mRNA Recognition Research Articles

Xmas-2 protein, a core protein of the TREX-2 mRNA export complex, is not determined the specificity of <i>Ras2</i> mRNA binding by the complex

The TREX-2 complex of eukaryotes is responsible for the export of a wide range of mRNAs from the nucleus to the cytoplasm. Previously, we showed that a subunit of the D. melanogaster TREX-2 complex, the PCID2 protein, has a domain that specifically interacts with RNA. However, it remains unknown whether other components of the complex are involved in interaction with and recognition of the target mRNA. In the present work, we determined the role of Xmas-2, the core structural subunit of the complex, in the specific recognition of ras2 mRNA fragments. In this work, we showed that Xmas-2, interacts with ras2 mRNA independently of other subunits of the complex. We showed that RNA-binding domains are located in both the N-terminal domain and the C-terminal domain of Xmas-2. However, the interaction of the protein with ras2 mRNA fragments is independent of RNA sequence and structure and is nonspecific. Thus, the Xmas-2 subunit is not involved in the recognition of specific RNA sequences by the complex.

Point mutations in the M-domainof PCID2 impair its functionin mRNA exportin <i>Drosophila melanogaster</i>

PCID2 protein is a component of the eukaryotic TREX-2 complex responsible for mRNA export from the nucleus to the cytoplasm. Previously, we showed that PCID2 of D. melanogaster is involved in specific mRNA recognition and identified key amino acids responsible for interaction with the RNA of the ras2 gene. In this work, we show that point mutations of these amino acids disrupt the interaction of the protein with cellular RNA and the export of polyA-containing mRNA from the nucleus to the cytoplasm in Drosophila cells.

Visualizing Macrophage Polarization through Fluorescent mRNA Profiling.

Macrophages, known for their phenotypic plasticity, play a critical role in maintaining homeostasis and inflammation-related pathogenesis. Although identifying diverse macrophage phenotypes holds promise for enhancing diagnoses and treatments of diseases mediated by macrophages, existing methodologies for differentiating macrophages often lack precision. They are limited by the cumbersome procedures that require large-scale equipment, such as flow cytometry and transcriptomic analysis. In this context, we have engineered fluorescent polyadenine (polyA)-mediated sticky flares that enable practical visualization of macrophages. This technology facilitates the highly sensitive detection of macrophage phenotypes through the specific recognition of intracellular mRNAs, permitting in situ imaging. Our approach demonstrates the potential for determining macrophage polarization status at the single-cell level within dynamic immune microenvironments, thereby providing crucial diagnostic and prognostic information that could guide the development of tailored treatments for macrophage-related diseases in personalized medicine.

Xmas-2 Protein, the Core Protein of the TREX-2 mRNA Export Complex, Does not Determine the Specificity of ras2 mRNA Binding by the Complex.

The TREX-2 complex of eukaryotes is responsible for the export of a wide range of mRNAs from the nucleus to the cytoplasm. Previously, we showed that a subunit of the D. melanogaster TREX-2 complex, the PCID2 protein, has a domain that specifically interacts with RNA. However, it remains unknown whether other components of the complex are involved in interaction with and recognition of the target mRNA. In the present study, we determined the role of Xmas-2, the core structural subunit of the complex, in the specific recognition of ras2 mRNA fragments. In this work, we showed that Xmas-2 interacts with ras2 mRNA independently of other subunits of the complex. We showed that RNA-binding domains are located in both the N-terminal domain and the C-terminal domain of Xmas-2. However, the interaction of the protein with ras2 mRNA fragments is independent of RNA sequence and structure and is nonspecific. Thus, the Xmas-2 subunit is not involved in the recognition of specific RNA sequences by the complex.

A dynamic compositional equilibrium governs mRNA recognition by eIF3.

Eukaryotic translation initiation factor (eIF) 3 is a multi-subunit protein complex that binds both ribosomes and messenger RNAs (mRNAs) to drive a diverse set of mechanistic steps during translation of an mRNA into the protein it encodes. And yet, a unifying framework explaining how eIF3 performs these numerous activities is lacking. Using single-molecule light scattering microscopy, we demonstrate that Saccharomyces cerevisiae eIF3 is in dynamic exchange between the full complex, subcomplexes, and subunits. By extending our microscopy approach to an in vitro reconstituted eIF3 and complementing it with biochemical assays, we define the subspecies comprising this dynamic compositional equilibrium and show that mRNA binding by eIF3 is not driven by the full complex but instead by the eIF3a subunit within eIF3a-containing subcomplexes. Our findings provide a mechanistic model for the role of eIF3 in mRNA recruitment and establish a mechanistic framework for explaining and investigating the other activities of eIF3.

Point Mutations in the M Domain of PCID2 Impair Its Function in mRNA Export in Drosophila melanogaster.

The PCID2 protein is a component of the eukaryotic TREX-2 complex, which is responsible for mRNA export from the nucleus into the cytoplasm. We have previously shown that Drosophila melanogaster PCID2 is involved in specific mRNA recognition and identified the key amino acids responsible for its interaction with the ras2 RNA. In this work, point mutations of the amino acids were shown to disrupt the PCID2 interaction with cell RNAs and to distort the export of polyA-containing mRNAs from the nucleus into the cytoplasm in Drosophila cells.

METTL3/IGF2BP1 influences the development of non-small-cell lung cancer by mediating m6A methylation modification of TRPV1.

Methyltransferase 3 (METTL3) accelerates N6-methyladenosine (m6A) modifications and affects cancer progression, including non-small-cell lung cancer (NSCLC). In this study, we aimed to explore the regulatory mechanisms of METTL3 underling NSCLC. Immunohistochemical assay, quantitative real-time polymerase chain reaction (qRT-PCR)assay, and western blot assay were conducted for gene expression. MTT assay and colony formation assay were performed to explore cell proliferation capacity. Cell apoptosis and THP-1 cell polarization were estimated by flow cytometry analysis. Cell migration and invasion capacities were evaluated by transwell assay. Methylated RNA immunoprecipitation assay, dual-luciferase reporter assay, actinomycin D treatment and RIP assay were performed to analyze the relationships of METTL3, insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), and transient receptor potential cation channel subfamily V member 1 (TRPV1). The functions of METTL3 and TRPV1 in vivo were investigated through establishing the murine xenograft model. TRPV1 expression was upregulated in NSCLC and related poor prognosis. TRPV1 silencing inhibited NSCLC cell growth and metastasis, induced NSCLC cell apoptosis, and repressed M2 macrophage polarization. The results showed that METTL3 and IGF2BP1 could regulate TRPV1 expression through m6A methylation modification. Moreover, METTL3 deficiency inhibited NSCLC cell growth, metastasis, and M2 macrophage polarization and facilitated NSCLC cell apoptosis, while TRPV1 overexpression restored the impacts. In addition, METTL3 knockdown restrained tumor growth in vivo via regulating TRPV1 expression. METTL3 bound to IGF2BP1 and enhanced IGF2BP1's m6A recognition of TRPV1 mRNA, thereby promoting NSCLC cell growth and metastasis, and inhibiting M2 macrophage polarization.

MDB-104. TARGETING Y BOX BINDING PROTEIN (YBX1) IN PEDIATRIC MEDULLOBLASTOMA

Abstract Medulloblastoma is the most common malignant pediatric brain tumor, with some patients having abysmal survival despite an intense therapeutic regimen. A significant barrier to effective outcomes is cell-intrinsic resistance to chemo- and radio- therapy. Using a batch-normalized bulk RNA-seq dataset (GSE124814) comprised of 1350 MB samples and 291 normal cerebella, we reveal upregulation of Y-box binding protein 1 (YBX1) in MB compared to normal cerebellum. Further analysis of this dataset and others demonstrates a significant correlation between MYC and YBX1 expression in G3 tumors. Proteomics analysis also reveals higher YBX1 in G3 tumors characterized by hyperstability of MYC. Using a well-established ex vivo model, we demonstrate increased YBX1 expression as normal cerebellar progenitor cells transition to tumorigenic G3 MB stem-like cells. Deletion of YBX1 in these progenitor cells limits tumorigenesis suggesting a requirement for YBX1 in tumor initiation. We utilized an orthogonal pharmacogenetic approach to inhibit YBX1 and determine its effects on G3 MB tumor biology. Genetic depletion of YBX1 significantly reduced cellular proliferation and antagonized MYC expression in vitro. Orthotopic implantation of these YBX1KO G3 MB cells leads to increased tumor latency and animal survival. Transcriptomic analysis reveals a de-repression of neuronal target genes as well as suppression of MYC-activated genes. Evaluation of SU056, a YBX1 targeting small molecule, revealed both single agent efficacy as well as synergism with chemo- and radio- therapy. Further analysis revealed efficacy in SHH MB, even in tumors with mutant p53, suggesting cross-subgroup use for SU056. In silico docking identified binding of SU056 in the mRNA recognition domain of YBX1. Disruption of YBX1-RNA binding impacts the stability of known oncogenic transcripts, important for tumorigenesis and progression. Our findings corroborate previous identification of YBX1 as a chemoresistance factor and validate pre-clinical targeting of YBX1 to improve patient outcomes.

Deletion of 82-85 N-Terminal Residues in SARS-CoV-2 Nsp1 Restricts Virus Replication.

Non-structural protein 1 (Nsp1) represents one of the most crucial SARS-CoV-2 virulence factors by inhibiting the translation of host mRNAs and promoting their degradation. We selected naturally occurring virus lineages with specific Nsp1 deletions located at both the N- and C-terminus of the protein. Our data provide new insights into how Nsp1 coordinates these functions on host and viral mRNA recognition. Residues 82-85 in the N-terminal part of Nsp1 likely play a role in docking the 40S mRNA entry channel, preserving the inhibition of host gene expression without affecting cellular mRNA decay. Furthermore, this domain prevents viral mRNAs containing the 5'-leader sequence to escape translational repression. These findings support the presence of distinct domains within the Nsp1 protein that differentially modulate mRNA recognition, translation and turnover. These insights have implications for the development of drugs targeting viral proteins and provides new evidences of how specific mutations in SARS-CoV-2 Nsp1 could attenuate the virus.

Molecular mechanism of specific HLA-A mRNA recognition by the RNA-binding-protein hMEX3B to promote tumor immune escape

Immunotherapy, including immune checkpoint inhibitors and adoptive cell transfer, has obtained great progress, but their efficiencies vary among patients due to the genetic and epigenetic differences. Human MEX3B (hMEX3B) protein is an RNA-binding protein that contains two KH domains at the N-terminus and a RING domain at its C-terminus, which has the activity of E3 ubiquitin ligase and is essential for RNA degradation. Current evidence suggests that hMEX3B is involved in many important biological processes, including tumor immune evasion and HLA-A regulation, but the sequence of substrate RNA recognized by hMEX3B and the functional molecular mechanisms are unclear. Here, we first screened the optimized hMEX3B binding sequence on the HLA-A mRNA and reported that the two tandem KH domains can bind with their substrate one hundred times more than the individual KH domains. We systematically investigated the binding characteristics between the two KH domains and their RNA substrates by nuclear magnetic resonance (NMR). Based on this information and the small-angle X-ray scattering (SAXS) data, we used molecular dynamics simulations to obtain structural models of KH domains in complex with their corresponding RNAs. By analyzing the models, we noticed that on the KH domains’ variable loops, there were two pairs of threonines and arginines that can disrupt the recognition of the RNA completely, and this influence had also been verified both in vitro and in vivo. Finally, we presented a functional model of the hMEX3B protein, which indicated that hMEX3B regulated the degradation of its substrate mRNAs in many biological processes. Taken together, our research illustrated how the hMEX3B protein played a key role in translation inhibition during the immune response to tumor cells and provided an idea and a lead for the study of the molecular mechanism and function of other MEX3 family proteins.

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

Activable Photodynamic DNA Probe with an "AND" Logic Gate for Precision Skin Cancer Therapy.

Photodynamic therapy (PDT) has emerged as a promising approach for squamous cell carcinoma treatment but hindered by tumor hypoxia, acquired resistance, phototoxicity, and so on. To address these issues, we developed a smart strategy utilizing activable photosensitizers delivered by an aptamer-functionalized DNA probe (ADP). The ADP incorporated an AS1411 aptamer for tumor targeting and a linear antisense oligonucleotide (ASO) for recognition of Survivin mRNA. In the absence of the target, PDT remained quenched, thereby avoiding phototoxicity during circulation and nonselective distribution. With the aid of the aptamer, ADP achieved selective targeting of tumors. Upon internalization, ADP targeted recognized Survivin mRNA, triggering PDT activation, and releasing ASO to down-regulate Survivin expression and reverse tumor resistance. Consequently, the activable photosensitizers exhibited an "AND" logic gate, combining tumor-targeting delivery and tumor-related gene activation, thus enhancing its specificity. Additionally, the incorporation of hemin into the ADP provided catalase activity, converting tumor-abundant H2O2 into O2, thereby ameliorating tumor hypoxia. The resulting functionalized G-quadruplex/hemin-DNA probe complex demonstrated targeted delivery and activation, minimized side effects, and enhanced PDT efficacy in both xenograft tumor-bearing mice and patient-derived xenograft models. This study offers a unique and promising platform for efficient and safe PDT, thus holding great potential for future clinical translation and improved cancer therapy.

Characterization of the mIF4G Domains in the RNA Surveillance Protein Upf2p.

Thirty percent of all mutations causing human disease generate mRNAs with premature termination codons (PTCs). Recognition and degradation of these PTC-containing mRNAs is carried out by the mechanism known as nonsense-mediated mRNA decay (NMD). Upf2 is a scaffold protein known to be a central component of the NMD surveillance pathway. It harbors three middle domains of eukaryotic initiation factor 4G (mIF4G-1, mIF4G-2, mIF4G-3) in its N-terminal region that are potentially important in regulating the surveillance pathway. In this study, we defined regions within the mIF4G-1 and mIF4G-2 that are required for proper function of Upf2p in NMD and translation termination in Saccharomyces cerevisiae. In addition, we narrowed down the activity of these regions to an aspartic acid (D59) in mIF4G-1 that is important for NMD activity and translation termination accuracy. Taken together, these studies suggest that inherently charged residues within mIF4G-1 of Upf2p play a role in the regulation of the NMD surveillance mechanism in S. cerevisiae.

NIR light-controlled DNA nanodevice for amplified mRNA imaging and precise gene therapy

Accurately delivering antisense oligonucleotides (ASOs) to tumor cells for gene therapy poses a significant challenge. To address this issue, we develop a NIR light-activable DNA nanodevice to target survivin mRNA and simultaneously release ASOs in tumor cells, which allows high-precision spatiotemporal imaging and efficient gene therapy. The concept is based on upconversion nanoparticles, which can convert NIR light into UV emissions to activate an entropy-driven DNA walking system for mRNA recognition in tumor cells. The intramolecular toehold-mediated entropy-driven catalytic reaction generates a large amount of Bcl-2 ASOs, which allows accurate delivery of ASOs for gene therapy due to the specific targeting of mRNA in tumor cells. The results from in vitro and in vivo experiments show that the NIR light-activated DNA nanodevice can detect mRNA with high sensitivity by DNA walking amplification and high precision in gene delivery. Moreover, the released ASOs from DNA walking system down-regulate the expression of Bcl-2 anti-apoptosis protein and induce tumor cell apoptosis, thereby suppressing tumor growth without a transfection reagent. The NIR-light-controlled DNA nanodevice holds great potential for precise gene therapy in clinical applications.

The structural basis of mRNA recognition and binding by yeast pseudouridine synthase PUS1.

The chemical modification of RNA bases represents a ubiquitous activity that spans all domains of life. Pseudouridylation is the most common RNA modification and is observed within tRNA, rRNA, ncRNA and mRNAs. Pseudouridine synthase or 'PUS' enzymes include those that rely on guide RNA molecules and others that function as 'stand-alone' enzymes. Among the latter, several have been shown to modify mRNA transcripts. Although recent studies have defined the structural requirements for RNA to act as a PUS target, the mechanisms by which PUS1 recognizes these target sequences in mRNA are not well understood. Here we describe the crystal structure of yeast PUS1 bound to an RNA target that we identified as being a hot spot for PUS1-interaction within a model mRNA at 2.4 Å resolution. The enzyme recognizes and binds both strands in a helical RNA duplex, and thus guides the RNA containing the target uridine to the active site for subsequent modification of the transcript. The study also allows us to show the divergence of related PUS1 enzymes and their corresponding RNA target specificities, and to speculate on the basis by which PUS1 binds and modifies mRNA or tRNA substrates.

Retraction: ‘RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA’ (2015), by Cui et al.

Retraction: ‘RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA’ (2015), by Cui <i>et al.</i>

Cardiac sequelae in athletes following COVID-19 vaccination: evidence and misinformation

The recognition of myocarditis as a rare side effect of SARS-CoV-2 mRNA vaccination has sparked a global debate on vaccine safety, especially in the realm of sports. The main proposed...

Expression of concern: 'RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA' (2015), by Cui Y et al.

Expression of concern: 'RNA editing of microRNA prevents RNA-induced silencing complex recognition of target mRNA' (2015), by Cui Y et al.

Structural basis of gRNA stabilization and mRNA recognition in trypanosomal RNA editing.

In Trypanosoma brucei, the editosome, composed of RNA-editing substrate-binding complex (RESC) and RNA-editing catalytic complex (RECC), orchestrates guide RNA (gRNA)-programmed editing to recode cryptic mitochondrial transcripts into messenger RNAs (mRNAs). The mechanism of information transfer from gRNA to mRNA is unclear owing to a lack of high-resolution structures for these complexes. With cryo-electron microscopy and functional studies, we have captured gRNA-stabilizing RESC-A and gRNA-mRNA-binding RESC-B and RESC-C particles. RESC-A sequesters gRNA termini, thus promoting hairpin formation and blocking mRNA access. The conversion of RESC-A into RESC-B or -C unfolds gRNA and allows mRNA selection. The ensuing gRNA-mRNA duplex protrudes from RESC-B, likely exposing editing sites to RECC-catalyzed cleavage, uridine insertion or deletion, and ligation. Our work reveals a remodeling event facilitating gRNA-mRNA hybridization and assembly of a macromolecular substrate for the editosome's catalytic modality.

K235 acetylation couples with PSPC1 to regulate the m6A demethylation activity of ALKBH5 and tumorigenesis

N6-methyladenosine (m6A) modification plays important roles in bioprocesses and diseases. AlkB homolog 5 (ALKBH5) is one of two m6A demethylases. Here, we reveal that ALKBH5 is acetylated at lysine 235 (K235) by lysine acetyltransferase 8 and deacetylated by histone deacetylase 7. K235 acetylation strengthens the m6A demethylation activity of ALKBH5 by increasing its recognition of m6A on mRNA. RNA-binding protein paraspeckle component 1 (PSCP1) is a regulatory subunit of ALKBH5 and preferentially interacts with K235-acetylated ALKBH5 to recruit and facilitate the recognition of m6A mRNA by ALKBH5, thereby promoting m6A erasure. Mitogenic signals promote ALKBH5 K235 acetylation. K235 acetylation of ALKBH5 is upregulated in cancers and promotes tumorigenesis. Thus, our findings reveal that the m6A demethylation activity of ALKBH5 is orchestrated by its K235 acetylation and regulatory subunit PSPC1 and that K235 acetylation is necessary for the m6A demethylase activity and oncogenic roles of ALKBH5.