RdRp Gene Research Articles

Prevalence of SARS-CoV-2 virus in saliva, stool, and urine samples of COVID-19 patients in Bihar, India.

Introduction. The coronavirus illness caused by SARS-CoV-2 can cause multiple organ involvement, with varying degrees of severity. Besides inhalation as a route for transmission, feco-oral has also been proposed. Its transmission to sewage systems is a growing public health issue. Objective. To detect SARS-CoV-2 RNA in non-respiratory samples (saliva, urine, and stool) collected from COVID-19 cases, in Bihar. Methods. This cross-sectional observational study was conducted from January 2021 to March 2022 on human non-respiratory samples. A total of 345 samples including saliva (116), stool (97), and urine (132) were collected from 143 COVID-19 cases. Samples were analysed for SARS-CoV-2 by multiplex RT-PCR targeted against E, ORF 1ab, and RdRp genes. Results. In this study, out of 143 cases, a total of 107 (74.8 %) were positive for SARS-CoV-2 RNA in at least one of the non-respiratory samples. Conclusion. There is a high prevalence of SARS-CoV-2 virus in non-respiratory samples.

Uncovering Gender and Age Neutrality in CT Values for E and RdRp Gene Amplification in SARS-CoV-2

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) pandemic poses a danger to public health across the world. Specific and sensitive testing is vital to tracking and containing the infected individuals. This study examines the characteristics of 705 patients based on gender and age groups, with a focus on their CT (Cycle Threshold) values associated with E- and RdRp gene amplification. Among the patient cohort, 58.87% were male, while 41.13% were female. Notably, all males and females tested positive for the E gene, achieving a 100% detection rate, whereas the RdRp gene exhibited a slightly lower positive rate of 93.4% in males and 89.6% in females. Statistical analysis through the chi-square test revealed no significant disparities between target genes and gender. Additionally, a one-way ANOVA test demonstrated no significant distinctions between target genes and age groups. This study's findings suggest that gender and age do not significantly influence CT values for E and RdRp gene amplification, and there is no preferred gene for detection, providing valuable insights into the molecular characteristics of the studied cohort.

Detection of SARS-CoV-2 Genes in Stool Samples of COVID-19 Survivors Using the Real-Time Reverse Transcriptase Polymerase Chain Reaction Method

The spread of a pneumonia outbreak infected with the new coronavirus (COVID-19) from Wuhan, China, has spread globally. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has been identified as the pathogen responsible for the pneumonic plague. The angiotensin conversion enzyme (ACE2) is the cellular receptor for SARS-CoV-2 entry. ACE2 is highly expressed in the epithelium of the stomach, duodenum and rectum. In infected patients, some patients infected with SARS-CoV-2 experience unusual symptoms, namely gastrointestinal symptoms, namely diarrhea, nausea and vomiting. This study aims to detect the presence of the SARS-CoV-2 gene in stool samples from COVID-19 survivors using the method real time RT-PCR as the gold standard for confirming COVID-19 with the RdRp and Helicase (ORF1b) target genes. There were 12 samples of COVID-19 survivors who met the inclusion criteria. The results showed that of the 12 samples, 2 samples were positive for SARS-CoV-2 RNA with Ct values of 32.79 and 36.86 which were detected on days 18 and 22 days after their respiratory tract tests were negative.

The effects of Leishmania RNA virus 2 (LRV2) on the virulence factors of L. major and pro-inflammatory biomarkers: an in vitro study on human monocyte cell line (THP-1)

BackgroundCutaneous Leishmaniasis (CL) is a parasitic disease with diverse outcomes. Clinical diversity is influenced by various factors such as Leishmania species and host genetic background. The role of Leishmania RNA virus (LRV), as an endosymbiont, is suggested to not only affect the pathogenesis of Leishmania, but also impact host immune responses. This study aimed to investigate the influence of LRV2 on the expression of a number of virulence factors (VFs) of Leishmania and pro-inflammatory biomarkers.Materials and methodsSample were obtained from CL patients from Golestan province. Leishmania species were identified by PCR (LIN 4, 17), and the presence of LRV2 was checked using the semi-nested PCR (RdRp gene). Human monocyte cell line (THP-1) was treated with three isolates of L. major with LRV2 and one isolate of L. major without LRV2. The treatments with four isolates were administered for the time points: zero, 12, 24, 36, and 48 h after co-infection. The expression levels of Leishmania VFs genes including GP63, HSP83, and MPI, as well as pro-inflammatory biomarkers genes including NLRP3, IL18, and IL1β, were measured using quantitative real-time PCR.ResultsThe expression of GP63, HSP83, and MPI revealed up-regulation in LRV2 + isolates compared to LRV2- isolates. The expression of the pro-inflammatory biomarkers including NLRP3, IL1β, and IL18 genes in LRV2- were higher than LRV2 + isolates.ConclusionThis finding suggests that LRV2 + may have a probable effect on the Leishmania VFs and pro-inflammatory biomarkers in the human macrophage model.

Isolation, molecular characterization, and genetic diversity of recently isolated foot-and-mouth disease virus serotype A in Egypt.

Foot-and-mouth Disease (FMD) is a highly contagious viral disease affecting all hoof-cloven animals. Serotypes A, O and SAT 2 of the foot-and-mouth disease virus (FMDV) are circulating in Egypt. The present study aimed to identify and molecularly characterize the FMDV strains circulating in Northern Egypt during an epidemic that struck the nation in 2022. RNA was extracted from the epithelial specimens, vesicular fluid from affected cattle. The samples were screened using real-time reverse-transcription polymerase chain reaction (RT-PCR) targeting the RNA-dependent RNA polymerase (RdRp) gene. Positive samples underwent individual serotype-specific amplification using primers designed for VP1 of O, A, and SAT 2 serotypes. Subsequently, direct sequencing was performed on the positive samples. The real-time RT-PCR detected positive samples from epithelial and vesicular fluid samples, but not in the blood of infected animals. Out of the 16 samples, seven tested positive for FMDV serotype A. Of these seven positive samples, six were categorized as serotype A-African topotype-G-IV, and these positive samples were isolated in BHK-21 cells, yielding an overt cytopathic effect caused by the virus. In conclusion, it is necessary to sustain continuous surveillance of the evolution of circulating FMDV strains to facilitate the assessment and aid in the selection of vaccine strains for the effective control of FMDV in Egypt.

Subgingival Plaque as a Potential Reservoir for SARS-CoV-2 Virus in Patients Recovered from COVID-19 Infection: A Cross-sectional Study

Background Subgingival plaque biofilm is a potential harboring site for bacteria and viruses, serving as a source of entry into the bloodstream. The presence of Severe Acute Respiratory Syndrome Coronavirus 2 RNA (SARS-CoV-2 RNA) in subgingival plaque could be a possible source for cross infection due to aerosol contamination during dental procedures. Objectives The objective of this study was to investigate the presence of SARS-CoV-2 RNA in the subgingival plaque biofilm of patients who recovered from COVID-19 infection. Materials and Methods Ten subjects visiting the Outpatient clinic with a previous history of COVID-19 infection were recruited for this cross-sectional study. Subgingival plaque sample was collected from all four quadrants using a sterile curette. Nasopharyngeal and oropharyngeal swabs were taken from all the subjects. Reverse transcriptase real-time qualitative polymerase chain reaction (RT-PCR) was used to determine the presence of SARS-CoV-2 RNA using BAG SARS-CoV-2 RT-PCR kit targeting E gene, RdRp gene, and internal control. Results Ten participants (seven females and three males) with a previous history of COVID-19 infection were included in the study. Six participants previously presented with mild COVID-19 infection (uncomplicated upper respiratory tract infection, mild fever, cough, sore throat, nasal congestion, malaise, headache, without evidence of breathlessness or hypoxia), and four participants previously presented with moderate COVID-19 infection (dyspnea and or hypoxia, fever, cough, SpO2 90%–94% on room air, respiratory rate more or equal to 24 per minute) according to clinical management protocol for COVID-19, Government of India. The nasopharyngeal, oropharyngeal, and subgingival plaque samples tested negative for SARS-CoV-2 RNA. Conclusion The absence of the SARS-CoV-2 virus in the subgingival plaque sample of patients recovered from COVID-19 infection suggests that dental plaque could not be a potential reservoir of the virus. However, clinicians should take at most precautions while treating the patients recovered from COVID-19 infection and should anticipate a change in subgingival environment leading to alteration in periodontal disease progression.

Targeted amplicon sequencing facilitated a novel risk assessment framework for assessing the prevalence of broad spectrum bacterial and coronavirus diseases

How to effectively leverage wastewater data to estimate the risk of various infectious diseases remains a great challenge. To address this issue, we conducted continuous wastewater surveillance in Dalian city during the summer-autumn seasons of 2022, targeting coronavirus and bacterial diseases. The surveillance included daily sampling at a wastewater treatment plant (WWTP) and weekly sampling in three sewersheds. Targeting the bacteria's 16S rRNA gene and the coronavirus's RNA-dependent RNA polymerase (RdRp) gene, we first employed RT–PCR and amplicon sequencing techniques to analyze the presence and phylogenetic relationship of detected coronavirus and bacterial pathogens. Next, qPCR was used to quantify the abundances of detected coronavirus and bacterial species. Based on the daily shedding dynamics of SARS-CoV-2, a novel model was developed to predict daily new cases. Based on the medium shedding density of 12 pathogens, two thresholds of sewage pathogen load (indicating 0.1 % and 1 % infection rates) were proposed. Our PanCoV RT–PCR detected coronavirus on 12th August and from 26th August to 12th September 2022. Targeted amplicon sequencing further identified human coronavirus OC43 (hCoV-OC43) on 12th August and the SARS-CoV-2 Omicron variant since 26th August in samples from WWTPs and sewersheds. Phylogenetic analysis revealed that hCoV-OC43 from this study belonged to genotype K and suggested a close relationship between the amplified coronavirus sequences from wastewater and clinical samples in a local COVID-19 outbreak on 26th August. Amplicon sequencing targeting the bacterial 16S rRNA gene also revealed the presence of several bacterial pathogens. Finally, we assessed the microbial risk of specific pathogens in sewersheds and identified a number of pathogens that reached high (>1 % prevalence) and medium risk levels (>0.1 % prevalence) at sewershed B. Our findings underline wastewater surveillance as a valuable early warning system for coronavirus and other waterborne bacterial diseases, complementing public health response measures.

Simple and Multiplexed Detection of Nucleic Acid Targets Based on Fluorescent Ring Patterns and Deep Learning Analysis.

Simple diagnostic tests for nucleic acid targets can provide great advantages for applications such as rapid pathogen detection. Here, we developed a membrane assay for multiplexed detection of nucleic acid targets based on the visualization of two-dimensional fluorescent ring patterns. A droplet of the assay solution is applied to a cellulose nitrate membrane, and upon radial chromatographic flow and evaporation of the solvent, fluorescent patterns appear under UV irradiation. The target nucleic acid is isothermally amplified and is immediately hybridized with fluorescent oligonucleotide probes in a one-pot reaction. We established the fluorescent ring assay integrated with isothermal amplification (iFluor-RFA = isothermal fluorescent ring-based radial flow assay), and feasibility was tested using nucleic acid targets of the receptor binding domain (RBD) and RNA-dependent RNA polymerase (RdRp) genes of SARS-CoV-2. We demonstrate that the iFluor-RFA method is capable of specific and sensitive detection in the subpicomole range, as well as multiplexed detection even in complex solutions. Furthermore, we applied deep learning analysis of the fluorescence images, showing that patterns could be classified as positive or negative and that quantitative amounts of the target could be predicted. The current technique, which is a membrane pattern-based nucleic acid assay combined with deep learning analysis, provides a novel approach in diagnostic platform development that can be versatilely applied for the rapid detection of infectious pathogens.

Metabarcoding of Hepatitis E Virus Genotype 3 and Norovirus GII from Wastewater Samples in England Using Nanopore Sequencing

Norovirus is one of the largest causes of gastroenteritis worldwide, and Hepatitis E virus (HEV) is an emerging pathogen that has become the most dominant cause of acute viral hepatitis in recent years. The presence of norovirus and HEV has been reported within wastewater in many countries previously. Here we used amplicon deep sequencing (metabarcoding) to identify norovirus and HEV strains in wastewater samples from England collected in 2019 and 2020. For HEV, we sequenced a fragment of the RNA-dependent RNA polymerase (RdRp) gene targeting genotype three strains. For norovirus, we sequenced the 5′ portion of the major capsid protein gene (VP1) of genogroup II strains. Sequencing of the wastewater samples revealed eight different genotypes of norovirus GII (GII.2, GII.3, GII.4, GII.6, GII.7, GII.9, GII.13 and GII.17). Genotypes GII.3 and GII.4 were the most commonly found. The HEV metabarcoding assay was able to identify HEV genotype 3 strains in some samples with a very low viral concentration determined by RT-qPCR. Analysis showed that most HEV strains found in influent wastewater were typed as G3c and G3e and were likely to have originated from humans or swine. However, the small size of the HEV nested PCR amplicon could cause issues with typing, and so this method is more appropriate for samples with high CTs where methods targeting longer genomic regions are unlikely to be successful. This is the first report of HEV RNA in wastewater in England. This study demonstrates the utility of wastewater sequencing and the need for wider surveillance of norovirus and HEV within host species and environments.

The First Identification of Cryptosporidium parvum Virus-1 (CSpV1) in Hanwoo (Bos taurus coreanae) Calves in Korea.

Cryptosporidium is an obligate coccidian parasite that causes enteric diseases in bovine species. A double-stranded RNA virus associated with C. parvum oocysts, Cryptosporidium parvum virus-1 (CSpV1), has been characterized. However, the relationship between the abovementioned coccidian parasite and the virus has not been studied in the context of the known clinical outcomes. This study aimed to characterize the prevalence and molecular traits of CSpV1 in diarrheal feces of Hanwoo (Korean indigenous cattle) calves. Of the 140 fecal samples previously tested for C. parvum, which were obtained from Hanwoo calves aged 60 days, 70 tested positive and 70 tested negative. These samples were included in this study. By using the polymerase chain reaction (PCR) analysis targeting the RdRp gene of CSpV1, we detected CSpV1 in 28 samples (20.0%), with infection rates of 31.4% (22/70) in C. parvum-positive and 8.6% (6/70) in C. parvum-negative samples. CSpV1 samples detected in the same farm were clustered together. To the best of our knowledge, this is the first study to report the prevalence and molecular characteristics of CSpV1 in Hanwoo calves in the Republic of Korea, providing important insights into the relationship between C. parvum and CSpV1 in bovine hosts.

A coronavirus-mimic mesoporous silica nanosystem enables efficient targeted delivery of siRNA for anti-SARS-CoV‐2

The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection has been a threat to human beings' health. However, there is still a lack of effective specific antiviral drugs for SARS-CoV-2 at present, which calls for the exploitation of new potent and safe therapeutic agents. Short-interfering RNA (siRNA), as a powerful RNA interference (RNAi) tool, can be designed to target virus-related genes and degrade them with high efficiency, presenting great potential for confronting SARS-CoV-2 infection. Despite the promises, effective delivery of synthetic siRNA into the virus-infected host cells for therapy remains a challenge. Herein, a SARS-CoV-2 spike (S) protein-decorated dendritic mesoporous silica nanoparticle (DMSN) was developed for targeted delivery of the RNA-dependent RNA polymerase (RdRp)-specific siRNA for anti-SARS-CoV‐2. The biocompatible DMSN with a large pore structure and surface area enabled the high siRNA loading and protected siRNA from nuclease-mediated degradation. On the basis of the specific binding between S protein and angiotensin-converting enzyme 2 (ACE2) receptor, the designed nanosystem could imitate coronavirus to target the host cells and promote the cellular internalization of siRNA. The results demonstrated that the designed siRNA delivery nanosystem showed an improved silencing effect on the transfected SARS-CoV-2 RdRp gene in the ACE2-overexpressed host cells. Moreover, such nanosystem could be inhaled and accumulated in the lung of living body through a nebulized administration, offering a promising treatment option for SARS-CoV‐2 infection.

Molecular Characteristics of Barley Yellow Dwarf Virus-PAS-The Main Causal Agent of Barley Yellow Dwarf Disease in Poland.

Barley yellow dwarf is a threat to cereal crops worldwide. Barley yellow dwarf virus-PAS (BYDV-PAS) was detected for the first time in Poland in 2015, then in 2019. In the spring of 2021, in several locations in Poland, winter wheat and barley plants with dwarfism and leaf yellowing were collected. Reverse transcription-polymerase chain reaction results revealed BYDV presence in 47 samples and excluded wheat streak mosaic virus infections. Next, immuno-captured polymerase chain reactions confirmed only one case of co-infection caused by BYDV and wheat dwarf virus. Moreover, restriction fragment length polymorphism analysis showed that BYDV-PAS was predominant. The preliminary results were confirmed using sequencing. Infected cereal plants originated mainly from northwestern Poland. The complete coding sequence of coat protein (CP) and a fragment of RNA-dependent RNA polymerase (RdRp) genes of 14 Polish isolates were determined and deposited in the GenBank database. The nucleotide and deduced amino acid sequences of local isolates were compared with others reported to date, indicating their high similarity, from 75.4% to 99.5% and from 81.1% to 100% nucleotide sequence identity, in RdRp and CP, respectively. Phylogenetic analysis, based on the CP gene, revealed the presence of 3 main groups. The Polish isolates clustered together within the Ia group.

Genotypic diversity and recombination of norovirus GI.6[P11] associated acute gastroenteritis outbreaks in Beijing, China, from 2016 to 2019.

Norovirus (NoV) is the leading pathogen responsible for global acute gastroenteritis (AGE) outbreaks and sporadic cases. NoV evolves through gene mutation and recombination, leading to the emergence of new strains capable of causing global epidemics. This study aimed to learn the epidemiological characteristics of 39 GI.6[P11] NoV outbreaks in Beijing, China, from 2016 to 2019 and to analyze the genetic diversity and phylogenetic process of GI.6[P11] strains. The Bayesian phylogenetic analysis of partial VP1 and RNA-dependent RNA polymerase (RdRp) genes showed that GI.6[P11] strains were clustered into four subclades. Eleven whole genome sequences were obtained through the amplicon sequencing with 16 pairs of newly designed primers. The phylogenetic trees based on the whole genome and ORF1, 2, and 3 showed that the clustering of the 11 strains was consistent with that of partial VP1 and RdRp genes. The Bayesian inference revealed that the most recent ancestor (TMRCA) for the four subclades of the phylogenetic tree based on the whole genome sequences was 2012.42, 2014.81, 2011.74, and 2015.53, respectively. The recombination sites of GI.6[P11] strains in Beijing were located near the ORF1/2 junction. The histo-blood group antigens (HBGA) binding sites of GI.6[P11] strains in Beijing were conserved and there were some unique amino acid mutations in non-structural proteins in the ORF1 region.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

Association of N and E Genes with ORF1b Gene for Early Detection of COVID-19 in Pakistani Patients

OBJECTIVE: To investigate the role of the first line and additional confirmatory assay to detect coronavirus based on Ct RT-PCR values. METHODOLOGY: A collaborative cross-sectional study was conducted using a systematic sampling type at Hyderabad's diagnostic and research laboratory and the SIOVS, Hyderabad, after getting ethical approval from the LUMHS ERC committee from July 2021 to June 2022. A total of 4822 patients have enrolled; 1200 patients were positive for COVID-19, and a nasopharyngeal swab was collected from patients for RNA extraction; the patients positive with COVID-19 RT-PCR test were included, and patients negative with COVID-19 RT-PCR were excluded out from this study. The RT-PCR was performed, and the Ct values of each potential target were recorded. RESULTS: The RT-PCR finding of potential targets revealed that the N and E genes are correlated and simultaneously positive with OFRb1 and RdRP genes and are crucial for detecting coronavirus. In 77.5% (310/400) of patients, the E gene was positive, and the N gene was positive in 85.8% (1030/1200) patients with ORF1b and Rdrp genes. 71% (850/1200) of males were infected in our cohort, and young patients carried the highest viral load than old age patients with asymptomatic features. Each target's obtained cycler threshold values by different kits were recorded and analyzed in SPSS-17. CONCLUSION: The data showed N and E genes are simultaneously associated with the ORFb1 gene for detecting COVID-19 in our patients. KEY WORDS: SARS CoV-2, COVID-19, E gene, N gene, ORF1b gene, RT-PCR

Epidemiological application of the cycle threshold value of RT-PCR for estimating infection period in cases of SARS-CoV-2

Epidemiological control of coronavirus disease 2019 (COVID-19) is needed to estimate the infection period of confirmed cases and identify potential cases. The present study, targeting confirmed cases for which the time of COVID-19 symptom onset was disclosed, aimed to investigate the relationship between intervals (day) from symptom onset to testing the cycle threshold (CT) values of real-time reverse transcription-polymerase chain reaction. Of the COVID-19 confirmed cases, those for which the date of suspected symptom onset in the epidemiological investigation was specifically disclosed were included in this study. Interval was defined as the number of days from symptom onset (as disclosed by the patient) to specimen collection for testing. A locally weighted regression smoothing (LOWESS) curve was applied, with intervals as explanatory variables and CT values (CTR for RdRp gene and CTE for E gene) as outcome variables. After finding its non-linear relationship, a polynomial regression model was applied to estimate the 95% confidence interval values of CTR and CTE by interval. The application of LOWESS in 331 patients identified a U-shaped curve relationship between the CTR and CTE values according to the number of interval days, and both CTR and CTE satisfied the quadratic model for interval days. Active application of these results to epidemiological investigations would minimize the chance of failing to identify individuals who are in contact with COVID-19 confirmed cases, thereby reducing the potential transmission of the virus to local communities.

A-275 Clinical Evaluation of SMARTCHEK® SARS-CoV-2 Detection Kit and SMARTCHEK® SARS-CoV-2 Fast Detection Kit for Detection of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in Nasopharyngeal Swabs

Abstract Background Rapid and accurate diagnosis of COVID-19 is very important in our daily lives. SMARTCHEK® SARS-CoV-2 Detection Kit (Genesystem, Daejeon, Korea) and SMARTCHEK® SARS-CoV-2 Fast Detection Kit (Genesystem) are rapid PCR kits for SARS-CoV-2 using a microfluidic chip-based PCR method. These two kits can provide results in 40 min and 20 min, respectively, enabling rapid point-of-care diagnostics. In this study, the diagnostic performance of SMARTCHEK® SARS-CoV-2 Detection Kit and SMARTCHEK® SARS-CoV-2 Fast Detection Kit using UF-340 Four-in-One Real-time PCR System (Genesystem) were compared to STANDARD M nCoV Real-Time Detection kit (SD Biosensor, Korea) using CFX96 Dx System (Bio-Rad, USA) in nasopharyngeal swabs. Methods Nasopharyngeal swabs were collected and frozen (at ≤−70°C) using 500ul of the residual samples of 64 patients who underwent COVID-19 PCR at Ajou University Hospital. After thawing, RNA was extracted with TANBead OptiPure Nucleic Acid Auto Plate (Taiwan Advanced Nanotech Inc., Taoyuan, Taiwan) using SLA-E13200 (Taiwan Advanced Nanotech Inc.), and real time PCR was performed according to the manufacturer’s instructions. For correlation evaluation, positive, negative, and overall concordance rates were calculated. Results Among 64 samples, results from STANDARD M nCoV Real-Time Detection kit showed 49 negative (77%) and 15 positive (23%) results. Ct value exceeding 30 was observed in 4 samples (27% of positive samples). The positive, negative, and overall concordance rates of the STANDARD M nCoV Real-Time Detection Kit and SMARTCHEK® SARS-CoV-2 Detection Kit were all 100%. One positive sample with the STANDARD M nCoV Real-Time Detection Kit (Ct value: E gene 34.5, RdRp gene 35.5) was excluded from the analysis because the results could not be determined even after repeated testing with SMARTCHEK® SARS-CoV-2 Detection Kit. The positive, negative, and overall concordance rate of the STANDARD M nCoV Real-Time Detection Kit and SMARTCHEK® SARS-CoV-2 Fast Detection Kit were 87%, 100%, and 97%, respectively. Both of the two discrepant samples had a Ct value close to 35. Conclusion SMARTCHEK® SARS-CoV-2 Detection Kit and SMARTCHEK® SARS-CoV-2 Fast Detection Kit can quickly and accurately diagnose COVID-19 in nasopharyngeal swabs and is especially useful in small to medium-sized laboratories or areas where space or equipment is limited.

A-259 Detecting Human RNase P Gene Prevents False-Negative of SARS-CoV-2

Abstract Background Real-time Reverse transcriptase—polymerase chain reaction (RT-PCR) is a regular technique for detecting SARS-CoV-2 infection. Human RNase P sequence is using as internal control for PCR assay usually. This article discusses the correlation between SARS-CoV-2 PCR result and human RNase P gene result. Methods Nasopharyngeal swabs were collected from two patients within three consecutive days. We detected for SARS-CoV-2 target gene and human RNase P gene by using real-time RT-PCR assay, which SARS-CoV-2 target gene includes E gene, Rarp gene and N gene . And the threshold cycle values (Ct) were determined by cobas® z 480. Evaluate the results of SARS-CoV-2 and RNase P gene detection. All samples were also analysis for SARS-CoV-2 infection in Taiwan Centers for Disease Control. Results Results of SARS-CoV-2 PCR assay were consistent in both laboratories. SARS-CoV-2 target genes were detected from specimens of both patients on day1. Ct values of E gene were 29.63 and 29.50. Ct values of Rdrp gene were 32.23 and 32.50. Ct values of N gene were 33.09 and 32.68. Ct values of RNase P gene were 21.21 and 21.22. On day 2 and 3, all specimens were negative detected for SARS-CoV-2 PCR. Ct values of RNase P gene were 25.73 and 26.16 on day 2 and 29.82 and 30.28 on day 3. Conclusion The Ct values of human RNase P gene detection can be correlated with the numbers of collected cells. Comparing the results of two patients for three consecutive days, the Ct value of human RNase P gene related to SARS-CoV-2 PCR result. Collection technique can be a factor to affect Ct value of human RNase P gene detection. Develop acceptance range for Ct value of RNase P gene detection can be a quality standard for sample collection to prevent false-negative of SARS-CoV-2.

Detection of Alpha- and Betacoronaviruses in Small Mammals in Western Yunnan Province, China.

The genetic diversity of coronaviruses (CoVs) is high, and their infection in animals has not yet been fully revealed. By RT-PCR detection of the partial RNA-dependent RNA polymerase (RdRp) gene of CoVs, we screened a total of 502 small mammals in the Dali and Nujiang prefectures of Western Yunnan Province, China. The number of overall CoV positives was 20, including β-CoV (n = 13) and α-CoV (n = 7), with a 3.98% prevalence in rectal tissue samples. The identity of the partial RdRp genes obtained for 13 strains of β-CoV was 83.42-99.23% at the nucleotide level, and it is worth noting that the two strains from Kachin red-backed voles showed high identity to BOV-36/IND/2015 from Indian bovines and DcCoV-HKU23 from dromedary camels (Camelus dromedarius) in Morocco; the nucleotide identity was between 97.86 and 98.33%. Similarly, the identity of the seven strains of α-CoV among the partial RdRp sequences was 94.00-99.18% at nucleotide levels. The viral load in different tissues was measured by quantitative RT-PCR (qRT-PCR). The average CoV viral load in small mammalian rectal tissue was 1.35 × 106 copies/g; differently, the mean CoV viral load in liver, heart, lung, spleen, and kidney tissue was from 0.97 × 103 to 3.95 × 103 copies/g, which revealed that CoV has extensive tropism in rectal tissue in small mammals (p < 0.0001). These results revealed the genetic diversity, epidemiology, and infective tropism of α-CoV and β-CoV in small mammals from Dali and Nujiang, which deepens the comprehension of the retention and infection of coronavirus in natural hosts.

Determination and analysis of whole genome sequence of recombinant GII.6[P7] norovirus in Ningxia, China

While the GII.4 norovirus was the predominant genotype, non-GII.4 genotype was increasingly focused since the non-GII.4 genotype caused regional epidemics. In this study, the detection rate was16.51% (183/1108) in Ningxia from January to December 2020. Among identified genotypes, GII.4[P31] and GII.4[P16] were the dominant genotypes (n = 20 and 18, respectively) while GII.6[P7] was the main type (n = 6) in non-GII.4 strains which was mainly detected in from May to July. The whole genome sequences of the norovirus diarrhea samples identified as GII.6 [P7] with Ct ≤ 30 collected in 2020 were determined. In this study, the complete genome sequences of norovirus strains PL20–044 and QTX20–071 were identified and analyzed phylogenetically. Phylogenetic analysis of the ORF1and ORF2 regions showed that these strains evolved from the GII·P7-GII.6 strains detected in recent years from different country. The results showed that PL20–044 had intra-type recombination with GII·P7-GII.6c and GII·P7-GII.6a, while QTX20–071 had intre-type recombination within GII·P7-GII.6a. The evolutionary rates of the RdRp gene region of the GII·P7 genotype and the VP1 gene region of the GII.6 genotype were 2.91 × 10−3 (95%HPDs2.32–3.51 × 10−3) and 2.61 × 10−3 (95%HPDs2.14–3.11 × 10−3) substitutions/site/year, respectively. Comparative analysis of the amino acid mutation sites in VP1 with the GII·P7-GII.6a strains before 1997, the later detected strains have changed in aa131 and aa354. Moreover, PL20–044 strains showed special mutations at aa316 and aa395. These results help to understand the norovirus genotype circulating in the human population in Ningxia, and discover the evolutionary characteristics of the GII·P7-GII.6 strain.