recA Sequences Research Articles

Molecular identification and antimicrobial resistance patterns of enterobacterales in community urinary tract infections among indigenous women in Ecuador: addressing microbiological misidentification

BackgroundAntibiotic resistance of Enterobacterales poses a major challenge in the treatment of urinary tract infections (UTIs). In low- and middle-income countries (LMICs), standard microbiological (i.e. urine culture and simple disk diffusion test) methods are considered the “gold standard” for bacterial identification and drug susceptibility testing, while PCR and DNA sequencing are less commonly used. In this study, we aimed to re-identifying Enterobacterales as the primary bacterial agents responsible for urinary tract infections (UTIs) by comparing the sensitivity and specificity of traditional microbiological methods with advanced molecular techniques for the detection of uropathogens in indigenous women from Otavalo, Ecuador.MethodsA facility-based cross-sectional study was conducted from October 2021 to February 2022 among Kichwa-Otavalo women. Pathogens from urine samples were identified using culture and biochemical typing. Morphological identification was doble-checked through PCR and DNA sequencing of 16S, recA, and rpoB molecular barcodes. The isolates were subjected to antimicrobial susceptibility-testing using disk diffusion test.ResultsThis study highlighted a 32% misidentification rate between biochemical and molecular identification. Using traditional methods, E. coli was 26.19% underrepresented meanwhile Klebsiella oxytoca was overrepresented by 92.86%. Furthermore, the genera Pseudomonas, Proteus, and Serratia were confirmed to be E. coli and Klebsiella spp. by molecular method, and one Klebsiella spp. was reidentified as Enterobacter spp. The susceptibility profile showed that 59% of the isolates were multidrug resistant strains and 31% produced extended spectrum beta-lactamases (ESBLs). Co-trimoxazole was the least effective antibiotic with 61% of the isolates resistant. Compared to previous reports, resistance to nitrofurantoin and fosfomycin showed an increase in resistance by 25% and 15%, respectively.ConclusionsCommunity-acquired UTIs in indigenous women in Otavalo were primarily caused by E. coli and Klebsiella spp. Molecular identification (16S/rpoB/recA) revealed a high rate of misidentification by standard biochemical and microbiological techniques, which could lead to incorrect antibiotic prescriptions. UTI isolates in this population displayed higher levels of resistance to commonly used antibiotics compared with non-indigenous groups. Accurate identification of pathogens causing UTIs and their antibiotic susceptibility in local populations is important for local antibiotic prescribing guidelines.

Genetic Diversity and Virulence of Phytopathogenic Burkholderia glumae Strains Isolated from Rice Cultivars in Valleys of the High Jungle of Perú.

Burkholderia glumae causes bacterial leaf blight in rice, and its global spread has been exacerbated by climate change. To understand the genetic diversity and virulence of B. glumae strains isolated from rice cultivars in Perú, 47 isolates were obtained from infected rice fields, all belonging to B. glumae, and confirmed by recA and toxB sequences. The BOX-PCR typing group has 38 genomic profiles, and these turn into seven variable number tandem repeats (VNTR) haplotypes. There was no correlation between clustering and geographical origin. Nineteen strains were selected for phenotypic characterization and virulence, using both the maceration level of the onion bulb proxy and inoculation of seeds of two rice cultivars. Several strains produced pigments other than toxoflavin, which correlated with onion bulb maceration. In terms of virulence at the seed level, all strains produced inhibition at the root and coleoptile level, but the severity of symptoms varied significantly between strains, revealing significant differences in pathogenicity. There is no correlation between maceration and virulence scores, probably reflecting different virulence mechanisms depending on the host infection stage. This is the first study to evaluate the VNTR diversity and virulence of Peruvian strains of B. glumae in two commercial cultivars.

Bacteria from nodules of Abrus mollis Hance: genetic diversity and screening of highly efficient growth-promoting strains.

Abrus mollis Hance. (AM) is an important species used in southern Chinese medicine. It is mainly found in Guangdong and Guangxi provinces in China, and it is effective in the treatment of hepatitis. Endophytic bacteria are known to affect the growth and quality of medicinal plants. However, there are limited reports describing endophytic bacteria related to AM. In the present study, Illumina-based 16S rRNA gene sequencing was used to investigate the endophytic bacterial communities of root nodules of AM at five sampling sites in Guangxi. In addition, 179 strains of endophytic bacteria were isolated and categorized into 13 haplotypes based on recA sequence analysis. The phylogeny of the 16S rRNA gene sequences revealed a predominance of nonrhizobial endophytes. Microbial diversity analysis showed that Proteobacteria was the dominant phylum in all samples, while Bradyrhizobium was the dominant genus in different samples. An efficient strain, Rhizobium tropici FM-19, was screened and obtained through greenhouse experiments. The AM plants inoculated with this strain showed the best growth performance and high nitrogen fixation and nodulation capacity. Notably, total phenols and total flavonoids, important active components in AM, increased by 30.9 and 42.7%, respectively, after inoculation with Rhizobium tropici FM-19. This study provides insights into the complex microbial diversity of AM nodules and provides strain information for the efficient cultivation of AM.

Lactobacillus juensis sp. nov. and Lactobacillus rizhaonensis sp. nov., isolated from the gut of honeybee (Apis mellifera).

Four lactic acid bacteria, designated F690T, F697, F790T and F769-2, were isolated from the gut of honeybee (Apis mellifera). Results of 16S rRNA gene sequence analysis indicated that strains F690T and F697 were phylogenetically related to the type strains of Lactobacillus kimbladii, Lactobacillus laiwuensis, Lactobacillus kullabergensis and Lactobacillus huangpiensis, having 99.1-99.6 % 16S rRNA gene sequence similarities; and that strains F790T and F769-2 were most closely related to the type strain of Lactobacillus melliventris, having 99.2-99.3 % 16S rRNA gene sequence similarities. The phylogenies based on concatenated pheS, rpoA, gyrB, hsp60, recA, rpoB and tuf sequences and based on whole genome sequences were identical to that based on 16S rRNA gene sequences. Strains F690T and F697 exhibited the highest average nucleotide identity (ANI; 92.1-93.2 %), digital DNA-DNA hybridization (dDDH; 50-50.1 %) and average amino acid identity (AAI; 94.9-95.1 %) values with L. kimbladii Hma2NT. Strains F790T and F769-2 had the highest ANI (93.1-94 %), dDDH (54.4 %) and AAI (94.4-94.7 %) values with L. melliventris Hma8NT. Based upon the data obtained in the present study, two novel species, Lactobacillus juensis sp. nov. and Lactobacillus rizhaonensis sp. nov., are proposed and the type strains are F690T (=JCM 36259T=CCTCC AB 2023131T) and F790T (=JCM 36260T=CCTCC AB 2023132T), respectively.

Identification of Burkholderia cepacia strains that express a Burkholderia pseudomallei-like capsular polysaccharide.

Burkholderia pseudomallei and Burkholderia cepacia are Gram-negative, soil-dwelling bacteria that are found in a wide variety of environmental niches. While B. pseudomallei is the causative agent of melioidosis in humans and animals, members of the B. cepacia complex typically only cause disease in immunocompromised hosts. In this study, we report the identification of B. cepacia strains isolated from either patients or soil in Laos and Thailand that express a B. pseudomallei-like 6-deoxyheptan capsular polysaccharide (CPS). These B. cepacia strains were initially identified based on their positive reactivity in a latex agglutination assay that uses the CPS-specific monoclonal antibody (mAb) 4B11. Mass spectrometry and recA sequencing confirmed the identity of these isolates as B. cepacia (formerly genomovar I). Total carbohydrates extracted from B. cepacia cell pellets reacted with B. pseudomallei CPS-specific mAbs MCA147, 3C5, and 4C4, but did not react with the B. pseudomallei lipopolysaccharide-specific mAb Pp-PS-W. Whole genome sequencing of the B. cepacia isolates revealed the presence of genes demonstrating significant homology to those comprising the B. pseudomallei CPS biosynthetic gene cluster. Collectively, our results provide compelling evidence that B. cepacia strains expressing the same CPS as B. pseudomallei co-exist in the environment alongside B. pseudomallei. Since CPS is a target that is often used for presumptive identification of B. pseudomallei, it is possible that the occurrence of these unique B. cepacia strains may complicate the diagnosis of melioidosis.IMPORTANCEBurkholderia pseudomallei, the etiologic agent of melioidosis, is an important cause of morbidity and mortality in tropical and subtropical regions worldwide. The 6-deoxyheptan capsular polysaccharide (CPS) expressed by this bacterial pathogen is a promising target antigen that is useful for rapidly diagnosing melioidosis. Using assays incorporating CPS-specific monoclonal antibodies, we identified both clinical and environmental isolates of Burkholderia cepacia that express the same CPS antigen as B. pseudomallei. Because of this, it is important that staff working in melioidosis-endemic areas are aware that these strains co-exist in the same niches as B. pseudomallei and do not solely rely on CPS-based assays such as latex-agglutination, AMD Plus Rapid Tests, or immunofluorescence tests for the definitive identification of B. pseudomallei isolates.

First report of Pectobacterium polaris causing aerial stem rot of potato in Mexico.

In Mexico, potato (Solanum tuberosum L.) is one of the most important vegetable crops for local consumption and industry. More than 1.8 million tons of potatoes are produced annually, of which the state of Sinaloa contributes with 21.5% (SIAP. 2022). In January 2020, potato plants (cv. FL1867) showing aerial stem rot symptoms were observed in a commercial field from the Santa Rosa Valley, in Northern Sinaloa with an incidence of 36%. Putative pectolytic bacteria showing pitting on crystal violet pectate (CVP) plates were restreaked and purified onto Nutritive Agar (NA) medium at 28°C. Four independent isolates were obtained (L25F-83, L25F-105, L25F-115, and L25F-125) from four symptomatic stems with biochemical and morphological characteristics related to Pectobacterium, such as catalase positive, oxidase negative, pectinolytic activity, Gram-negative and non-fluorescent in B-King medium. Bacterial gDNA was used for amplification and sequencing of two housekeeping genes (dnaX and leuS) (Portier et al. 2019). The nucleotide sequence identity between our isolates was 100% with both housekeeping genes (dnaX, OP376536-OP376539 and leuS, OP376540-OP376543). The BLASTn analysis of dnaX gene shared 98.98% and 99.19% identity with two soft-rot-causing bacterial strains NIBIO1006T (CP017481) and NIBIO1392 (CP017482) of Pectobacterium polaris, respectively; and with leuS gene shared 99.56% identity with P. polaris type strain NIBIO1006T. To further validate the identification, two strains, S5 (isolate L25F-105) and S6 (L25F-125), were selected for whole genome sequencing (WGS). The ANI values for closely related species were calculated using the Orthologous Average Nucleotide Identity (Ortho-ANI) Software Tool (OAT) (Lee et al. 2016). The Type (Strain) Genome Server (TYGS) was used for accurate genome-based taxonomy (https://tygs.dsmz.de) (Meier-Kolthoff et al. 2019). The genomes of P. polaris strains S5 (4811345 pb, GC=52%, AULSZ000000000) and S6 (4809754 pb, GC=52%, JAULTA000000000) revealed 96.86% and 96.07% Ortho-ANI and 73.6% and 66.5% dDDH with P. polaris type strain NIBIO1006T and P. parvum strain CFBP8630, respectively. The MLSA was performed on concatenated complete sequences of dnaX (OR470476, OR470477), leuS (OR470484, OR470485), recA (OR470488, OR470488), acnA (OR470474, OR470475), gapA (OR470478, OR470479), gyrA (OR470480, OR470481), icdA (OR470482, OR470483), proA (OR470486, OR470487), and rpoA genes (OR470490, OR470491). The consensus tree, constructed using the maximum likelihood method (MEGA 7.0), clustered strains S5 and S6 with P. polaris strains NIBIO1006T and NIBIO1392. The four isolates resulted pathogenic in tuber slices and potato seedlings (cv. Fianna) 24 and 72 h, respectively, after being inoculated with 30 µL bacterial suspension (1 X 108 CFU/ml) and incubated at 28 °C and 85% relative humidity. Bacterial colonies were reisolated from the affected tissue and identified with the same PCR primers as described above. Accordingly, P. polaris isolates S5 and S6, fulfill Koch's postulates for aerial stem rot of potato. To our knowledge, this is the first report of P. polaris causing aerial stem rot of potato in Mexico. This bacterium could be a significant threat to the local potato producers; therefore, an accurate and sensitive method of detection and epidemiological studies are needed to support an effective disease diagnosis and management program.

Streptomyces argyrophyllae sp. nov., isolated from the rhizosphere soil of Cathaya argyrophylla.

Strain Jing01T, a novel actinomycete from rhizosphere soil of Cathaya argyrophylla, was identified using a polyphasic approach. 16S rRNA gene sequence analysis of strain Jing01T revealed that it was a member of the genus Streptomyces and shared 99.03%, 99.03%, 98.96%, 98.89%, 98.83%, 98.82%, 98.76%, 98.74%, 98.73%, 98.69% and 98.68% similarities to Streptomyces rochei NRRL B-2410T, Streptomyces naganishii NBRC 12892T, Streptomyces rubradiris JCM 4955T, Streptomyces anandii NRRL B-3590T, Streptomyces aurantiogriseus NBRC 12842T, Streptomyces mutabilis NBRC 12800T, Streptomyces rameus LMG 20326T, Streptomyces djakartensis NBRC 15409T, Streptomyces bangladeshensis JCM 14924T, Streptomyces andamanensis KCTC 29502T and Streptomyces tuirus NBRC 15617T, respectively. In phylogenetic trees constructed based on 16S rRNA gene sequences, strain Jing01T generated a separate branch at the middle of the clade, suggesting it could be a potential novel species. In phylogenomic tree, strain Jing01T was related to S. rubradiris JCM 4955T. In phylogenetic trees based on the gene sequences of atpD, gyrB, recA, rpoB and trpB, strain Jing01T was related to S. bangladeshensis JCM 14924T and S. rubradiris JCM 4955T. Whereas, the multilocus sequence analysis distance, average nucleotide identity and DNA-DNA hybridization values between them were much less than the species-level thresholds. This conclusion was further supported by phenotypic and chemotaxonomic analysis. Consequently, strain Jing01T represents a new Streptomyces species, for which the proposed name is Streptomyces argyrophyllae sp. nov. The type strain is Jing01T (= MCCC 1K05707T = JCM 35923T).

Genotypic and phenotypic uniformity among the population of Pectobacterium atrosepticum strains isolated during three growing seasons from potato fields in Poland

Pectobacterium atrosepticum (Pba)are phytopathogenic, pectinolytic, non-sporulating, gram-negative rods causing blackleg and soft rot diseases in potato. They are ubiquitously present under temperate climate conditions and contribute to significant economic losses. Currently, there are no efficient control methods against soft rot Pectobacteriaceae (SRP). As limitation of the spread of SRP is solely prevention-based, we undertook broad characterization on both genotypic and phenotypic levels of the P. atrosepticum isolates acquired during monitoring of potato fields in Poland in 2013, 2014 and 2016. Of REP, ERIC and BOX-based genomic fingerprinting, the BOX-based approach turned out to be the most informative and allowed for classification of 118 Pba strains into six groups. The present study indicated that IV and I BOX profiles dominated among the investigated population. Finally, 23 Pba strains representing all BOX groups and originating from various growing seasons were selected for genotypic, phylogenetic and phenotypic studies. rpoS-based phylogeny revealed intraspecies variation (16 SNP sites) among the studied Pba strains, in contrast to the analyses relying on gyrA (1 SNP) and recA (0 SNP) sequences. Pba strains showed higher potency to macerate potato tissue at 20 °C than 28 °C. These isolates exhibited rather uniform production of plant cell wall degrading enzymes (pectinases, cellulases and proteases), lipases, siderophores and biofilm, however in the majority of cases inferior in comparison to Dickeya solani and Pectobacterium carotovorum strains. In conclusion, this study revealed genotypic and phenotypic uniformity in addition to high virulence potential of Pba strains isolated from potato fields during several growing seasons in Poland.

First Report of Canker Caused by Pectobacterium actinidiae on Asian Pear Trees (Pyrus pyrifolia) in South Korea.

In July 2020, pear trees (Pyrus pyrifolia cv. Niitaka) with cankers displaying dark-red bacterial ooze on the trunk and branches were found in two pear orchards located in Naju, Jeollanam-do, South Korea (34°57'50″ N, 126°43'52″ E and 34°56'14″ N, 126°33'42″ E). The incidence was 1.5% (3 out of 200 trees) and 0.83% (1 out of 120 trees), respectively. The symptoms were similar to those of the bleeding canker caused by Dickeya fangzhongdai (Choi et al. 2021), which is typically observed in October. The bacterial ooze was suspended in sterile water and streaked in Luria-Bertani (LB) medium to isolate single bacterial colonies. Two isolates (PRI-B16 and PRI-B17) from representative diseased trees were selected for investigation. Physiological and biochemical characteristics of the isolates analyzed using the BIOLOG GEN III MicroPlate™ system (Biolog, Hayward, CA, USA) were similar to the characteristics of Pectobacterium actinidiae (Portier et al. 2019). These isolates were positively utilized stachyose, L-galactonic acid-g-lactone, guanidine hydrochloride and weakly utilized (-)-D-arabitol (Portier et al. 2019). Bacterial genomic DNA was extracted from cell cultured in 5 ml LB at 28C for 2 days using G-spin DNA extraction kit (iNtRON Biotechnology, Korea) according to the manufacturer's protocol. PCR amplification was amplified as Portier et al. (2019). The generated their sequences of the small subunit ribosomal RNA (16S rRNA) using primers 27f and 1492r (Heuer et al. 1997) (Genebank accession numbers: ON951863 and ON951864) were 99.86% and 99.76% identical, respectively, to that of P. actinidiae isolate SCPJ-1 (KY307837.1) by a BLAST search against gene bank databases. The dnaX (Genebank accession nos: ON960281 and ON960282), leuS (Genebank accession nos: ON960283 and ON960284), and recA (Genebank accession nos: ON960285 and ON960286) genes of these isolates were also amplified and sequenced by previously described Stawiak et al. (2009) for dnaX and leuS, and Waleron et al. (2002) for recA. A neighbor-joining phylogenetic analysis based on the concatenated dnaX, leuS, and recA sequences placed the two isolates in a clade containing previously identified P. actinidiae isolates. A pathogenicity test was conducted using two-year-old pear (P. pyrifolia cv. Nittaka) trees grown in a greenhouse. Wounded and unwounded pear tree branches were inoculated with 10 µL of the bacterial suspension (108 CFU/ml) or sterile water as a control. The inoculated plants were maintained at 30°C without light for 2 days under 85-90% humidity. At 7 days post-inoculation, bacterial ooze was observed on the branches inoculated with a bacterial suspension, whereas branches subjected to unwounded inoculation and water inoculation exhibited no symptoms. This assay was performed three times. We reisolated two colonies from each sample showing typical bleeding symptoms and confirmed their identity by sequencing the dnaX locus. Pectobacterium actinidiae has been reported to cause canker in pear trees in Brazil (Araujo et al. 2021) as well as kiwifruit in South Korea (Koh et al. 2012). This is the first report of P. actinidiae causing canker on pear trees in South Korea and is, therefore, pathologically significant.

First report of bacterial soft rot on Epipremnum aureum caused by Pectobacterium aroidearum in Taiwan.

Pothos (Epipremnum aureum) is an Araceae foliage plant with great ornamental values, which has long been enjoyed by consumers (Chen et al. 2010). In September 2021, pothos showing soft rot symptoms were found in 2 nurseries in Taichung, Taiwan. The petioles of the infected plants were macerated; some lesions extended to the leaves (Figure S1). The disease incidence was 50% in one nursery and 37.5% in the other; two and three plants were respectively collected from the two sites. Macerated tissues were homogenized in 10 mM MgCl2 and the samples were observed microscopically without dyeing. Motile, rod-shaped bacteria were observed in the samples, and the bacteria were isolated onto nutrient agar (NA) and grown at 28°C for 2 days. Fast-growing, round, creamy colonies were isolated from all 5 plants. One strain was isolated from each plant and the strains were named Ea1 to Ea5. The bacteria could ferment glucose and induce maceration on potato tuber slices (Schaad et al. 2001), but did not produce indigoidine on NGM medium (Lee and Yu 2006) and were tested negative for phosphatase activity (Schaad et al. 2001). The bacteria's DNA samples were tested using primers specific to Pectobacterium (Y1/Y2; Darrasse et al. 1994). The expected 434-bp amplicon was amplified in all five strains. Multilocus sequence analysis was conducted as previously described (Portier et al. 2019). A concatenated sequence (1,592 bp) comprising partial dnaX (492 bp), leuS (452 bp) and recA (648 bp) sequences was obtained for each strain. Two genotypes were detected among the strains; Ea1 and Ea2 belonged to one genotype (i.e., they had identical sequences), while Ea3, Ea4 and Ea5 belonged to the other (GenBank accession nos. OK416015-OK416020). Phylogenetic analysis was conducted using these data and those of representative strains of known Pectobacterium species (Klair et al. 2022). A maximum-likelihood tree showed that Ea1 to Ea5 clustered with P. aroidearum CFBP8168T (Figure S2). Sequence comparison (Table S1) showed that the similarity between the two genotypes' concatenated sequences was 99.1% (Ea1 vs. Ea3; 1,578/1,592 bp); Ea1 and Ea3 shared 99.2% and 99.3% sequence similarity with P. aroidearum CFBP8168T, respectively. The sequences obtained in this work were searched against GenBank and all of their top hits were those of strains belonging to P. aroidearum (supplementary information). Koch's Postulates were fulfilled by stab inoculating cutting-propagated pothos (8-cm tall) using toothpicks carrying bacteria grown on NA. The pathogen loads used were estimated by suspending cells (attached to individual toothpicks) in 10 mM MgCl2 and spread-plating them onto NA (after dilution); the loads were 5.5 x 106 - 2.2 x 107 CFU. Three plants were inoculated for each strain (3 petioles per plant). Control plants were stabbed with sterile toothpicks. Each plant was then bagged and placed in a growth chamber (28°C; 14 h light). After 24 h, all inoculated plants produced symptoms resembling those found in the nurseries, and the controls did not. For every treatment group, a strain was re-isolated onto NA; each of them shared the same recA sequence with the original strain inoculated. This is first report of P. aroidearum causing pothos soft rot in Taiwan. Local nurseries often grow pothos and other Araceae plants together in humid areas. Since other Araceae species are also known to be susceptible to P. aroidearum (Xu et al. 2020), growers should be cautious of the pathogen's spread across hosts.

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

Optimized multilocus sequence analysis for laboratory identification of pathogens of ixodid tick-borne borreliosis

Introduction. The most common etiological agents of ixodid tick-borne borreliosis (ITBB) in Russia are Borrelia garinii, B. afzelii, B. bavariensis. Multilocus sequence typing and multilocus sequence analysis (MLSA) have been used in recent studies for Borrelia species identification. The results of using the MLSA scheme for identification of pathogens causing erythemic forms of ITBB have been presented earlier.
 The purpose of the study was to explore the possibility of MLSA optimization for laboratory identification of ITBB pathogens. Objectives: comparative analysis of nucleotide sequences of 6 conserved genes (rrs, hbb, fla, groEL, recA, ospA) and the rrfA-rrlB intergenic spacer, which are recommended by the MLSA protocol; identification of the minimum set of genes, the concatenated sequences of which are essential for species identification of Borrelia isolates.
 Materials and methods. The sequences of the above loci of 23 reference isolates collected from patients with ITBB and assigned, using MLSA, to B. bavariensis were compared with the sequences of similar genes of other Borrelia species available in international databases. The UPGMA method was used to build and analyze dendrograms based on the obtained data.
 Results. The sequences of ospA gene loci of reference species demonstrated the greatest difference (not less than 8.5%) from the sequences of the above gene in other analyzed species of Borrelia; approximately similar species-related differences (not less than 6.7%) were demonstrated by the comparison of recA gene sequences. The sequences of the identified variants of these two genes in B. bavariensis differed from the sequences of the similar genes in the most closely related species B. garinii. The dendrogram of the concatenated nucleotide sequences of recA and ospA genes demonstrated that it was totally consistent with the results of identification of the isolates based on the MLSA protocol.
 Conclusion. The optimized approach to MLSA of the B. burgdorferi sensu lato group suggests that species identification should be based on the concatenated analysis of loci of only two genes (recA and ospA) out of 7 loci recommended by the MLSA protocol.

Entomopathogenic Nematodes and Their Symbiotic Bacteria from the National Parks of Thailand and Larvicidal Property of Symbiotic Bacteria against Aedes aegypti and Culex quinquefasciatus.

Entomopathogenic nematodes (EPNs) are insect parasitic nematodes of the genera Het-erorhabditis and Steinernema. These nematodes are symbiotically associated with the bacteria, Photorhabdus and Xenorhabdus, respectively. National parks in Thailand are a potentially rich resource for recovering native EPNs and their symbiotic bacteria. The objectives of this study are to isolate and identify EPNs and their bacterial flora from soil samples in four national parks in Thailand and to evaluate their efficacy for controlling mosquito larvae. Using a baiting method with a Galleria mellonella moth larvae and a White trap technique, 80 out of 840 soil samples (9.5%) from 168 field sites were positive for EPNs. Sequencing of an internal transcribed spacer resulted in the molecular identification of Heterorhabditis nematode isolates as H. indica, H. baujardi and Heterorhabditis SGmg3, while using 28S rDNA sequencing, Steinernema nematode species were identified as S. guang-dongense, S. surkhetense, S. minutum, S. longicaudum and one closely related to S. yirgalemense. For the symbiotic bacterial isolates, based on recA sequencing, the Photorhabdus spp. were identified as P. luminescens subsp. akhurstii, P. luminescens subsp. hainanensis and P. luminescens subsp. australis. Xenorhabdus isolates were identified as X. stockiae, X. indica, X. griffiniae, X. japonica and X. hominickii. Results of bioassays demonstrate that Photorhabdus isolates were effective on both Aedes aegypti and Culex quinquefasciatus. Therefore, we conclude that soil from Thailand's national parks contain a high diversity of entomopathogenic nematodes and their symbiotic bacteria. Photorhabdus bacteria are larvicidal against culicine mosquitoes and may serve as effective biocontrol agents.

Larvicidal activity of Photorhabdus and Xenorhabdus bacteria isolated from insect parasitic nematodes against Aedes aegypti and Aedes albopictus

Aedes aegypti and Aedes albopictus are important vectors for several arboviruses such as the dengue virus. The chemical control of Aedes spp., which is usually implemented, affects both humans and the environment. The biological control of Aedes spp. with entomopathogenic bacteria such as Photorhabdus and Xenorhabdus may be an alternative method that can overcome such issues. This study aimed to isolate and identify Photorhabdus and Xenorhabdus bacteria from entomopathogenic nematodes (EPNs) collected in Thailand and evaluate their larvicidal properties in controlling A. aegypti and A. albopictus. Colony morphology and recA sequencing of the 118 symbiotic isolated bacteria indicated that most were P. luminescens subsp. akhurstii and X. stockiae with minor prevalence of P. luminescens subsp. hainanensis, P. asymbiotica subsp. australis, X. indica, X. griffiniae, X. japonica, X. thuongxuanensis, and X. eapokensis. The larvicidal bioassay with the third- and fourth-instar mosquito larvae suggested that a whole-cell suspension of X. griffiniae (bMSN3.3_TH) had the highest efficiency in eradicating A. aegypti and A. albopictus, with 90 ± 3.71% and 81 ± 2.13% mortality, respectively, after 96 h exposure. In contrast, 1% of ethyl acetate extracted from X. indica (bSNK8.5_TH) showed reduced mortality for A. aegypti of only 50 ± 3.66% after 96 h exposure. The results indicate that both X. griffiniae (bMSN3.3_TH) and X. indica (bSNK8.5_TH) could be used as biocontrol agents against Aedes larvae

Bifidobacterium mizhiense sp. nov., isolated from the gut of honeybee (Apis mellifera).

A novel bifidobacteria (designated S053-2T) was isolated from the gut of honeybee (Apis mellifera). Strain S053-2T was characterized using a polyphasic taxonomic approach. The result of 16S rRNA gene sequence analysis indicated that strain S053-2T was phylogenetically related to the type strains of Bifidobacterium asteroides, Bifidobacterium indicum, Bifidobacterium actinocoloniiforme, Bifidobacterium xylocopae, Bifidobacterium coryneforme, Bifidobacterium apousia, Bifidobacterium choladohabitans and Bifidobacterium polysaccharolyticum, and had 95.5-99.7 % 16S rRNA gene sequence similarities. Based on the 16S rRNA gene sequence analysis, strain S053-2T was most closely related to the type strain of B. asteroides, having 99.7 % 16S rRNA gene sequence similarity. Strain S053-2T had relatively low (91.6-95.7 %) pheS, atpA, clpC, dnaG, fusA, glnA, glyS, hsp60, argS, pyrG and recA sequence similarities to the type strain of B. asteroides. Strain S053-2T had 94.5-95.3% atpA, clpC, dnaG, dnaK and pyrG sequence similarities to the type strain of B. apousia. The phylogenomic tree indicated that strain S053-2T belonged to the B. asteroides group, and was most closely related to the type strains of B. asteroides, B. apousia, B. choladohabitans and B. polysaccharolyticum, and distantly related to type strains of other phylogenetically related species in the B. asteroides group. Strain S053-2T shared the highest average nucleotide identity (ANI, 93.8 %), digital DNA-DNA hybridization (dDDH, 52.4 %) and average amino acid identity (AAI, 95.6%) values with B. apousia W8102T. Strain S053-2T shared 91.1 % ANI, 41.9 % dDDH and 92.5 % AAI values with B. asteroides DSM 20089T. Acid production from l-arabinose, d-xylose, d-mannose, amygdalin, cellobiose, maltose, melibiose, sucrose, raffinose, gentiobiose and l-fucose, and activity of esterase lipase (C8) and α-fucosidase could differentiate strain S053-2T from B. asteroides DSM 20089T. Acid production from d-mannose, maltose, sucrose, melezitose and gentiobiose, and activity of α-fucosidase could differentiate strain S053-2T from B. apousia W8102T. Based upon the data obtained in the present study, a novel species, Bifidobacterium mizhiense sp. nov., is proposed, and the type strain is S053-2T (=JCM 34710T=CCTCC AB 2021129T).

The Genetic relatedness of Burkholderia contaminans clinical isolates from cystic fibrosis and non-cystic fibrosis patients in Argentina.

The Burkholderia cepacia complex (BCC) bacteria are opportunistic pathogens that cause nosocomial infections and are especially dangerous for cystic fibrosis (CF) patients. Burkholderia contaminans is an emerging BCC species isolated from CF patients that also occurs as a contaminant in pharmaceutical and personal care products, sometimes linking it with outbreaks. A total of 55 B. contaminans isolates from CF and non-CF patients in Argentina were identified by recA sequencing and MALDI TOF MS. A standardized Pulsed Field Gel Electrophoresis (PFGE) protocol was set up in order to assess genetic diversity, outbreak investigations, and possible clone persistence. All isolates were identified as B. contaminans by both MALDI-TOF MS and recA sequence analysis. PFGE has enabled us to compare and determine the genetic relationship between B. contaminans isolates. Isolates were distributed in different PFGE clusters with evidence of the presence and persistence of a clone, over a period of 3 years, in the same hospital. This large hospital outbreak involved CF and non-CF patients. Moreover, PFGE results showed a good correlation between sporadic or outbreak-related isolates and the available epidemiological information. These findings highlight the importance of B. contaminans in Argentina and provide evidence for encouraging the surveillance of highly transmissible clones. The study also contributes to global knowledge about B. contaminans infections.

First Report of Burkholderia cepacia Causing Finger-Tip Rot on Banana Fruit in the Guangxi Province of China.

Banana (Musa acuminata) is one of the most popular and widely consumed fruit crops in the world. During late October to early November 2020, a banana finger-tip rot disease was observed in the banana (cultivar 'Brazil', AAA group) orchard of about 12 hectares located in Zhongcun, Zhangmu Town, Fumian District, Yulin City, Guangxi province, China. The disease incidence was about 0.5% at the surveyed field. Infected fingers and their tips were usually normal in the appearances and then turned to brown to black discoloration in the central fruit pulp adjacent to the fingertips (Fig. 1A). In severe infection, diseased fingers showed brown to black discoloration in both the central and the periphery fruit pulp, and along the longitudinal axis throughout the fruit (Fig. 1B-C). The symptomatic banana fingers were surface-disinfected with 1% sodium hypochlorite for 30 sec, 75% ethanol for 30 sec then rinsed three times with sterile distilled water. The flesh tissues were ground in a sterile mortar and soaked in 1 ml of sterile distilled water for 30 min. A 50 μl of tissue suspensions was streaked onto Luria-Bertani (LB) medium. Single colonies were picked and re-streaked onto new LB medium. The cultures were incubated at 37°C for 24 h. Two representative strains, GX and GX2, were obtained from symptomatic pulps and used in the following studies. To molecularly identify the bacterial species, we performed a polymerase chain reaction (PCR) using 16S rRNA and recA primers (Turner et al. 1999; Lee and Chan 2007) and amplified 1,442 bp and 1,019 bp sequences, respectively. The amplified sequences were deposited in GenBank under the accession numbers MZ267253 and MZ961355 for the 16S rRNA and MZ287336 and MZ983484 for the recA genes. BLASTn searches shared more than 99% similarity with the reference sequences of B. cepacia strains (MK680073.1 and KC261418.1 for 16S rRNA; AY598028.1 and KF812859.1 for recA). Phylogenetic trees were constructed using the 16 rRNA and recA sequences and showed that the representative strains, GX and GX2, strongly clustered with B. cepacia type strains (Fig. 2). To further determine the genomovars of strain GX, we used specific PCR primers to the B. cepacia epidemic strain marker (BCESM), type III secretion gene cluster (bcscV) and cable pilin subunit gene (cblA) (Lee and Chan 2007; Ansari et al. 2019). The presence of bcscV and BCESM were confirmed by PCR, while cblA was not observed in the strains GX and GX2, suggesting that the isolated strains belong to B. cepacia genomovar III and are slightly different from the Iranian and Taiwan strains of B. cepacia (Lee and Chan 2007; Ansari et al. 2019). Pathogenicity test was conducted on banana fingers (cultivar 'Zhongjiao No.3') at the immature and full ripe stages. A final suspensions of 106 CFU/ml, was injected into the banana fingers (100 μl per finger) through the center of the stigma (Lee and Chan 2007; Ansari et al. 2019). The fingers inoculated with sterile water were used as negative control. To maintain humidity, the treated fingertips were wrapped with Parafilm. For each treatment, ten independent replicates were conducted. At 10 days post-inoculation (dpi), the pulp of immature bananas exhibited reddish brown decaying tissue, which symptoms were similar to those observed in the field (Fig. 1D). Moreover, the pulp tissues of ripe bananas showed a dark brown discoloration in the tip at 5 dpi, whereas the controls remained symptomless (Fig. 1E). The same bacterium was re-isolated from diseased tissues and its identification confirmed by 16S rRNA, thus fulfilling the Koch's postulates. This disease was first described in Honduras in Latin America, and then reported in Taiwan province of China, and Iran (Buddenhagen 1968; Lee et al. 2003; Ansari et al. 2019). To our knowledge, this is the first report of banana finger-tip rot caused by B. cepacia in the Guangxi province, China. It is necessary to determine the distribution of B. cepacia and to prevent its spread in Guangxi province of China.

Resolution of housekeeping gene sequences used in MLSA for the genus Streptomyces and reclassification of Streptomyces anthocyanicus and Streptomyces tricolor as heterotypic synonyms of Streptomyces violaceoruber.

Although 16S rRNA gene sequences are conventionally analysed in bacterial systematics, their resolution is not sufficient for species identification. Multilocus sequence analysis (MLSA) is a powerful method for species identification as well as the elucidation of phylogenetic relationships in the genus Streptomyces. Gene sequences of atpD, gyrB, recA, rpoB and trpB are generally used in MLSA for Streptomyces species. This study aims to evaluate the sequence analysis of one gene instead of all five genes to be employed for species identification. The resolution of atpD gene sequences was not necessarily able to distinguish closely related species. In contrast, trpB gene sequence similarities correlated to the MLSA-based evolutionary distances, especially among closely related strains. A pairwise similarity of 97.9 % in trpB gene sequences was proposed as the threshold for species delineation based on the feasibility examined using strain pairs that shared >99.93 % pairwise 16S rRNA gene sequence similarities. Resequencing the five housekeeping genes followed by MLSA suggested that Streptomyces anthocyanicus and Streptomyces tricolor are synonyms of Streptomyces violaceoruber.

First Report of Pectobacterium punjabense Causing Potato Soft Rot and Blackleg in Serbia.

Soft rot and blackleg are common diseases affecting potato (Solanum tuberosum) production in Serbia. Pectinolytic plant pathogens belonging to the genera Pectobacterium cause soft rot and wilt diseases by plant cell wall degradation. These opportunistic phytopathogens lead to considerable economic losses in many potato-growing regions worldwide and are listed among top 10 plant pathogenic bacteria (Mansfield et al. 2012). Potato plants (cv. VR808) with symptoms of wilting, slow growth, stem blackening and tubers softening, were collected from a commercial potato field in Zobnatica (Serbia) in July 2019 and subjected to analysis. All symptoms occurred in the same field and the incidence of symptomatic plants was approximately 5%. Isolation was performed from 10 randomly chosen potato plant and tuber samples, expressing wilting and soft rot symptoms. Plant tissue was surface-disinfected and 1 cm length sections from the margins of lesions were macerated in sterile distilled water for 25 min and streaked on nutrient-agar medium. After 48 h of incubation at 26°C, predominant shiny, cream-colored, round colonies were obtained from all samples. Three representative isolates (MMZKVR1, MMZCVR2, and MMZKVR3) from independent samples were selected randomly and subjected to biochemical and pathogenicity tests. Isolates were gram-negative, nonfluorescent facultative anaerobes, exhibiting pectinolytic activity on potato tuber slices and hypersensitive response on tobacco leaves. They expressed catalase activity but did not express oxidase or acid phosphatase activity or produce indole. All strains grew at 37°C, in 5% NaCl, and reduced nitrate. Pathogenicity of the obtained isolates was tested on 3-week-old healthy potato plants (cv. VR808 and cv. Kiebitz) grown in commercial Baltic Tray Substrate (Hawita) in the greenhouse, as well as on potato tubers of the same varieties. Three potato plant stems per isolate were inoculated by the toothpick piercing method (Duarte et al. 2004) using bacterial suspension (approx. 1 × 108 CFU/ml). Inoculated plants were incubated under plastic bags in a greenhouse at 25 ± 2°C. Blackleg symptoms and stem wilting developed 48 hours after inoculation. No symptoms were observed on plants inoculated with sterile toothpicks dipped in sterile distilled water. The pathogen was re-isolated from symptomatic plants, fulfilling Koch's postulates and sequencing of 16S rDNA confirmed the originally isolated pathogen. Three potato tubers per isolate were inoculated by toothpicks dipped in bacterial suspension (approx. 1 × 108 CFU/ml). Inoculated tubers were placed in a sealed plastic container at 25 ± 2°C. Treatment with sterile distilled water was used as a negative control. Softening of the tissue around the inoculation point developed within 48 h from inoculation, and no symptoms developed on the control tubers. For molecular analyses, total DNA of the isolates was extracted using the DNeasy Plant Mini Kit (Qiagen). The isolates were not detected in diagnostic PCR assays using specific primers Br1F/L1R for the detection of P. brasiliense (Duarte et al. 2004) and primers EXPCCF/EXPCCR for P. catotovorum subsp. carotovorum (Kang et al. 2003). The 16S rDNA PCR amplification was performed using the universal PCR primer pair 27F/1492R (Fredriksson et al. 2013) and followed by Sanger sequencing (Macrogen Europe BV). The BLASTn analysis of sequences (GenBank Accession Numbers MZ048661, MZ048662, and MZ157274) revealed 100% query coverage and 100% identity to the sequences of Pectobacterium punjabense in NCBI (MT242589 and CP038498) isolated from potato in China and Pakistan (Sarfraz et al. 2018), respectively. All three obtained isolates were proposed to belong to Pectobacterium punjabense sp. nov. To further validate the identification, isolate MMZCVR2 of P. punjabense was selected for multilocus sequence analyses of 5 housekeeping genes (gyrA, recA, recN, rpoA and rpoS). The gyrA (MZ161817), recA (MZ161818), recN (MZ161819), rpoA (MZ161820) and rpoS (MZ161821) sequence analysis showed the highest nucleotide identity (99.44 to 100%) with P. punjabense strain SS95 (Sarfraz et al. 2018) previously deposited in NCBI GenBank database. To our knowledge, this is the first report of blackleg and soft rot caused by P. punjabense on potato in Serbia. Pectobacterium punjabense is a newly described species causing soft rot and blackleg disease in potato plants (Sarfraz et al. 2018). Its current geographic distribution is not well-described but important to know since soft rot bacteria are easily transported long distances in latently infected seed tubers and can cause significant economic losses in potato production worldwide.

Agrobacterium vaccinii sp. nov. isolated from galls on blueberry plants (Vaccinium corymbosum)

Four non-pathogenic strains isolated from the galls on blueberry plants (Vaccinium corymbosum) were characterized by using polyphasic taxonomic methods. Based on 16S rRNA gene phylogeny, strains were clustered within the genus Agrobacterium. Furthermore, multilocus sequence analysis (MLSA) based on the partial sequences of atpD, recA and rpoB housekeeping genes and whole-genome-based phylogeny indicated that the strains studied form a novel Agrobacterium species. Analyses showed that the strains belong to “rubi” sub-clade of Agrobacterium genus and their closest relatives are Agrobacterium rubi and “Agrobacterium bohemicum”. Average nucleotide identity (ANI) and digital DNA–DNA hybridization (dDDH) comparisons between genome sequences of representative strains B7.6T and B19.1.4, and their closest relatives, confirmed the distinct phylogenetic position of studied strains, because obtained values were considerably below the proposed thresholds for the species delineation. The four strains studied were phenotypically distinguishable from other species of the genus Agrobacterium. Overall, polyphasic characterization showed that the strains studied represent a novel species of the genus Agrobacterium, for which the name Agrobacterium vaccinii sp. nov. is proposed. The type strain of A. vaccinii is B7.6T (=CFBP 8740T = LMG 31849T).