Pyrophosphate-fructose 6-phosphate 1-phosphotransferase Research Articles

Genome-wide identification of the PFK gene family and their expression analysis in Quercus rubra.

The glycolytic pathway involves phosphofructokinase (PFK), a rate-limiting enzyme that catalyzes the phosphorylation of fructose-6-phosphate. In plants, the two PFK members are ATP-dependent phosphofructokinase (PFK) and pyrophosphate-fructose-6-phosphate phosphotransferase (PFP). However, the functions of the PFK family members in Quercus rubra are not well understood. The purpose of this study was to investigate the genome-wide distribution of the PFK family members and their roles in Q. rubra by performing a systematic study of the phylogenetic relationships, molecular characteristics, motifs, chromosomal and subcellular locations, and cis-elements of QrPFKs. We identified 14 QrPFK genes in the genome of Q. rubra, followed by examining their expression in different tissues, including the roots, stems, and leaves. The phylogenetic tree divided the 14 QrPFK genes into two groups: 11 belonging to PFK and three belonging to PFP. The expression profiles of all 14 proteins were relatively the same in leaves but differed between stems and roots. Four genes (Qurub.02G189400.1, Qurub.02G189400.2, Qurub.09G134300.1, and Qurub.09G134300.2) were expressed at very low levels in both stems and roots, while two (Qurub.05G235500.1 and Qurub.05G235500.1) were expressed at low levels and the others showed relatively high expression in all tissues.

Quantitative proteomic analyses of two soybean low phytic acid mutants to identify the genes associated with seed field emergence

BackgroundSeed germination is essential to crop growth and development, and ultimately affects its harvest. It is difficult to breed soybeans low in phytic acid with a higher seed field emergence. Although additional management and selection could overcome the phytate reduction, the mechanisms of seed germination remain unknown.ResultsA comparative proteomic analysis was conducted between two low phytic acid (LPA) soybean mutants (TW-1-M and TW-1), both of which had a deletion of 2 bp in the GmMIPS1 gene. However, the TW-1 seeds showed a significantly lower field emergence compared to the TW-1-M. There were 282 differentially accumulated proteins (DAPs) identified between two mutants at the three stages. Among these DAPs, 80 were down-accumulated and 202 were up-accumulated. Bioinformatic analysis showed that the identified proteins were related to functional categories of oxidation reduction, response to stimulus and stress, dormancy and germination processes and catalytic activity. KEGG analysis showed that these DAPs were mainly involved in energy metabolism and anti-stress pathways. Based upon the conjoint analysis of DAPs with the differentially expressed genes (DEGs) previously published among three germination stages in two LPA mutants, 30 shared DAPs/DEGs were identified with different patterns, including plant seed protein, beta-amylase, protein disulfide-isomerase, disease resistance protein, pyrophosphate-fructose 6-phosphate 1-phosphotransferase, cysteine proteinase inhibitor, non-specific lipid-transfer protein, phosphoenolpyruvate carboxylase and acyl-coenzyme A oxidase.ConclusionsSeed germination is a very complex process in LPA soybean mutants. The TW-1-M and TW-1 showed many DAPs involved in seed germination. The differential accumulation of these proteins could result in the difference of seed field emergence between the two mutants. The high germination rate in the TW-1-M might be strongly attributed to reactive oxygen species-related and plant hormone-related genes. All these findings would help us further explore the germination mechanisms in LPA crops.

Molecular characterization and in vitro interaction analysis of Op14-3-3 μ protein from Opuntia ficus-indica: identification of a new client protein from shikimate pathway

In plants, 14-3-3 proteins are important modulators of protein-protein interactions in response to environmental stresses. The aim of the present work was to characterize one Opuntia ficus-indica 14-3-3 and get information about its client proteins. To achieve this goal, O. ficus-indica 14-3-3 cDNA, named as Op14-3-3 μ, was amplified by 3’-RACE methodology. Op14-3-3 μ contains an Open Reading Frame of 786 bp encoding a 261 amino acids protein. Op14-3-3 μ cDNA was cloned into a bacterial expression system and recombinant protein was purified. Differential Scanning Fluorimetry, Dynamic Light Scattering, and Ion Mobility-Mass Spectrometry were used for Op14-3-3 μ protein characterization, and Affinity-Purification-Mass Spectrometry analysis approach was used to obtain information about their potential client proteins. Pyrophosphate-fructose 6-phosphate 1-phosphotransferase, ribulose bisphosphate carboxylase large subunit, and vacuolar-type H+-ATPase were identified. Interestingly chorismate mutase p-prephenate dehydratase was also identified. Op14-3-3 μ down-regulation was observed in Opuntia calluses when they were induced with Jasmonic Acid, while increased accumulation of Op14-3-3 μ protein was observed. The putative interaction of 14-3-3 μ with chorismate mutase, which have not been reported before, suggest that Op14-3-3 μ could be an important regulator of metabolites biosynthesis and responses to stress in Opuntia spp. SignificanceOpuntia species are important crops in arid and semiarid areas worldwide, but despite its relevance, little information about their tolerance mechanism to cope with harsh environmental conditions is reported. 14-3-3 proteins have gained attention due to its participation as protein-protein regulators and have been linked with primary metabolism and hormones responses. Here we present the characterization of the first Opuntia ficus-indica 14-3-3 (Op14-3-3) protein using affinity purification-mass spectrometry (AP-MS) strategy. Op14-3-3 has high homology with other 14-3-3 from Caryophyllales. A novel Op14-3-3 client protein has been identified; the chorismate mutase p-prephenate dehydratase, key enzyme that links the primary with secondary metabolism. The present results open new questions about the Opuntia spp. pathways mechanisms in response to environmental stress and the importance of 14-3-3 proteins in betalains biosynthesis.

Early events following phosphorus restriction involve changes in proteome and affects nitric oxide metabolism in soybean leaves

Phosphorus (P) is a macronutrient with structural and regulatory functions, essential for energy transfer. Under limited P availability, plant cells respond to internal signals, adjusting their metabolic pathways in order to reorganize physiological priorities. This work was conducted with the aim to explore the initial changes following P deprivation, before neither growth nor photosynthesis was strongly affected. The first unifoliate leaves of nine-day-old soybean plants (Glycine max, cv. Williams 82) were analyzed. Plants grown hydroponically under control conditions (+P, nutrient solution with 500 μM H2PO4−) were compared with those restricted in phosphate (-P, without H2PO4− in the nutrient solution). No visible symptoms of P-deficiency, such as changes in pigment intensity and leaf number or size, were observed up to 48 h of P deprivation. Neither fresh weight nor shoot/root FW ratio was affected in plants as a consequence of early P-restriction. Shotgun proteomic analyses of leaves from plants exposed to 24 h of P-deprivation, revealed that a total of 202 proteins were exclusively detected and 232 increased their relative abundance under –P conditions. The proteins affected belong mainly to the catalytic activity group according to Gene Ontology Consortium including proteins like 6-phosphogluconate dehydrogenase (from pentose phosphate pathway), pyrophosphate-fructose 6-phosphate 1-phosphotransferase subunit alpha, alpha-1,4 glucan phosphorylases (from carbohydrate metabolic processes), and other enzymes involved in metabolic processes such as glyceraldehyde-3-phosphate dehydrogenase, pyruvate kinase and fructose-bisphosphate aldolase (from gycolisis), and nitrate reductase (from nitrogen assimilation). Early events in leaves also involve higher levels of the bioactive molecule nitric oxide (NO), detected employing confocal laser microscopy, accompanied with a parallel increase in nitrate reductase activity. Furthermore, the presence of nitrated proteins was detected using shotgun liquid chromatography–mass spectrometry (LCMS/MS). This post-translational protein modification, affected proteins mainly related to photosynthesis (chlorophyll a–b binding protein, ribulose bisphosphate carboxylase), and some other metabolic processes (glutamine synthetase, methionine synthase, lipoxygenase). This methodology allowed the confirmation of nitration sites in proteins previously described as putatively nitrated. Taken together the data presented suggest important metabolic changes, including nitric oxide metabolism, during the first hours of P deprivation.

Mapping and comparative proteomic analysis of the starch biosynthetic pathway in rice by 2D PAGE/MS.

Our results not only provide a comprehensive overview of the starch biosynthetic pathway in the developing endosperm but also reveal some important protein markers that regulate the synthesis of starch. In human diets, rice (Oryza sativa L.) is an important source of starch, a substantial amount of which is accumulated in developing endosperm. A better understanding of the complicated pathways involved in starch biosynthesis is needed to improve the yield and quality of rice and other cereal crops through breeding. One pure line rice mutant, SA0419, was induced from a wild-type rice, TNG67, by sodium azide mutagenesis; therefore, TNG67 and SA0419 share the same genetic background. SA0419 is, however, a unique glutinous rice with a lower amylose content (8%) than that of TNG67 (20%), and the grains of SA0419 develop earlier and faster than those of TNG67. In this study, we used a comparative proteomic analysis to identify the differentially expressed proteins that may explain the differences in starch biosynthesis and the characteristics of TNG67 and SA0419. A gel-based proteomic approach was applied to profile the expressed proteome in the developing endosperm of these two rice varieties by nano-LC/MS/MS. Several over-expressed proteins were found in SA0419, such as plastidial ADP-glucose pyrophosphorylase (AGPase), phosphoglucomutase (PGM), pyrophosphate-fructose 6-phosphate 1-phosphotransferase (PFP), 6-phosphofructokinase (PFK), pyruvate phosphate dikinase (PPDK), starch branching enzymes (SBE) and starch debranching enzyme (SDBE), with those proteins mainly being involved in the pathways of starch metabolism and PPDK-mediated gluconeogenesis. Those over-expressed enzymes may contribute to the relatively early development, similar starch accumulation and rapid grain filling of SA0419 as compared with TNG67. This study provides a detailed biochemical description of starch biosynthesis and related information regarding a unique starch mutant that may assist future research efforts to improve the yield and quality of grain and starch in rice through breeding.

ITRAQ-based proteome profile analysis of superior and inferior Spikelets at early grain filling stage in japonica Rice

BackgroundLarge-panicle rice varieties often fail to achieve their yield potential due to poor grain filling of late-flowering inferior spikelets (IS). The physiological and molecular mechanisms of poor IS grain filling, and whether an increase in assimilate supply could regulate protein abundance and consequently improve IS grain filling for japonica rice with large panicles is still partially understood.ResultsA field experiment was performed with two spikelet removal treatments at anthesis in the large-panicle japonica rice line W1844, including removal of the top 1/3 of spikelets (T1) and removal of the top 2/3 of spikelets (T2), with no spikelet removal as a control (T0). The size, weight, setting rate, and grain filling rate of IS were significantly increased after spikelet removing. The biological functions of the differentially expressed proteins (DEPs) between superior and inferior spikelets as well as the response of IS to the removal of superior spikelets (SS) were investigated by using iTRAQ at 10 days post anthesis. A total of 159, 87, and 28 DEPs were identified from group A (T0-SS/T0-IS), group B (T0-SS/T2-IS), and group C (T2-IS/T0-IS), respectively. Among these, 104, 63, and 22 proteins were up-regulated, and 55, 24, and 6 proteins were down-regulated, respectively. Approximately half of these DEPs were involved in carbohydrate metabolism (sucrose-to-starch metabolism and energy metabolism) and protein metabolism (protein synthesis, folding, degradation, and storage).ConclusionsReduced endosperm cell division and decreased activities of key enzymes associated with sucrose-starch metabolism and nitrogen metabolism are mainly attributed to the poor sink strength of IS. In addition, due to weakened photosynthesis and respiration, IS are unable to obtain a timely supply of materials and energy after fertilization, which might be resulted in the stagnation of IS development. Finally, an increased abundance of 14–3-3 protein in IS could be involved in the inhibition of starch synthesis. The removal of SS contributed to transfer of assimilates to IS and enhanced enzymatic activities of carbon metabolism (sucrose synthase, starch branching enzyme, soluble starch synthase, and pullulanase) and nitrogen metabolism (aspartate amino transferase and alanine amino transferase), promoting starch and protein synthesis in IS. In addition, improvements in energy metabolism (greater abundance of pyrophosphate-fructose 6-phosphate 1-phosphotransferase) might be played a vital role in inducing the initiation of grain filling. These results collectively demonstrate that carbohydrate supply is the main cause of poor IS grain filling.

Pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) regulates carbon metabolism during grain filling in rice.

Key messageDecreased PFPase activity in rice perturbs the equilibration of carbon metabolism during grain filling but has no visible phenotypic effects during the vegetative and reproductive growth stages.Starch is a primary energy reserve for various metabolic processes in plant. Despite much advance has been achieved in pathways involved in starch biosynthesis, information was still lacked for precise regulation related to carbon metabolism during seed filling in rice (Oryza sativa). The objective of this study was to identify and characterize new gene associated with carbon metabolism during grain filling. By screening our chemical mutant pool, two allelic mutants exhibiting floury endosperm were isolated. No visible phenotypic defects were observed during both the vegetative and reproductive growth stages, except for the floury-like endosperm of grains with significantly reduced kernel thickness, 1000-grain weight and total starch content. Map-based cloning revealed that the mutant phenotypes were controlled by a gene encoding pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP, EC 2.7.1.90) β subunit (PFPβ), which catalyzes reversible interconversion between fructose-6-phosphate and fructose-1, 6-bisphosphate. The identity of PFPβ was further confirmed by a genetic complementation test. Subcellular analysis demonstrated that PFPβ was localized in cytoplasm. Quantitative PCR and histochemical staining indicated PFPβ was ubiquitously expressed in various tissues. Furthermore, we found PFPβ could express in both the early and late phases of starch accumulation during grain filling and decreased activity of PFPβ in pfp mutants resulted in compromised carbon metabolism with increased soluble sugar contents and unfavorable starch biosynthesis. Our results highlight PFPβ functions in modulating carbon metabolism during grain filling stage.Electronic supplementary materialThe online version of this article (doi:10.1007/s00299-016-1964-4) contains supplementary material, which is available to authorized users.

Pyrophosphate: fructose-6-phosphate 1-phosphotransferase is involved in the tolerance of Arabidopsis seedlings to salt and osmotic stresses

In plants, pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) is a regulatory enzyme that participates in glycolysis and gluconeogenesis. Arabidopsis contains two PFPα subunit genes (PFPα1 and PFPα2) and two PFPβ subunit genes (PFPβ1 and PFPβ2). The single-knockout mutants of the PFP subunit genes were isolated, and double and quadruple pfp mutants were generated by crossing the single mutants. To elucidate the role of PFP in stress tolerance, the responses of the double and quadruple pfp knockout mutants to stress conditions, including osmotic and salt stresses, were examined. The seedling growth of the pfpα1/α2 and pfpβ1/β2 double mutants and the pfpα1/α2/β1/β2 quadruple mutant was severely retarded under salt and osmotic stress conditions compared with that of the wild type. The expression of PFP subunit genes increased in response to salt and osmotic stresses. In contrast, the vegetative growth of the wild type and pfp mutants after the seedling stage was similarly affected by salt and osmotic stresses. These findings suggest that PFP plays a role in the adaptation of Arabidopsis seedlings to salt and osmotic stresses.

Characterization of the phosphofructokinase gene family in rice and its expression under oxygen deficiency stress.

Plants possess two types of phosphofructokinase proteins for phosphorylation of fructose-6-phosphate, the ATP-dependent phosphofructokinase (PFK) and the pyrophosphate-(PPi) dependent pyrophosphate-fructose-6-phosphate-phosphotransferase (PFP). During oxygen deficiency ATP levels in rice seedlings are severely reduced, and it is hypothesized that PPi is used as an alternative energy source for the phosphorylation of fructose-6-phosphate during glycolysis. In this study, we analyzed the expression of 15 phosphofructokinase-encoding genes in roots and aerial tissues of anoxia-tolerant rice seedlings in response to anoxic stress and compared our data with transcript profiles obtained from microarray analyses. Furthermore, the intracellular localization of rice PFK proteins was determined, and the PFK and PFP isoforms were grouped in a phylogenetic tree. Two PFK and two PFP transcripts accumulated during anoxic stress, whereas mRNA levels of four PFK and three PFP genes were decreased. The total specific activity of both PFK and PFP changed only slightly during a 24-h anoxia treatment. It is assumed that expression of different isoforms and their catalytic properties differ during normoxic and anoxic conditions and contribute to balanced glycolytic activity during the low-oxygen stress. These characterizations of phosphofructokinase genes and the comparison to other plant species allowed us to suggest candidate rice genes for adaptation to anoxic stress.

High activities and mRNA expression of pyrophosphate-fructose-6-phosphate-phosphotransferase and 6-phosphofructokinase are induced as a response to Rhizoctonia solani infection in rice leaf sheaths

Rice sheath blight disease caused by Rhizoctonia solani Kuhn results in significant yield and quality losses in rice growing areas worldwide. The glycolytic pathway is important in the resistance response to R. solani infection in rice. This study examined one of the regulatory steps in this pathway catalyzed by pyrophosphate-fructose-6-phosphate-phosphotransferase (PFP) and 6-phosphofructokinase (PFK). PFP and PFK activity in R. solani-infected rice plants increased. The mRNA expression of PFP/PFK isozymes showed that PFK 1, 2, 4 and 5 in the resistant line at 1 dpi were high as compared to the gradual increase observed in the expression of all PFP isozymes. Also PFK 1, PFK 3, PFK 4, PFK 5, PFP 2 and PFP 5 were adaptive to sheath blight disease infection and linked to defence response while, the expressions of PFK 2, PFP 1, PFP 3 and PFP 4 although adaptive, were not specific to R. solani infection. These observations provide evidence that (a) both PFP and PFK have isozymes that play an adaptive role after R. solani infection but while those of PFK are expressed at higher levels within a short time after infection those of PFP are expressed gradually, (b) the adaptive activation of PFP in R. solani-infected rice plants is correlated with the paired expression of its α- and β-subunits as shown by PFP 2 and PFP 5, and (c) the expression of some α-subunits is not specific to R. solani infection as shown by PFP 1, PFP 3 and PFP 4.

Upregulation of pyrophosphate: fructose 6-phosphate 1-phosphotransferase (PFP) activity in strawberry

Pyrophosphate: fructose 6-phosphate 1-phosphotransferase (PFP) is a cytosolic enzyme catalyzing the first committed step in glycolysis by reversibly phosphorylating fructose-6-phosphate to fructose-1,6-bisphosphate. The position of PFP in glycolytic and gluconeogenic metabolism, as well as activity patterns in ripening strawberry, suggest that the enzyme may influence carbohydrate allocation to sugars and organic acids. Fructose-2,6-bisphosphate activates and tightly regulates PFP activity in plants and has hampered attempts to increase PFP activity through overexpression. Heterologous expression of a homodimeric isoform from Giardia lamblia, not regulated by fructose-2,6-bisphosphate, was therefore employed to ensure in vivo increases in PFP activity. The coding sequence was placed into a constitutive expression cassette under control of the cauliflower mosaic virus 35S promoter and introduced into strawberry by Agrobacterium tumefaciens-mediated transformation. Heterologous expression of PFP resulted in an up to eightfold increase in total activity in ripe berries collected over two consecutive growing seasons. Total sugar and organic acid content of transgenic berries harvested during the first season were not affected when compared to the wild type, however, fructose content increased at the expense of sucrose. In the second season, total sugar content and composition remained unchanged while the citrate content increased slightly. Considering that PFP catalyses a reversible reaction, PFP activity appears to shift between gluconeogenic and glycolytic metabolism, depending on the metabolic status of the cell.

Altered expression of pyrophosphate: fructose-6-phosphate 1-phosphotransferase affects the growth of transgenic Arabidopsis plants.

Pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) catalyzes the reversible interconversion of fructose-6-phosphate and fructose-1,6-bisphosphate, a key step in the regulation of the metabolic flux toward glycolysis or gluconeogenesis. To examine the role of PFP in plant growth, we have generated transgenic Arabidopsis plants that either overexpress or repress Arabidopsis PFP sub-unit genes. The overexpressing lines displayed increased PFP activity and slightly faster growth relative to wild type plants, although their photosynthetic activities and the levels of metabolites appeared not to have significantly changed. In contrast, the RNAi lines showed significantly retarded growth in parallel with the reduced PFP activity. Analysis of photosynthetic activity revealed that the growth retardation phenotype of the RNAi lines was accompanied by the reduced rates of CO(2) assimilation. Microarray analysis of our transgenic plants further revealed that the altered expression of AtPFPbeta affects the expression of several genes involved in diverse physiological processes. Our current data thus suggest that PFP is important in carbohydrate metabolism and other cellular processes.

Down-regulation of pyrophosphate: fructose 6-phosphate 1-phosphotransferase (PFP) activity in sugarcane enhances sucrose accumulation in immature internodes

Pyrophosphate: fructose 6-phosphate 1-phosphotransferase (PFP) activity was successfully down-regulated in sugarcane using constitutively expressed antisense and untranslatable forms of the sugarcane PFP-beta gene. In young internodal tissue activity was reduced by up to 70% while no residual activity could be detected in mature tissues. The transgenic plants showed no visible phenotype or significant differences in growth and development under greenhouse and field conditions. Sucrose concentrations were significantly increased in the immature internodes of the transgenic plants but not in the mature internodes. This contributed to an increase in the purity of the immature tissues, resembling an early ripening phenotype. Both the immature and mature internodes of the transgenic plants had significantly higher fibre contents. These findings suggest that PFP influences the ability of young, biosynthetically active sugarcane culm tissue to accumulate sucrose but that the equilibrium of the glycolytic intermediates, including the stored sucrose, is restored when ATP-dependent phosphofructokinase and the residual PFP activity is sufficient to sustain the required glycolytic flux as the tissue matures. Moreover, it suggests a role for PFP in glycolytic carbon flow, which could be rate limiting under conditions of high metabolic activity.

Pyrophosphate:fructose 6-phosphate 1-phosphotransferase is involved in the mobilization of sugar reserves in the taproots of cold- and drought-stressed carrot plants

The purpose of this work was to further investigate the regulatory interplay between pyrophosphate:fructose 6-phosphate 1-phosphotransferase (PFP) and its positive effector, fructose 2,6-bisphosphate (Fru-2,6-P2), in the storage organs of cold- and drought-stressed plants. Since there is no detectable cytoplasmic fructose-1,6-bisphosphatase (cytFBPase) activity in the taproots of carrot plants, PFP is the only enzyme that can replace its function when stored starch is converted to transportable sucrose. The working hypothesis was that PFP is likely to be involved in the mobilisation of energy reserves and might have a special role in storage organs such as carrot taproots upon stress. Both cold and drought stress resulted in a marked increase in the endogenous Fru-2,6-P2levels. It is suggested that the significant changes in photosynthate allocation are the direct results of the stimulation of PFP activity by elevated Fru-2,6-P2levels. PFP stimulated by Fru-2,6-P2operated in the gluconeogenic direction in the taproots of stressed carrot plants, whereas the glycolytic direction was dominant in the non-stressed controls. This suggests that the metabolic status determining the net activity of PFP depends on the physiological stress situation, making PFP an important sensor of environmental changes. The experimental data indicated that PFP is involved in the mobilisation of energy reserves during unfavourable environmental changes by promoting the re-synthesis of transportable sucrose in taproots.

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase α2 gene that is essential for expression

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.

Molecular and kinetic characterisation of sugarcane pyrophosphate: fructose-6-phosphate 1-phosphotransferase and its possible role in the sucrose accumulation phenotype.

The amount of pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) activity in sugarcane internodal tissue is inversely correlated with sucrose content. To help elucidate this apparent role of PFP in sucrose accumulation in sugarcane we have determined its molecular and kinetic properties. Sugarcane PFP was purified 285-fold to a final specific activity of 4.23 µmol min-1 mg-1 protein. It contained two polypeptides of 63.2 and 58.0 kDa respectively, at near equal amounts that cross-reacted with potato PFP-α and -β antiserum. In gel filtration analyses the native enzyme eluted in three peaks of 129, 245 and 511 kDa, corresponding to dimeric, tetrameric and octameric forms, respectively and fructose 2,6-bisphosphate (Fru 2,6-P2) influenced this aggregation state. Both the glycolytic (forward) and gluconeogenic (reverse) reactions had relative broad pH optima between pH 6.7 and 8.0. The Fru 2,6-P2 saturation curves were hyperbolic with approximate Ka values of 69 and 82 nm for the forward and reverse reactions, respectively. The enzyme showed hyperbolic saturation curves for all its substrates with Km values comparable with that of other plant PFP, i.e. 150, 37, 39 and 460 µM for fructose 6-phosphate, inorganic pyrophosphate, fructose 1,6-bisphosphate and inorganic phosphate, respectively. Sugarcane PFP's molecular and kinetic characteristics differed slightly from that of other plant PFP in that: (i) Fru 2,6-P2 directly induced the octameric state from the dimeric state; (ii) Fru 2,6-P2 shifted the pH optimum for the forward reaction to a slightly more basic pH; and (iii) Fru 2,6-P2 increased the Vmax for the forward and reverse reactions by similar amounts.

Reconstructing the mosaic glycolytic pathway of the anaerobic eukaryote Monocercomonoides.

All eukaryotes carry out glycolysis, interestingly, not all using the same enzymes. Anaerobic eukaryotes face the challenge of fewer molecules of ATP extracted per molecule of glucose due to their lack of a complete tricarboxylic acid cycle. This may have pressured anaerobic eukaryotes to acquire the more ATP-efficient alternative glycolytic enzymes, such as pyrophosphate-fructose 6-phosphate phosphotransferase and pyruvate orthophosphate dikinase, through lateral gene transfers from bacteria and other eukaryotes. Most studies of these enzymes in eukaryotes involve pathogenic anaerobes; Monocercomonoides, an oxymonad belonging to the eukaryotic supergroup Excavata, is a nonpathogenic anaerobe representing an evolutionarily and ecologically distinct sampling of an anaerobic glycolytic pathway. We sequenced cDNA encoding glycolytic enzymes from a previously established cDNA library of Monocercomonoides and analyzed the relationships of these enzymes to those from other organisms spanning the major groups of Eukaryota, Bacteria, and Archaea. We established that, firstly, Monocercomonoides possesses alternative versions of glycolytic enzymes: fructose-6-phosphate phosphotransferase, both pyruvate kinase and pyruvate orthophosphate dikinase, cofactor-independent phosphoglycerate mutase, and fructose-bisphosphate aldolase (class II, type B). Secondly, we found evidence for the monophyly of oxymonads, kinetoplastids, diplomonads, and parabasalids, the major representatives of the Excavata. We also found several prokaryote-to-eukaryote as well as eukaryote-to-eukaryote lateral gene transfers involving glycolytic enzymes from anaerobic eukaryotes, further suggesting that lateral gene transfer was an important factor in the evolution of this pathway for denizens of this environment.

Protein synthesis by rice coleoptiles during prolonged anoxia: implications for glycolysis, growth and energy utilization.

Anoxia-tolerant plant tissues synthesize a number of proteins during anoxia, in addition to the 'classical anaerobic proteins' involved in glycolysis and fermentation. The present study used a model system of rice coleoptile tips to elucidate patterns of protein synthesis in this anoxia-tolerant plant tissue. Coleoptile tips 7-11 mm long were excised from intact seedlings exposed to anoxia, or excised from hypoxically pre-treated seedlings and then exposed to anoxia for 72 h. Total proteins or 35S-labelled proteins were extracted, separated using two-dimensional isoelectric focusing/SDS-polyacrylamide gel electrophoresis and analysed using mass spectrometry. The coleoptile tips excised after intact seedlings had been exposed to anoxia for 72 h had a similar proteome to tips that were first excised and then exposed to anoxia. After 72 h anoxia, Bowman-Birk trypsin inhibitors and a glycine-rich RNA-binding protein decreased in abundance, whereas a nucleoside diphosphate kinase and several proteins with unknown functions were strongly enhanced. Using [35S]methionine as label, proteins synthesized at high levels in anoxia, and also in aeration, included a nucleoside diphosphate kinase, a glycine-rich RNA-binding protein, a putative elicitor-inducible protein and a putative actin-depolymerizing factor. Proteins synthesized predominately in anoxia included a pyruvate orthophosphate dikinase (PPDK), alcohol dehydrogenase 1 and 2, fructose 1,6-bisphosphate aldolase and a protein of unknown function. The induction of PPDK in anoxic rice coleoptiles might, in combination with pyruvate kinase (PK), enable operation of a 'substrate cycle' producing PPi from ATP. Production of PPi would (a) direct energy to crucial transport processes across the tonoplast (i.e. the H+-PPiase); (b) be required for sucrose hydrolysis via sucrose synthase; and (c) enable acceleration of glycolysis, via pyrophosphate:fructose 6-phosphate 1-phosphotransferase (PFP) acting in parallel with phosphofructokinase (PFK), thus enhancing ATP production in anoxic rice coleoptiles; ATP production would need to be increased if there was a substantial requirement for PPi.

Fluorescence study of ligand binding to potato tuber pyrophosphate-dependent phosphofructokinase: evidence for competitive binding between fructose-1,6-bisphosphate and fructose-2,6-bisphosphate

The intrinsic fluorescence of potato tuber pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP) was used as an indicator of conformational changes due to ligand binding. Binding of the substrates and the allosteric activator fructose-2,6-bisphosphate was quantitatively compared to their respective kinetic effects on enzymatic activity. PFP exhibited a relatively high affinity for its isolated substrates, relative to the enzyme’s respective K m (substrate) values. There are two distinct types of fructose-1,6-bisphosphate interaction with PFP, corresponding to catalytic and activatory binding. Activatory fructose-1,6-bisphosphate binding shares several characteristics with fructose-2,6-bisphosphate binding, indicating that both ligands compete for the same allosteric activator site. Activation by fructose-1,6-bisphosphate or fructose-2,6-bisphosphate was exerted primarily on the forward (glycolytic) reaction by greatly increasing the enzyme’s affinity for fructose-6-phosphate. Binding of substrates and effectors to PFP and PFP kinetic properties were markedly influenced by assay pH. Results indicate an increased glycolytic role for PFP during cytosolic acidification that accompanies anoxia stress.

Fructose 2,6-bisphosphate activates pyrophosphate: fructose-6-phosphate 1-phosphotransferase and increases triose phosphate to hexose phosphate cycling in heterotrophic cells.

The aim of this work was to establish the influence of fructose 2,6-bisphosphate (Fru-2,6-P2) on non-photosynthetic carbohydrate metabolism in plants. Heterotrophic callus lines exhibiting elevated levels of Fru-2,6-P2 were generated from transgenic tobacco (Nicotiana tabacum L.) plants expressing a modified rat liver 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase. Lines containing increased amounts of Fru-2,6-P2 had lower levels of hexose phosphates and higher levels of 3-phosphoglycerate than the untransformed control cultures. There was also a greater redistribution of label into the C6 position of sucrose and fructose, following incubation with [1-13C]glucose, in the lines possessing the highest amounts of Fru-2,6-P2, indicating a greater re-synthesis of hexose phosphates from triose phosphates in these lines. Despite these changes, there were no marked differences between lines in the metabolism of 14C-substrates, the rate of oxygen uptake, carbohydrate accumulation or nucleotide pool sizes. These data provide direct evidence that physiologically relevant changes in the level of Fru-2,6-P2 can affect pyrophosphate: fructose-6-phosphate 1-phosphotransferase (PFP) activity in vivo, and are consistent with PFP operating in a net glycolytic direction in the heterotrophic culture. However, the results also show that activating PFP has little direct effect on heterotrophic carbohydrate metabolism beyond increasing the rate of cycling between hexose phosphates and triose phosphates.