 95% CI of 99.58; 103.63 being within the pre-specified acceptance range.•No clinically meaningful differences in the safety profile for B12019 and Neulasta were observed.Conclusion •Study B12019-102 confirmed the PD comparability of B12019 with Neulasta at a sensitive dose of 3 mg.•The immunogenicity profile of B12019 did not show differences to Neulasta.•The study confirmed the biosimilarity of B12019 and Neulasta in a sensitive study design for immunogenicity and PD. DisclosuresRoth, Né Meyer:Cinfa Biotech: Employment. Wessels:Cinfa Biotech: Employment. Hoefler:Staburo GmbH: Employment. Jankowsky:Cinfa Biotech: Employment.

A Phase 2, International, Multicenter, Prospective Clinical Trial of Subcutaneous Tbo-Filgrastim in Pediatric Patients with Solid Tumors Undergoing Chemotherapy

Background: Chemotherapy (CT)-induced neutropenia is a common complication from chemotherapy, limiting optimal dosing and treatment. Tbo-filgrastim (GRANIX®) is a non-glycosylated recombinant methionyl human granulocyte colony-stimulating growth factor manufactured by recombinant DNA technology. It is indicated to reduce the duration of severe neutropenia (SN) in patients with non-myeloid malignancies receiving myelosuppressive anticancer drugs associated with a clinically significant incidence of febrile neutropenia (FN). It is approved under a biologic license application in the United States. This phase 2, multicenter, open-label study investigated the safety, tolerability, pharmacokinetics (PK), pharmacodynamics (PD), efficacy, and immunogenicity of tbo-filgrastim in pediatric patients receiving at least 1 cycle of myelosuppressive CT.Methods: Patients ages 1 mo to <16 y with solid tumors without bone marrow involvement were administered tbo-filgrastim 5 µg/kg/body weight once daily subcutaneously. Tbo-filgrastim administration was started at approximately 24 hours (±3 hours) after the end of the last CT treatment. Daily dosing with tbo-filgrastim continued until the expected neutrophil nadir was passed and the neutrophil count had recovered to 2.0 × 109/L but not longer than 14 consecutive days. Patients were stratified into three age groups: infants (1 mo to <2 y), children (2 to <12 y), and adolescents (12 to <16 y). The CT regimens included at least one of the following: etoposide, doxorubicin, ifosfamide, or cyclophosphamide. The primary endpoint was the safety of tbo-filgrastim; secondary objectives were to assess the PK, PD (incidence and duration of SN, defined as absolute neutrophil count <0.5x109/L), and efficacy (incidence of FN). Immunogenicity was also assessed.Results: Fifty patients (2 infants, 30 children, and 18 adolescents) were administered a single daily dose of tbo-filgrastim. The most common cancers were rhabdomyosarcoma (14%), neuroblastoma (14%), Ewing tumors (12%), and osteosarcoma (12%). The mean (SD) number of doses administered were 9.2 (2.83) in children and 7.3 (1.88) in adolescents. Twelve and 14 doses, respectively, were administered to each infant. Serious treatment-emergent adverse events (TEAEs) were reported in 24% of patients (Table). The most common serious TEAEs were FN (12%, 4 children, 2 adolescents), anemia (8%, 4 children) and thrombocytopenia (8%, 2 children, 2 adolescents), increased alanine aminotransferase (ALT) and increased aspartate aminotransferase (AST) (6% each). The majority of grade 3 and 4 events, per Common Terminology Criteria for Adverse Events (NCI CTCAE), were in the hematologic system organ class. Nine patients (18%) experienced treatment-related TEAEs. The most common treatment-related TEAEs were musculoskeletal and connective tissue disorders (4/50, 8%) and were of NCI CTCAE grade 1 severity. Two patients (2/50, 4%) had increases in liver function enzymes considered to be related to tbo-filgrastim and CT by the investigator. No clinical symptoms were observed with these events, which resolved by the end of the study. No deaths or study withdrawal occurred during the study. PK parameters of exposure were comparable between age groups as shown by the overlap of tbo-filgrastim serum concentrations (Figure). The incidence of SN was 52% (26/50; 95% CI 0.374-0.663). The mean (SD) duration of SN was 1.8 (2.21) d. The incidence of FN was 26% (13/50; 95% CI 0.146-0.403). Immunogenicity assessments found that none of the patients had an antidrug antibody response after tbo-filgrastim treatment.Conclusion: A daily dose of tbo-filgrastim 5 μg/kg/body weight administered to pediatric patients with solid tumors without bone marrow involvement demonstrated a safety profile consistent with the safety profile in adult patients. No immunogenic response was observed in this population. The increases in liver function enzymes were considered related to both tbo-filgrastim and CT by the investigator. The sponsor assessed these events to be related to CT and concomitant medications and not related to tbo-filgrastim. The incidence of FN was on the lower end of the range in the literature. PD variables of the incidence and duration of SN provide supportive results of the efficacy of tbo-filgrastim in pediatric cancer patients. [Display omitted] DisclosuresBias:Teva ratiopharm: Employment, Equity Ownership. Lammerich:Teva ratiopharm: Employment, Equity Ownership. Roth-Ben Arie:Teva Pharmaceuticals Industries: Employment. Zou:Teva Pharmaceuticals: Employment, Equity Ownership. Buchner:Teva ratiopharm: Employment, Equity Ownership.

The Effect of Neutropenia and Filgrastim (G-CSF) on Cancer Patients With Coronavirus Disease 2019 (COVID-19) Infection.

BackgroundNeutropenia is commonly encountered in cancer patients. Recombinant human granulocyte colony-stimulating factor (G-CSF, filgrastim), a cytokine that initiates proliferation and differentiation of mature granulocytes, is widely given to oncology patients to counteract neutropenia, reducing susceptibility to infection. However, the clinical impact of neutropenia and G-CSF use in cancer patients with coronavirus disease 2019 (COVID-19) remains unknown.MethodsAn observational cohort of 379 actively treated cancer patients with COVID-19 was assembled to investigate links between concurrent neutropenia and G-CSF administration on COVID-19-associated respiratory failure and death. These factors were encoded as time-dependent predictors in an extended Cox model, controlling for age and underlying cancer diagnosis. To determine whether the degree of granulocyte response to G-CSF affected outcomes, the degree of response to G-CSF, based on rise in absolute neutrophil count (ANC) 24 hours after growth factor administration, was also incorporated into a similar Cox model.ResultsIn the setting of active COVID-19 infection, outpatient receipt of G-CSF led to an increased number of hospitalizations (hazard ratio [HR]: 3.54, 95% confidence interval [CI]: 1.25–10.0, P value: .017). Furthermore, among inpatients, G-CSF administration was associated with increased need for high levels of oxygen supplementation and death (HR: 3.56, 95% CI: 1.19–10.2, P value: .024). This effect was predominantly seen in patients that exhibited a high response to G-CSF based on their ANC increase post-G-CSF administration (HR: 7.78, 95% CI: 2.05–27.9, P value: .004).ConclusionsThe potential risks versus benefits of G-CSF administration should be considered in neutropenic cancer patients with COVID-19, because G-CSF administration may lead to worsening clinical and respiratory status.

Preclinical immunogenicity testing using anti-drug antibody analysis of GX-G3, Fc-fused recombinant human granulocyte colony-stimulating factor, in rat and monkey models

Human granulocyte colony-stimulating factor (G-CSF, this study used Fc-fused recombinant G-CSF; GX-G3) is an important glycoprotein that stimulates the proliferation of granulocytes and white blood cells. Thus, G-CSF treatment has been considered as a crucial regimen to accelerate recovery from chemotherapy-induced neutropenia in cancer patients suffering from non-myeloid malignancy or acute myeloid leukemia. Despite the therapeutic advantages of G-CSF treatment, an assessment of its immunogenicity must be performed to determine whether the production of anti-G-CSF antibodies causes immune-related disorders. We optimized and validated analytical tools by adopting validation parameters for immunogenicity assessment. Using these validated tools, we analyzed serum samples from rats and monkeys injected subcutaneously with GX-G3 (1, 3 or 10 mg/kg once a week for 4 weeks followed by a 4-week recovery period) to determine immunogenicity response and toxicokinetic parameters with serum concentration of GX-G3. Several rats and monkeys were determined to be positive for anti-GX-G3 antibodies. Moreover, the immunogenicity response of GX-G3 was lower in monkeys than in rats, which was relevant to show less inhibition of toxicokinetic profiles in monkeys, at least 1 mg/kg administrated group, compared to rats. These results suggested the establishment and validation for analyzing anti-GX-G3 antibodies and measurement of serum levels of GX-G3 and anti-GX-G3 antibodies, which was related with toxicokinetic profiles. Taken together, this study provides immunogenicity assessment which is closely implicated with toxicokinetic study of GX-G3 in 4-week repeated administrated toxicological studies.

Challenges for design of aggregation-resistant variants of granulocyte colony-stimulating factor

Non-native protein aggregation is a long-standing issue in pharmaceutical biotechnology. A rational design approach was used in order to identify variants of recombinant human granulocyte colony-stimulating factor (rhG-CSF) with lower aggregation propensity at solution conditions that are typical of commercial formulation. The approach used aggregation-prone-region (APR) predictors to select single amino acid substitutions that were predicted to decrease intrinsic aggregation propensity (IAP). The results of static light scattering temperature-ramps and chemical unfolding experiments demonstrated that none of the selected variants exhibited improved aggregation resistance, and the apparent conformational stability of each variant was lower than that of WT. Aggregation studies under partly denaturing conditions suggested that the IAP of at least one variant remained unaltered. Overall, this study highlights a general challenge in designing aggregation resistance for proteins, due to the need to accurately predict both APRs and conformational stability.

Efficacy and Safety of PEG-rhG-CSF in HSC Mobilization in 71 Normal Healthy Donors for Allogeneic Hematopoietic Stem Cell Transplantation

To retrospectively analyze the efficacy and safety of pegylated recombinant human granulocyte colony-stimulating factor (PEG-rhG-CSF) in hematopoietic stem cell mobilization in 71 normal healthy donors for allogeneic hematopoietic stem cell transplantation (allo-HSCT). From March 2018 to July 2019, 71 patients received allo-HSCT in The General Hospital of Western Theater Command were enrolled in the study, a single dose of PEG-rhG-CSF was injected subcutaneously at 12 mg to all the stem cell donors. After injection for 4 days, CD34+ cell number were detected, stem cells were collected on day 4 or 5 according to the CD34+ cell number. The successful collection criteria were CD34+ cells≥2×106/kg, and the excellent collection criteria were CD34+ cells≥4×106/kg. The side effects after mobilization were observed and the collection time, the success rate, excellent rate, and times of the collection were evaluated in the donors, as well as the infused cell number, the engraftment rate, the time of engraftment, and the incidence of acute graft-versus-host disease (aGVHD) of the recipients. Seventy-one healthy stem cell donors included 39 males and 32 females with a median age of 38 (16-58) years old. The median number of CD34+ cells on day 4 was 46 (7.4-133)/μl, of which 39 cases with CD34+ cells ≥ 40/μl were collected on day 4, 28 cases with CD34+ cells 20-40/μl were collected on day 5, and 4 cases with CD34+ cells <20/μl were collected on day 5 after a salvage treatment with rhG-CSF. Sixty-five cases were collected once, while 6 cases twice. The median number of collected CD34+ cells was 6.1(3.1-18.1)×106/kg. The success collection rate was 100% (71/71), and the excellent collection rate was 81.6% (58/71). All the cases had varying degrees of muscle and bone soreness, 17 cases (23.9%) had headache, 11 cases (15.5%) had fatigue, and 3 cases (4.2%) had a mild fever. Among 71 recipients, the median number of infused mononuclear cells (MNC) was 8.3(5-23.3)×108/kg, the median number of infused CD34+ cells and CD3+ cells was 5.3(3.1-10.7)×106/kg and 1.9 (0.5-7.6)×108/kg, respectively. Among them, 68 cases (95.8%) had a stable engraftment, the median time of neutrophil engraftment was 11(8-19) days, and the median time of platelet engraftment was 12(8-23) days. Among the 68 cases who were engrafted, 15 cases (22%) had grade Ⅱ-Ⅳ aGVHD, including grade Ⅲ-Ⅳ aGVHD in 3 patients (4.4%), 2 cases (2.9%) died of severe aGVHD. For allo-HSCT donor mobilization, PEG-rh-G-CSF is effective, safe, and convenient, providing more options for HSC mobilization.

Real-world hematological adverse events in Chinese patients with advanced ovarian cancer treated with an individualized starting dose of niraparib.

BackgroundThis work set out to examine the hematological adverse events (AEs) of an individualized starting dose (ISD) of niraparib in Chinese patients with ovarian cancer (OC).MethodsThe medical records of 43 patients with OC who were treated with an ISD of niraparib at the Cancer Hospital of The University of Chinese Academy of Sciences between February 2019 and January 2020 were retrospectively reviewed. Treatment-emergent hematological AEs were analyzed.ResultsOf the 43 patients with OC, 28 (65.1%) had hematological AEs of ≥ grade 1, including thrombocytopenia (39.5%), leukopenia (37.2%), and anemia (34.9%). Ten (23.3%) patients developed grade 3/4 hematological AEs, including thrombocytopenia (11.6%), leukopenia (9.3%), and anemia (7.0%). Among the individuals who developed AEs during treatment, 9 (32.1%) patients had their treatment interrupted, with treatment being restarted in 8 (28.6%) cases, and 4 (14.3%) patients had the drug dose decreased. No deaths were reported. The median times to the occurrence of any-grade leukopenia, anemia, and thrombocytopenia were 30 (range, 7 to 162), 34 (range, 7 to 108), and 20 (range, 13 to 180) days, respectively. Most AEs occurred within the first 3 months of treatment (93.8% leukopenia, 80.0% anemia, and 76.5% thrombocytopenia). Treatments for AEs included supplementation of recombinant human granulocyte colony-stimulating factor (n=5, 17.9%), erythrocytes (n=2, 7.1%), and recombinant human thrombopoietin (n=5, 17.9%).ConclusionsThe incidence of adverse hematological reactions to an ISD of niraparib in Chinese patients with advanced OC is relatively lower in the real world than in the phase III clinical trials PRIMA (also an ISD) and NOVA. These hematological AEs can be managed through dose adjustment and symptomatic therapy.

The Efficacy of Moxibustion for Breast Cancer Patients with Chemotherapy-Induced Myelosuppression during Adjuvant Chemotherapy: A Randomized Controlled Study.

Objective The randomized controlled clinical trial aims to investigate the clinical efficacy of moxibustion for breast cancer patients with chemotherapy-induced myelosuppression (CIM) during adjuvant chemotherapy. Methods Surgically resected breast cancer patients were randomly divided into the moxibustion group (MOX; n = 48) and control group (CON; n = 44). Routine adjuvant chemotherapy (every 21 days, 4–8 cycles) and supportive recombinant human granulocyte colony-stimulating factor were given to both groups, while MOX received an additional moxibustion treatment (once daily after each cycle of chemotherapy). Primary endpoints included the grade of myelosuppression in terms of white blood cell (WBC) and absolute neutrophil count (ANC) and the incidence of myelosuppression-related serious adverse events (SAEs). Other measures included treatment compliance, adverse events (AEs), and survival. Results WBC counts were generally higher in MOX and were dramatically higher than those in CON at the 7th course of chemotherapy (P=0.008), while grade 1 ANC reduction was dramatically lower than that in CON at the 7thcourse of chemotherapy (P=0.006). These effects were particularly significant in patients receiving anthracycline-taxane combination regimens. Moreover, MOX had fewer febrile neutropenia than CON (P=0.051). MOX demonstrated a lower incidence of grade 3–4 myelosuppression (P < 0.05). AEs including grade 2–3 severe nausea, various kinds of pains, and vertigo occurred less frequently in MOX (P < 0.05). No difference in survival was observed between the two groups (P > 0.05). Conclusion Moxibustion is effective for treating CIM in breast cancer patients during adjuvant chemotherapy, especially for patients receiving high-dose, long-term, and combined chemotherapy regimens. Moxibustion can reduce the incidence of myelosuppression-related SAE and improve the compliance and safety of chemotherapy in breast cancer.

Optimizing Granulocyte Colony-Stimulating Factor Transcript for Enhanced Expression in Escherichia coli.

The human granulocyte colony-stimulating factor (G-CSF) is a hematopoietic growth factor used to prevent and treat neutropenia. G-CSF stimulates the bone marrow to produce infection-fighting granulocytes. Food and Drug Administration of the United States approved G-CSF in 1991 and its PEGylated version in 2002 as a prophylactic and therapeutic measure against neutropenia. Recombinant human G-CSF is produced in surrogate host Escherichia coli and is PEGylated at N-terminal. Besides neutropenia, G-CSF is also used in bone marrow transplantation for the mobilization and maturation of peripheral blood stem cells. Considering the requirement of producing G-CSF therapeutic in large quantities, construct designing for high expression is critical for the biopharmaceutical and industrial application. Earlier studies have employed approaches such as codon optimization, use of strong promoters, employment of protein tags, secretion signals, optimization of protein folding, etc., for increasing expression and yield of therapeutic proteins. In this study, it was observed that mRNA transcribed from the native human cDNA of G-CSF and the codon-optimized variant leads to low protein expression in E. coli. To understand the underlying reasons, the mRNA secondary structure of the 5′ end of the G-CSF transcript was analyzed. This analysis revealed the presence of stable secondary structures at the 5′ end of the G-CSF transcript, arising from the native human gene and even from the codon-optimized sequence. These secondary structures were disrupted through translationally silent mutations within the first 24 nucleotides of the transcript without affecting the protein sequence. Interestingly, through this approach, the G-CSF protein expression was increased 60 folds as compared to native G-CSF construct. We believe that these findings create a roadmap for optimization of G-CSF transcript for enhanced expression in E. coli and could be employed to increase the expression of other therapeutic proteins.

Abstract PS9-59: Pooled efficacy analysis from two phase 3 studies in patients receiving eflapegrastim, a novel, long-acting granulocyte-colony stimulating factor, following TC for early-stage breast cancer

Abstract Background: Eflapegrastim (Rolontis®, Efla) represents the first novel, long-acting granulocyte-colony stimulating factor (G-CSF) to be introduced in more than 15 years. Efla consists of a recombinant human G-CSF analog conjugated to a human IgG4 Fc fragment via a polyethylene glycol linker. Preclinical, clinical, and pharmacodynamic/pharmacokinetic data have shown increased potency for Efla versus pegfilgrastim (Peg). Both independent, randomized Phase 3 studies comparing Efla and Peg for prophylaxis of chemotherapy-induced neutropenia in patients with early-stage breast cancer (ESBC) met the primary endpoint of non-inferiority in duration of severe neutropenia (SN; ANC&amp;lt;0.5 × 109/L) (p&amp;lt;0.001) for Efla vs Peg in all 4 treatment cycles. Additionally, one of the studies exhibited a statistically significant reduction in the relative risk of SN in Cycle 1 with Efla. Here we provide a pooled analysis across the two pivotal studies comparing Efla vs Peg for SN in various subgroups. Methods: Patients with ESBC, who were candidates for adjuvant or neoadjuvant chemotherapy, were randomized 1:1 in two open-label Phase 3 studies to fixed-dose Efla (3.6 mg G-CSF) or standard Peg (6 mg G-CSF) administered on Day 2 following TC (docetaxel/cyclophosphamide) for a total of 4 cycles. ANCs were collected daily in Cycle 1 and 5 times in Cycles 2-4. SN was evaluated between treatment groups in Cycle 1 using Fisher’s exact test at 5% level of significance and was analyzed using multivariate logistic and Cox proportional hazards regression models. Results: A total of 643 patients who received either Efla (n=314) or Peg (n=329) were included in the analysis. The two treatment groups were well balanced for demographics and baseline characteristics. The mean age was 59 years, 38% were ≥65 years old, and 54% weighed &amp;gt;75kg. The safety profiles, including AEs and discontinuations, for Efla and Peg were comparable, and &amp;gt;99% of all patients received full dose of TC on schedule. The majority (67%) of patients with SN experienced a 1 day duration, occurring between Days 7 and 8 after TC. Mean duration of SN for Efla was statistically lower than for Peg (0.24 vs. 0.36 days; p=0.029). The above statistical significance was maintained for Efla after adjusting for demographic and baseline characteristics, namely age, weight, enrolling geographical region, and treatment setting in a multivariate model. Similarly, the incidence of SN for Efla was statistically lower than Peg in Cycle 1 (17.5% vs 24%; relative risk reduction [RRR]=27%; p=0.043). Univariate analysis of the incidence of SN showed a significant risk reduction in favor of Efla (8.6% vs 14.1%; p=0.034) for patients weighing &amp;gt;75kg (p=0.034). Multivariate analysis of SN showed significant odds ratio of SN for age ≥65 years and baseline ANC &amp;gt;6 × 109/L in favor of Efla (OR=0.42 and 0.39, respectively). The incidence of SN in Cycles 2-4 was comparable between treatment groups. Also, the incidence of febrile neutropenia and neutropenic complications was similar with &amp;lt;5% in each treatment group. No leukocytosis, splenic rupture, or anaphylaxis was reported in any patient receiving Efla or Peg. Conclusion: A pooled analysis of two, randomized Phase 3 studies evaluating Efla vs Peg, administered once-per-cycle for prophylaxis of SN, showed Efla and Peg had similar safety profiles with Efla demonstrating a statistically significant risk reduction in SN overall and in patients weighing &amp;gt;75kg. Eflapegrastim is a novel, long-acting and potent recombinant human G-CSF which may provide an attractive option in supporting patients at risk for SN-related complications. Citation Format: Lee S Schwartzberg, Gajanan Bhat, Alvaro Restrepo, Osama Hlalah, Inderjit Mehmi, Yong Wha Moon, Seungjae Baek, Shanta Chawla, Francois Lebel, Patrick Wayne Cobb. Pooled efficacy analysis from two phase 3 studies in patients receiving eflapegrastim, a novel, long-acting granulocyte-colony stimulating factor, following TC for early-stage breast cancer [abstract]. In: Proceedings of the 2020 San Antonio Breast Cancer Virtual Symposium; 2020 Dec 8-11; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2021;81(4 Suppl):Abstract nr PS9-59.

Safety and efficacy of administering reduced doses of pegylated recombinant human granulocyte-colony stimulating factors in patients treated with cisplatin and etoposide for small cell carcinoma: A retrospective study.

BackgroundThe aim of this study was to discuss the safety and efficacy of administering reduced doses (3 mg) of pegylated recombinant human granulocyte‐colony stimulating factor (PEG‐rhG‐CSF) at approximately 24 h or up to three days following treatment with etoposide and cisplatin (EP).MethodsA total of 104 cycles from 31 patients were divided into a PEG‐rhG‐CSF prophylaxis group (PP‐Group) and a control group (No‐PP‐Group). The PP‐Group received a reduced dose of 3 mg of PEG‐rhG‐CSF within a minimum of 15 h and a maximum of 72 h following EP chemotherapy, while the rest did not receive any G‐CSF prophylaxis (No‐PP‐Group). For both groups, complete blood counts, incidence of febrile neutropenia (FN), grade III or IV neutropenia, and the use of antibiotics to treat neutropenia were recorded.ResultsThere was statistically no significant difference in the incidence of FN (0% vs. 1.4%, p = 1), antibiotic use due to neutropenia (0% vs. 2.7%, p = 0.881), estimated lowest mean marginal (EM) platelet (106.56 × 109/L vs. 127.70 × 109/L, p = 0.056) and hemoglobin (110.48 g/L vs. 110.14 g/L, p = 0.906) levels between the two groups. However, when compared with the No‐PP‐group, the white blood cell count in the PP‐group was significantly higher (EM means: 4.95 × 109/L vs. 2.80 × 109/L, p < 0.01), while the incidence of grade III or IV neutropenia was significantly lower (9.1% vs. 68.1%, p < 0.01).ConclusionsThe administration of a low dose (3 mg) of PEG‐rhG‐CSF within approximately 24 h or up to three days following EP treatment is safe and effective at reducing the risk of neutropenia. These findings bring a more flexible administration interval between PEG‐rhG‐CSF and EP treatment.

Abstract OT-06-01: Open-label, phase 1 study to evaluate duration of severe neutropenia after same-day dosing of eflapegrastim in patients with breast cancer receiving docetaxel and cyclophosphamide (NCT04187898)

Abstract Background: Eflapegrastim (Rolontis®, Efla) is a long-acting granulocyte-colony stimulating factor (G-CSF), consisting of a recombinant human G-CSF analog conjugated to a human IgG4 Fc fragment via a short polyethylene glycol linker. Efla is not a biosimilar and represents the first myeloid growth factor innovation in more than 15 years. In preclinical studies with chemotherapy-induced neutropenic rats, Efla showed ~3-fold higher exposure in serum and higher exposure in bone marrow at similar doses compared to pegfilgrastim (Peg). The duration of neutropenia (DN) was shown to be significantly shorter with Efla vs Peg when administered on the same day and 24-hours post-chemotherapy. Additionally, the DN after Efla administered on the same day as chemotherapy was similar to the DN 24 hours post-chemotherapy. Moreover, in two Phase 3 studies that randomized a total of 643 patients with early-stage breast cancer (ESBC) to either Efla (3.6 mg G-CSF n=314) or Peg (6 mg G-CSF n=329) given ~ 24 hours after docetaxel and cyclophosphamide (TC) administration, the duration of severe neutropenia (DSN) was statistically noninferior in patients treated with Efla compared to Peg. As a standard of practice, G-CSF products require administration 24 hours after chemotherapy. Since Efla preclinical and clinical results suggest that the increased activity of Efla may provide effective prophylaxis against chemotherapy-induced neutropenia when administered on the same day as chemotherapy, the purpose of this study is to assess the feasibility of Efla same-day (3 different dosing timepoints) in patients receiving TC for treatment of ESBC. Trial Design: This is a randomized, schedule finding, multicenter, Phase 1, open-label study evaluating the same-day administration of 13.2 mg/0.6 mL Efla (3.6 mg G-CSF) following IV infusion of docetaxel (75 mg/m2) and cyclophosphamide (600 mg/m2) in patients with ESBC. Patients will be randomized 1:1:1 to Efla dose schedules of 0.5, 3, and 5 hours after TC. The primary endpoint is DSN (ANC &amp;lt;0.5×109/L) in Cycle 1. The secondary endpoints for Cycle 1 administration include the incidence of SN, time to recovery from SN, incidence of Grade 3 febrile neutropenia, incidence of neutropenic complications, and pharmacokinetics (PK) of Efla. Blood for hematology will be drawn daily for the first 10 days and then on Day 1 of Cycles 2-4. Eligibility Criteria: This study is enrolling histologically confirmed (operable stage I-IIIA) patients with ESBC, who are &amp;gt;18 years of age, are candidates for neoadjuvant or adjuvant TC chemotherapy, have an ECOG of &amp;lt;2, with adequate hematological, renal, and hepatic function. Patients will be excluded if they have a known sensitivity or previous reaction to E. coli derived products, exposure to a G-CSF agent within 3 months, history of bone marrow or hematopoietic stem cell transplant, radiotherapy or surgery within 30 days, are pregnant, or are breast-feeding. Statistical Methods: A sample size of 15 patients per dosing schedule arm was determined to provide adequate precision for the 95% CI of the DSN and secondary endpoints, including PK parameters. The sample size produces a 2-sided 95% CI with a distance from the mean DSN to the limits that is equal to 0.554 using t-distribution when the estimated standard deviation is 1.0 days. A safety evaluation will be performed once the first three patients in each arm have completed Cycle 1. Target Accrual: 45 patients (15 subjects/arm). Enrollment began in April 2020. Citation Format: Lee S. Schwartzberg, Jawad Francis, Hlalah Osama, Manuel Modiano, Jayaram Bharadwaj, Shanta Chawla, Gajanan Bhat, Francois Lebel, Nishan Tchekmedyian. Open-label, phase 1 study to evaluate duration of severe neutropenia after same-day dosing of eflapegrastim in patients with breast cancer receiving docetaxel and cyclophosphamide (NCT04187898) [abstract]. In: Proceedings of the 2020 San Antonio Breast Cancer Virtual Symposium; 2020 Dec 8-11; San Antonio, TX. Philadelphia (PA): AACR; Cancer Res 2021;81(4 Suppl):Abstract nr OT-06-01.

Potentiation of Lupus Activity by Granulocyte Colony-Stimulating Factor

Recombinant human granulocyte colony-stimulating factor (G-CSF) is commonly used to accelerate recovery of neutropenia in patients with marrow suppression. We hereby report a patient with systemic lupus erythematosus (SLE) who developed diffuse lupus nephritis and impending cytokine storm after G-CSF therapy. The exact mechanisms by which G-CSF leads to lupus flares remains enigmatic. Increased neutrophil apoptosis and release of cytokines have been postulated. The use of G-CSF in patients with autoimmune disease should be cautious.

Production of recombinant human G-CSF from non-classical inclusion bodies in Escherichia coli.

Recombinant granulocyte colony-stimulating factor (G-CSF) protein produced in Escherichia coli has been widely used for the treatment of neutropenia induced by chemotherapy for decades. In E. coli cells, G-CSF is usually expressed as inactive inclusion bodies, which requires costly and inefficient denaturation and refolding steps to obtain the protein in its active form. However, following the findings of previous studies, we here successfully produced G-CSF in E. coli as non-classical inclusion bodies (ncIBs), which contained likely correctly folded protein. The ncIBs were easily dissolved in 0.2% N-lauroylsarcosine solution and then directly applied to a Ni-NTA affinity chromatography column to get G-CSF with high purity (> 90%). The obtained G-CSF was demonstrated to have a similar bioactivity with the well-known G-CSF containing product Neupogen (Amgen, Switzerland). Our finding clearly verified that the G-CSF production from ncIBs is a feasible approach to improve the yield and lower the cost of G-CSF manufacturing process.

PEG-rhG-CSF Use Reduces Glucose Level Significantly in Cancer Patients Receiving Chemotherapy

Background: In patients receiving anti-cancer chemotherapy, polyethylene glycolated recombinant human granulocyte-colony stimulating factor (PEG-rhG-CSF) was used for prophylaxis of chemotherapy-induced neutropenia. However, the side effect of PEG-rhG-CSF use on fasting blood glucose (FBG) level remains unclear. Materials and Methods: Cancer patients receiving chemotherapy and PEG-rhG-CSF were enrolled in our study. Baseline glucose (Glucose 1) was measured before PEG-rhG-CSF use, a second FBG test (Glucose 2) was performed after PEG-rhG-CSF use. Mean glucose levels were compared using t test. Results: The time interval between PEG-rhG-CSF use and the second glucose test was 2.4±1.5 days. The mean Glucose 1 was 5.18±0.53 mmol/L, and Glucose 2 was 3.80±1.13 mmol/L. Statistical analysis showed a significant difference between Glucose 1 and 2 existed (P&lt;0.001). Conclusion: Our study identifies a hypoglycemic side effect of PEG-rhG-CSF occurs in cancer patients undergoing anti-cancer chemotherapy. Our results highlight the caution required when using PEG-rhG-CSF for prophylaxis of chemotherapy-induced neutropenia.

Allogeneic Blood Stem Cell Transplantation: Considerations for Donors

AbstractAllogeneic transplantation of cytokine-mobilized peripheral blood stem cells (PBSCs) is now being increasingly performed, but safety considerations for hematologically normal PBSC donors have not been fully addressed. Progenitors are generally mobilized for collection from normal donors using recombinant human granulocyte colony-stimulating factor (rhG-CSF). Although the short-term safety profile of rhG-CSF seems acceptable, experience remains limited and its optimal dose and schedule have not been defined. Minimal data exist regarding long-term safety of rhG-CSF, primarily derived from experience in patients with chronic neutropenia or cancer. An “ad hoc” workshop was recently convened among a group of investigators actively involved in the field of allogeneic stem cell transplantation to discuss the safety issues pertaining to normal PBSC donors. There was agreement on the following points: (1) On the basis of available data, it appears that rhG-CSF treatment and PBSC collection have an acceptable short-term safety profile in normal donors. However, the need for continued safety monitoring was recognized. (2) rhG-CSF doses up to 10 μg/kg/d show a consistent dose-response relationship with the mobilization (and collection) of CD34+ progenitor cells, and this dose is acceptable for routine clinical use. Whether higher doses are superior (or cost effective) remains to be determined, and they may produce more severe side effects. The potential risks of marked leukocytosis (arbitrarily defined as a leukocyte count of more than 70 × 109/L) have been a concern, and rhG-CSF dose reduction is performed by many centers to maintain leukocyte counts below this level. (3) Transient post donation cytopenias, involving granulocytes, lymphocytes, and platelets, may occur and are at least partly related to the leukapheresis procedure. These are generally asymptomatic and self-limited; follow-up blood counts are not necessarily required. Reinfusion of autologous platelet-rich plasma should be considered for donors with expected postdonation thrombocytopenia (platelet count < 80 to 100 × 109/L). (4) Donors should meet the eligibility criteria which apply to donors of apheresis platelets, with the exception that pediatric donors may also be considered. Any deviation from these criteria should have supporting documentation. There is insufficient information at this time to clearly establish definite contraindications for PBSC collection in a hematologically normal donor. Potential contraindications include the presence of inflammatory, autoimmune, or rheumatologic disorders, as well as atherosclerotic or cerebrovascular disease. (5) The creation of an International PBSC Donor Registry is desirable to facilitate monitoring the long-term effects of the procedure. Individual institutions or donor centers are encouraged to establish their own PBSC donor follow-up system, preferably with a standardized approach to data collection.

A Randomized Controlled Trial of Filgrastim During Remission Induction and Consolidation Chemotherapy for Adults With Acute Lymphoblastic Leukemia: CALGB Study 9111

Recombinant human granulocyte colony-stimulating factor (G-CSF; filgrastim) shortens the time to neutrophil recovery after intensive chemotherapy, but its role in the treatment of adults with acute lymphoblastic leukemia (ALL) is uncertain. We randomly assigned 198 adults with untreated ALL (median age, 35 years; range, 16 to 83) to receive either placebo or G-CSF (5 μg/kg/d) subcutaneously, beginning 4 days after starting intensive remission induction chemotherapy and continuing until the neutrophil count was ≥1,000/μL for 2 days. The study assignment was unblinded as individual patients achieved a complete remission (CR). Patients initially assigned to G-CSF then continued to receive G-CSF through 2 monthly courses of consolidation therapy. Patients assigned to placebo received no further study drug. The median time to recover neutrophils ≥1,000/μL during the remission induction course was 16 days (interquartile range [IQR], 15 to 18 days) for the patients assigned to receive G-CSF and 22 days (IQR, 19 to 29 days) for the patients assigned to placebo (P< .001). Patients in the G-CSF group had significantly shorter durations of neutropenia (<1,000/μL) and thrombocytopenia (<50,000/μL) and fewer days in the hospital (median, 22 daysv 28 days; P = .02) compared with patients receiving placebo. The patients assigned to receive G-CSF had a higher CR rate and fewer deaths during remission induction than did those receiving placebo (P = .04 by the chi-square test for trend). During Courses IIA and IIB of consolidation treatment, patients in the G-CSF group had significantly more rapid recovery of neutrophils ≥1,000/μL than did the control group by approximately 6 to 9 days. However, the patients in the G-CSF group did not complete the planned first 3 months of chemotherapy any more rapidly than did the patients in the placebo group. Overall toxicity was not lessened by the use of G-CSF. After a median follow-up of 4.7 years, there were no significant differences in either the disease-free survival (P = .53) or the overall survival (P = .25) for the patients assigned to G-CSF (medians, 2.3 years and 2.4 years, respectively) compared with those assigned to placebo (medians, 1.7 and 1.8 years, respectively). Adults who received intensive chemotherapy for ALL benefited from G-CSF treatment, but its use did not markedly affect the ultimate outcome.© 1998 by The American Society of Hematology.

Use of glycosylated recombinant human G-CSF (lenograstim) during and/or after induction chemotherapy in patients 61 years of age and older with acute myeloid leukemia: final results of AML-13, a randomized phase-3 study

The role of glycosylated recombinant human granulocyte colony-stimulating factor (G-CSF) in the induction treatment of older adults with acute myeloid leukemia (AML) is still uncertain. In this trial, a total of 722 patients with newly diagnosed AML, median age 68 years, were randomized into 4 treatment arms: (A) no G-CSF; (B) G-CSF during chemotherapy; (C) G-CSF after chemotherapy until day 28 or recovery of polymorphonuclear leukocytes; and (D) G-CSF during and after chemotherapy. The complete remission (CR) rate was 48.9% in group A, 52.2% in group B, 48.3% in group C, and 64.4% in group D. Analysis according to the 2 x 2 factorial design indicated that the CR rate was significantly higher in patients who received G-CSF during chemotherapy (58.3% for groups B + D vs 48.6% for groups A + C; P = .009), whereas no significant difference was observed between groups A + B and C + D (50.6% vs 56.4%, P = .12). In terms of overall survival, no significant differences were observed between the various groups. Patients who received G-CSF after chemotherapy had a shorter time to neutrophil recovery (median, 20 vs 25 days; P < .001) and a shorter hospitalization (mean, 27.2 vs 29.7 days; P < .001). We conclude that although priming with G-CSF can improve the CR rate, the use of G-CSF during and/or after chemotherapy has no effect on the long-term outcome of AML in older patients.