Putative Binding Research Articles

The miR-665/SOST Axis Regulates the Phenotypes of Bone Marrow Mesenchymal Stem Cells and Osteoporotic Symptoms in Female Mice

Osteoporosis is a common degenerative skeletal disease among older people, especially postmenopausal women. Bone marrow mesenchymal stem cells (BMSCs), the progenitors of osteoblasts, are essential to the pathophysiology of osteoporosis. Herein, targeting miRNAs with differential expression in dysfunctional BMSCs was accomplished by bioinformatics analysis based on public databases. Target mRNAs were predicted and applied for signaling pathway and function enrichment annotations. Invitro and invivo effects of selected miRNA on BMSC proliferation and osteogenesis were investigated, the putative binding between selected miRNA and predicted target mRNA was verified, and the co-effects of the miRNA/mRNA axis on BMSCs were determined. miRNA 665 (miR-665) was down-regulated in osteoporotic BMSCs compared with normal BMSCs and elevated in BMSCs experiencing osteogenic differentiation. In BMSCs, miR-665 overexpression promoted cell proliferation and osteogenic differentiation. miR-665 targeted the Wnt signaling inhibitor sclerostin (SOST) and inhibited SOST mRNA and protein expression. SOST overexpression inhibited BMSC cell proliferation and osteogenic differentiation. When co-transduced to BMSCs, SOST knockdown significantly reversed the effects of miR-665 on BMSCs. In ovariectomy (OVX)-induced osteoporosis model mice, OVX remarkably decreased bone mass, whereas miR-665 overexpression partially improved OVX-induced bone mass loss. miR-665 was down-regulated in osteoporotic BMSCs and up-regulated in osteogenically differentiated BMSCs. In conclusion, the miR-665/SOST axis modulates BMSC proliferation, osteogenic differentiation, and OVX-induced osteoporosis in mice, possibly through Wnt signaling.

CircTBX5 knockdown modulates the miR-558/MyD88 axis to alleviate IL-1β-induced inflammation, apoptosis and extracellular matrix degradation in chondrocytes via inactivating the NF-κB signaling

BackgroundIt has been widely shared that the dysregulation of circular RNA (circRNA) may contribute to the progression of osteoarthritis (OA). OA is characterized by persistent chondrocyte injury. We aimed to clarify the role of circTBX5 in IL-1β-induced chondrocyte injury.MethodsThe expression of circTBX5, miR-558 and MyD88 mRNA was measured using quantitative real-time PCR (qPCR). Cell viability, proliferation and apoptosis were assessed by CCK-8, EdU or flow cytometry assay. The protein levels of extracellular matrix (ECM)-associated markers, MyD88, IkBα, p65 and phosphorylated IkBα were measured by western blot. The release of inflammatory factors was assessed by ELISA. The targets of circTBX5 were screened by RIP and pull-down assay. The putative binding between miR-558 and circTBX5 or MyD88 was validated by dual-luciferase reporter assay.ResultsCircTBX5 and MyD88 were enhanced, while miR-558 was downregulated in OA cartilage tissues and IL-1β-treated C28/I2 cells. IL-1β induced C28/I2 cell injury by impairing cell viability and proliferation and promoting cell apoptosis, ECM degradation and inflammatory response, while circTBX5 knockdown alleviated IL-1β induced injury. CircTBX5 bound to miR-558 to regulate IL-1β induced cell injury. In addition, MyD88 was a target of miR-558, and circTBX5 targeted miR-558 to positively regulate MyD88 expression. MiR-558 enrichment attenuated IL-1β induced injury by sequestering MyD88 expression. Moreover, circTBX5 knockdown weakened the activity of NF-κB signaling, while miR-558 inhibition or MyD88 overexpression recovered the activity of NF-κB signaling.ConclusionCircTBX5 knockdown modulated the miR-558/MyD88 axis to alleviate IL-1β induced chondrocyte apoptosis, ECM degradation and inflammation via inactivating the NF-кB signaling pathway.

CIRC_0012535 CONTRIBUTES TO LIPOPOLYSACCHARIDE-INDUCED FETAL LUNG FIBROBLAST APOPTOSIS AND INFLAMMATION TO REGULATE INFANTILE PNEUMONIA DEVELOPMENT BY MODULATING THE MIR-338-3P/IL6R SIGNALING.

Background: Infantile pneumonia is a respiratory infection disease, seriously threatening the life of neonatal patients. Circular RNA (circRNA) dysregulation is reported to be involved in pneumonia pathogenesis. Circ_0012535 was previously displayed to be upregulated in blood samples of patients with community-acquired pneumonia. However, circ_0012535's role in this disorder remains unclear. We thus aim to unveil the functions of circ_0012535 in infantile pneumonia. Methods: Fetal lung fibroblasts (WI38) treated with LPS were used as pneumonia cell models. Expression analysis for circ_0012535, miR-338-3p and IL6R was performed using quantitative real-time polymerase chain reaction. Cell counting kit 88), 5-ethynyl-2'-deoxyuridine, and flow cytometry assays were implemented for cell function detection. The release of inflammatory factors, and superoxide dismutase activity and malonaldehyde content were ascertained using commercial kits. The putative binding between miR-338-3p and circ_0012535 or IL6R was validated by dual-luciferase analysis, RIP analysis, and pull-down analysis. Results: Circ_0012535 was highly expressed in LPS-treated WI38 cells. Knockdown of circ_0012535 recovered LPS-inhibited cell viability and proliferation and attenuated LPS-induced cell apoptosis, cell cycle arrest, inflammation, and oxidative stress. Circ_0012535 bound to miR-338-3p and negatively regulated miR-338-3p expression. Inhibition of miR-338-3p reversed the role of circ_0012535 knockdown, thereby recovering LPS-induced WI38 cell apoptosis and inflammation. MiR-338-3p bound to IL6R 3'UTR, and circ_0012535 shared miR-338-3p binding site with IL6R. IL6R overexpression reversed the role of miR-338-3p, thereby recovering LPS-induced WI38 cell apoptosis and inflammation. Conclusion: Circ_0012535 supported LPS-induced WI38 cell apoptosis and inflammation to promote the progression of infantile pneumonia, and circ_0012535 functioned partly by targeting the miR-338-3p/IL6R signaling.

Hsa_circ_0128846 knockdown attenuates the progression of pancreatic cancer by targeting miR-1270/NR3C1 axis

The considerable role of circular RNAs (circRNAs) make them prospective biomarkers in cancer therapy. Our study aimed to unveil the function of circ_0128846 in pancreatic cancer (PC). The expressions of circ_0128846, miR-1270 and NR3C1 mRNA were measured via RT-qPCR. The expressions of NR3C1 protein and apoptosis-related markers (Bax and Bcl-2) were measured via western blotting. CCK-8, colony-forming, or wound healing assay was respectively utilized to identify cell proliferation, growth and migration. Xenograft model was developed to evaluate tumor growth affected by circ_0128846 in vivo. The putative binding between miR-1270 and circ_0128846 or NR3C1 was testified by dual-luciferase reporter, RIP or pull-down assay. Circ_0128846 showed elevated expression in PC. Circ_0128846 deficiency restrained cancer cell proliferation, colony formation and migratory ability, enhanced cell apoptotic rate, and also impeded tumor development in vivo. Circ_0128846 directly targeted miR-1270 whose expression was declined in PC. The suppressive effects of silencing circ_0128846 on PC cell malignant phenotypes were largely reversed by miR-1270 inhibition. NR3C1 was targeted by miR-1270 and was highly regulated in PC. The repressive effects of NR3C1 knockdown on PC cell malignant phenotypes were partly abolished by miR-1270 inhibition. Circ_0128846 deficiency blocked PC progression via mediating the miR-1270/NR3C1 pathway, which partly illustrated PC pathogenesis.

Role and mechanism of REG2 depletion in insulin secretion augmented by glutathione peroxidase-1 overproduction

We previously reported a depletion of murine regenerating islet-derived protein 2 (REG2) in pancreatic islets of glutathione peroxidase-1 (Gpx1) overexpressing (OE) mice. The present study was to explore if and how the REG2 depletion contributed to an augmented glucose stimulated insulin secretion (GSIS) in OE islets. After we verified a consistent depletion (90%, p < 0.05) of REG2 mRNA, transcript, and protein in OE islets compared with wild-type (WT) controls, we treated cultured and perifused OE islets (70 islets/sample) with REG2 (1 μg/ml or ml · min) and observed 30–40% (p < 0.05) inhibitions of GSIS by REG2. Subsequently, we obtained evidences of co-immunoprecipitation, cell surface ligand binding, and co-immunofluorescence for a ligand-receptor binding between REG2 and transmembrane, L-type voltage-dependent Ca2+ channel (CaV1.2) in beta TC3 cells. Mutating the C-type lectin binding domain of REG2 or deglycosylating CaV1.2 removed the inhibition of REG2 on GSIS and(or) the putative binding between the two proteins. Treating cultured OE and perifused WT islets with REG2 (1 μg/ml or ml · min) decreased (p < 0.05) Ca2+ influx triggered by glucose or KCl. An intraperitoneal (ip) injection of REG2 (2 μg/g) to OE mice (6-month old, n = 10) decreased their plasma insulin concentration (46%, p < 0.05) and elevated their plasma glucose concentration (25%, p < 0.05) over a 60 min period after glucose challenge (ip, 1 g/kg). In conclusion, our study identifies REG2 as a novel regulator of Ca2+ influx and insulin secretion, and reveals a new cascade of GPX1/REG2/CaV1.2 to explain how REG2 depletion in OE islets could decrease its binding to CaV1.2, resulting in uninhibited Ca2+ influx and augmented GSIS. These findings create new links to bridge redox biology, tissue regeneration, and insulin secretion.

Valproate and Short-Chain Fatty Acids Activate Transcription of the Human Vitamin D Receptor Gene through a Proximal GC-Rich DNA Region Containing Two Putative Sp1 Binding Sites

The vitamin D receptor (VDR) mediates 1,25-dihydroxyvitamin D3 pleiotropic biological actions through transcription regulation of target genes. The expression levels of this ligand-activated nuclear receptor are regulated by multiple mechanisms both at transcriptional and post-transcriptional levels. Vitamin D3 is the natural VDR activator, but other molecules and signaling pathways have also been reported to regulate VDR expression and activity. In this study, we identify valproic acid (VPA) and natural short-chain fatty acids (SCFAs) as novel transcriptional activators of the human VDR (hVDR) gene. We further report a comprehensive characterization of VPA/SCFA-responsive elements in the 5′ regulatory region of the hVDR gene. Two alternative promoter DNA regions (of 2.4 and 3.8 kb), as well as subsequent deletion fragments, were cloned in pGL4-LUC reporter vector. Transfection of these constructs in HepG2 and human Upcyte hepatocytes followed by reporter assays demonstrated that a region of 107 bp (from −107 to −1) upstream of the transcription start site in exon 1a is responsible for most of the increase in transcriptional activity in response to VPA/SCFAs. This short DNA region is GC-rich, does not contain an apparent TATA box, and includes two bona fide binding sites for the transcription factor Sp1. Our results substantiate the hypothesis that VPA and SCFAs facilitate the activity of Sp1 on novel Sp1 responsive elements in the hVDR gene, thus promoting VDR upregulation and signaling. Elevated hepatic VDR levels have been associated with liver steatosis and, therefore, our results may have clinical relevance in epileptic pediatric patients on VPA therapy. Our results could also be suggestive of VDR upregulation by SCFAs produced by gut microbiota.

In silico analyses of penicillin binding proteins in Burkholderia pseudomallei uncovers SNPs with utility for phylogeography, species differentiation, and sequence typing

Burkholderia pseudomallei causes melioidosis. Sequence typing this pathogen can reveal geographical origin and uncover epidemiological associations. Here, we describe B. pseudomallei genes encoding putative penicillin binding proteins (PBPs) and investigate their utility for determining phylogeography and differentiating closely related species. We performed in silico analysis to characterize 10 PBP homologs in B. pseudomallei 1026b. As PBP active site mutations can confer β-lactam resistance in Gram-negative bacteria, PBP sequences in two resistant B. pseudomallei strains were examined for similar alterations. Sequence alignments revealed single amino acid polymorphisms (SAAPs) unique to the multidrug resistant strain Bp1651 in the transpeptidase domains of two PBPs, but not directly within the active sites. Using BLASTn analyses of complete assembled genomes in the NCBI database, we determined genes encoding PBPs were conserved among B. pseudomallei (n = 101) and Burkholderia mallei (n = 26) strains. Within these genes, single nucleotide polymorphisms (SNPs) useful for predicting geographic origin of B. pseudomallei were uncovered. SNPs unique to B. mallei were also identified. Based on 11 SNPs identified in two genes encoding predicted PBP-3s, a dual-locus sequence typing (DLST) scheme was developed. The robustness of this typing scheme was assessed using 1,523 RefSeq genomes from B. pseudomallei (n = 1,442) and B. mallei (n = 81) strains, resulting in 32 sequence types (STs). Compared to multi-locus sequence typing (MLST), the DLST scheme demonstrated less resolution to support the continental separation of Australian B. pseudomallei strains. However, several STs were unique to strains originating from a specific country or region. The phylogeography of Western Hemisphere B. pseudomallei strains was more highly resolved by DLST compared to internal transcribed spacer (ITS) typing, and all B. mallei strains formed a single ST. Conserved genes encoding PBPs in B. pseudomallei are useful for strain typing, can enhance predictions of geographic origin, and differentiate strains of closely related Burkholderia species.

The caspase-2 substrate p54nrb exhibits a multifaceted role in tumor cell death susceptibility via gene regulatory functions

Caspase-2 represents an evolutionary conserved caspase, which plays a role in genotoxic stress-induced apoptosis, ageing-related metabolic changes, and in deleting aneuploid cells in tumors. Genetic deletion of caspase-2 leads to increased tumor susceptibility in vivo. The exact downstream signaling mechanism by which caspase-2 accomplishes its specific tumor suppressor functions is not clear. Caspase-2, uniquely among caspases, resides in the nucleus and other cellular compartments. In this study, we identify a nuclear caspase-2 specific substrate, p54nrb, which is selectively cleaved by caspase-2 at D422, leading to disruption of the C-terminal site, the putative DNA binding region of the protein. P54nrb is an RNA and DNA binding protein, which plays a role in RNA editing, transport, and transcriptional regulation of genes. Overexpression of p54nrb is observed in several human tumor types, such as cervix adenocarcinoma, melanoma, and colon carcinoma. In contrast, the loss of p54nrb in tumor cell lines leads to increased cell death susceptibility and striking decrease in tumorigenic potential. By employing high resolution quantitative proteomics, we demonstrate that the loss/cleavage of p54nrb results in altered expression of oncogenic genes, among which the downregulation of the tumorigenic protease cathepsin-Z and the anti-apoptotic gelsolin can be detected universally across three tumor cell types, including adenocarcinoma, melanoma and colon carcinoma. Finally, we demonstrate that p54nrb interacts with cathepsin-Z and gelsolin DNA, but not RNA. Taken together, this study uncovers a so far not understood mechanism of caspase-2 tumor suppressor function in human tumor cells.

Genomic and Computational Analysis of Novel SNPs in TNP1 Gene Promoter Region of Bos indicus Breeding Bulls.

Transition nuclear proteins (TNPs), the principal proteins identified in the condensing spermatids chromatin, have been found to play a key role in histone displacement and chromatin condensation during mammalian spermatogenesis. One such gene belonging to the TNP family called TNP1 gene is abundantly expressed in the regulation of spermatogenesis, and its sequence is remarkably well conserved among mammals. Genomic analysis, by sequencing and computational approach, was used to identify the novel polymorphisms and to evaluate the molecular regulation of TNP1 gene expression in Sahiwal cattle breeding bulls. DNA samples were sequenced to identify novel single nucleotide polymorphisms (SNPs) in the TNP1 gene. Modern computational tools were used to predict putative transcription factor binding in the TNP1 promoter and CpG islands in the TNP1 promoter region. In the TNP1 gene, four SNPs, three TATA boxes, and one CAAT box were identified. One CAAT box was discovered at 89 bp upstream of start site ATG. The computational analyses indicated that the polymorphisms inside the promoter sequence results in an added HNF-1 transcription factor binding site. In contrast, the other variations may remove the naturally occurring SRF transcription factor binding site. The CpG islands in the TNP1 promoter region were predicted to be absent by the MethPrimer program before and after SNP site mutations. These findings pave the way for more research into the TNP1 gene's promoter activity and the links between these SNPs and reproductive attributes in the Sahiwal breeding bulls.

A putative cap binding protein and the methyl phosphate capping enzyme Bin3/MePCE function in telomerase biogenesis

Telomerase reverse transcriptase (TERT) and the noncoding telomerase RNA (TR) subunit constitute the core of telomerase. Additional subunits are required for ribonucleoprotein complex assembly and in some cases remain stably associated with the active holoenzyme. Pof8, a member of the LARP7 protein family is such a constitutive component of telomerase in fission yeast. Using affinity purification of Pof8, we have identified two previously uncharacterized proteins that form a complex with Pof8 and participate in telomerase biogenesis. Both proteins participate in ribonucleoprotein complex assembly and are required for wildtype telomerase activity and telomere length maintenance. One factor we named Thc1 (Telomerase Holoenzyme Component 1) shares structural similarity with the nuclear cap binding complex and the poly-adenosine ribonuclease (PARN), the other is the ortholog of the methyl phosphate capping enzyme (Bin3/MePCE) in metazoans and was named Bmc1 (Bin3/MePCE 1) to reflect its evolutionary roots. Thc1 and Bmc1 function together with Pof8 in recognizing correctly folded telomerase RNA and promoting the recruitment of the Lsm2-8 complex and the catalytic subunit to assemble functional telomerase.

Cloning of the Human MORG1 Promoter: Differential Regulation by Hypoxia and Prolyl-Hydroxylase Inhibitors.

MAPK-organizer 1 (MORG1) is a molecular scaffold for prolyl-hydroxylase-3 containing a domain (PHD3) protein linking MORG1 to mechanisms of adaptation in hypoxic conditions. In this paper, we report the cloning of the promoter region of the murine and human MORG1 gene. Among other transcriptional factors binding sites, we identified that both (mouse and human) promoter regions contained several putative hypoxia-inducible factor binding motifs. Analyses of the human MORG1 promoter by reporter assays revealed that hypoxia and pharmacological inhibitors of prolyl-hydroxylases under in vitro conditions in HEK 293 cells differentially regulate the MORG1 promoter reporter activity. The exposure of the cells to 10% hypoxia showed inhibition of MORG1 promotor activity at 6 and 12 h, but stimulation after 24 h while treated with prolyl-hydroxylase inhibitors led to a time-independent MORG1 promoter activation. Mutational analyses of the individual HIF binding sites on human MORG1 promoter suggest that the binding sites work in a complex corporation because single mutations were not sufficient to abolish completely the MORG1 reporter activation by PHD inhibitors. Our data provide the first evidence that not only MORG1 regulate HIF stabilization through a PHD complex, but also that, vice versa, HIFs control MORG1 expression directly or indirectly by a complex regulatory mechanism.

Amoxicillin Haptenation of α-Enolase is Modulated by Active Site Occupancy and Acetylation.

Allergic reactions to antibiotics are a major concern in the clinic. ß-lactam antibiotics are the class most frequently reported to cause hypersensitivity reactions. One of the mechanisms involved in this outcome is the modification of proteins by covalent binding of the drug (haptenation). Hence, interest in identifying the corresponding serum and cellular protein targets arises. Importantly, haptenation susceptibility and extent can be modulated by the context, including factors affecting protein conformation or the occurrence of other posttranslational modifications. We previously identified the glycolytic enzyme α-enolase as a target for haptenation by amoxicillin, both in cells and in the extracellular milieu. Here, we performed an in vitro study to analyze amoxicillin haptenation of α-enolase using gel-based and activity assays. Moreover, the possible interplay or interference between amoxicillin haptenation and acetylation of α-enolase was studied in 1D- and 2D-gels that showed decreased haptenation and displacement of the haptenation signal to lower pI spots after chemical acetylation of the protein, respectively. In addition, the peptide containing lysine 239 was identified by mass spectrometry as the amoxicillin target sequence on α-enolase, thus suggesting a selective haptenation under our conditions. The putative amoxicillin binding site and the surrounding interactions were investigated using the α-enolase crystal structure and molecular docking. Altogether, the results obtained provide the basis for the design of novel diagnostic tools or approaches in the study of amoxicillin-induced allergic reactions.

Characterization and Molecular Determinants for β-Lactam Specificity of the Multidrug Efflux Pump AcrD from Salmonella typhimurium.

Gram-negative Tripartite Resistance Nodulation and cell Division (RND) superfamily efflux pumps confer various functions, including multidrug and bile salt resistance, quorum-sensing, virulence and can influence the rate of mutations on the chromosome. Multidrug RND efflux systems are often characterized by a wide substrate specificity. Similarly to many other RND efflux pump systems, AcrAD-TolC confers resistance toward SDS, novobiocin and deoxycholate. In contrast to the other pumps, however, it in addition confers resistance against aminoglycosides and dianionic β-lactams, such as sulbenicillin, aztreonam and carbenicillin. Here, we could show that AcrD from Salmonella typhimurium confers resistance toward several hitherto unreported AcrD substrates such as temocillin, dicloxacillin, cefazolin and fusidic acid. In order to address the molecular determinants of the S. typhimurium AcrD substrate specificity, we conducted substitution analyses in the putative access and deep binding pockets and in the TM1/TM2 groove region. The variants were tested in E. coli ΔacrBΔacrD against β-lactams oxacillin, carbenicillin, aztreonam and temocillin. Deep binding pocket variants N136A, D276A and Y327A; access pocket variant R625A; and variants with substitutions in the groove region between TM1 and TM2 conferred a sensitive phenotype and might, therefore, be involved in anionic β-lactam export. In contrast, lower susceptibilities were observed for E. coli cells harbouring deep binding pocket variants T139A, D176A, S180A, F609A, T611A and F627A and the TM1/TM2 groove variant I337A. This study provides the first insights of side chains involved in drug binding and transport for AcrD from S. typhimurium.

Abstract 11704: NF-κβ Signaling Regulates Vasopressin Receptor 2 Promoter Activity

Background: Arginine vasopressin, through vasopressin receptor 2 (AVP-V2R), regulates water reabsorption via aquaporin-2 and sodium reabsorption via several mechanisms. We recently implicated V2R, and its transcriptional downregulation, in a model of B-cell deficiency with increased sodium- and water-excretion and reduced blood pressure (BP). Here, we identify mechanisms underlying the immunoregulation of V2R transcription and evaluate the importance of V2R in BP regulation. Methods &amp; Results: Using an Avpr2 promoter-luciferase reporter in an immortalized mouse inner medullary collecting duct cell line [mIMCD-3], we found that IL-6 (100ng/mL), a stimulator of NF-κβ signaling, increased promoter-reporter activity (10.4±3.2 vs 4.0±0.5 RLU; N=2-3/group); while PDTC (60μM), an inhibitor of NF-κβ signaling, reduced promoter-reporter activity (2.2 vs 4.0±0.5 RLU; N=1-3/group). Importantly, single point mutations in two putative NF-κβ binding sites in the proximal Avpr2 promoter also reduced promoter activity (2.3±0.6 vs 4.0±0.5 RLU; N=2-3/group), and blocked the stimulatory effect of IL-6 (2.4 vs 2.3±0.6 RLU; N=1-2/group). An anti-IL-6 receptor antibody (10μg/mL vs isotype, 10μg/mL) also abolished the stimulatory effect of IL-6 on promoter activity (3.2 vs 9.1 RLU; N=1/group). To determine the role of V2R in BP regulation, wild-type C57BL/6J mice (male and female; aged 10-wk) were randomized to (i) Tolvaptan (TOL), a selective V2R-antagonist or (ii) DMSO/glycerol control (50/50) via osmotic mini-pump (0.0375mg/d). Invasive hemodynamics 12-d post-implant revealed reduced mean arterial pressure (MAP) in TOL-treated mice (76±3 vs 86±3 mmHg; N=4-5/group; P&lt;0.05), while metabolic cage studies 8-11-d post-implant showed higher 24-h urine volume/body weight (UV/BW; 0.07±0.00 vs 0.05±0.00 mL/g; N=4-5/group; P&lt;0.05) and 24-h sodium excretion/BW (0.25±0.01 vs 0.17±0.01 mg/d/g; N=4-5/group; P&lt;0.01). Correlation analyses revealed inverse relationships between MAP and 24-h UV/BW (r=-0.65; N=9 pairs; P&lt;0.05) and 24-h sodium excretion/BW (r=-0.64; N=9 pairs; P&lt;0.05). Conclusion: These studies suggest that the V2R promoter is responsive to NF-κβ signaling, and that V2R serves a role in BP homeostasis through sodium- and water-handling.

Abstract 14011: Myomegalin, a 250 Kilodalton Phosphodiesterase Interacting Protein (PDE4DIP), Shows a Novel Protein Interaction With Cardiac Myosin Binding Protein C

Cardiac myosin binding protein C (cMyBP-C) is a sarcomeric protein important in the regulation of cardiac contraction through its phosphorylation-dependent interactions with myosin heavy chain and actin. MYBPC3, the gene encoding cMyBP-C, contains the largest number of hypertrophic cardiomyopathy (HCM)-causing mutations. Interestingly, the region of MYBPC3 containing the greatest number of HCM-causing missense mutations, the central domains, have an unknown physiological relevance to the overall function of the protein. Intriguingly, central domain C3 contains a positively charged, putative surface binding interface for an as-yet unidentified ligand. Two of the most common HCM-causing mutations, R495Q and R502W, located in C3, appear to alter this charged interface. We have previously shown that these two mutations lead to altered contractile kinetics and hypophosphorylation of cMyBP-C. We hypothesize that this region of C3 contains an important binding region that is disrupted by both the R495Q and R502W mutations. To reveal candidate binding proteins, we performed a pull-down assay using mouse cardiac homogenate and a GST-tagged C2-C4 fragment of cMyBP-C, with or without the R495Q mutation. Mass spectrometry revealed that myomegalin, a 250 kDa phosphodiesterase-4D-interacting protein (PDE4DIP), bound the WT, but not the R495Q C2-C4 fragment. To confirm the interaction between cMyBP-C and myomegalin in situ , we performed Duolink proximity ligase assay (PLA) in cultured neonatal mouse cardiomyocytes which revealed a positive interaction in cMyBP-C +/+ but not in cMyBP-C -/- cells (n&gt;20) (Figure). Our data strongly suggest that a large isoform of myomegalin, separately known to form a protein complex with PKA/AKAP, forms a novel interaction with cMyBP-C. We hypothesize that perturbations in this interaction lead to altered PKA localization and the observed changes in R495Q and R502W cMyBP-C phosphorylation, and may contribute to the HCM phenotype.

Sigma-1 Receptor and Binding Immunoglobulin Protein Interact with Ulinastatin Contributing to a Protective Effect in Rat Cerebral Ischemia/Reperfusion

To investigate impact of ulinastatin (UTI) on sigma-1 receptor (σ1R) and binding immunoglobulin protein (BiP) after cerebral ischemia/reperfusion injury. The middle cerebral artery occlusion (MCAO) model was used to induce cerebral ischemia/reperfusion injury. Eighty male Sprague Dawley rats were randomly divided into 6 groups: control, MCAO, MCAO+50,000 U/kg UTI, MCAO+100,000 U/kg UTI, MCAO+200,000 U/kg UTI, MCAO+300,000 U/kg UTI. At 24 and 48 hours after MCAO, infarct volume, neurological dysfunction, and grip strength test were measured, and level of σ1R and BiP proteins was further detected using Western blot. Molecular docking assays were carried out to verify interaction between σ1R, BiP, and UTI. The serum concentration of BiP and the binding assay between σ1R, BiP, and UTI were determined using enzyme-linked immunosorbent assay. UTI increased the modified neurological severity score and upregulated σ1R and BiP expression in the cerebral cortex after MCAO. The grip strength of forelimbs increased significantly in the MCAO+200,000 U/kg UTI and MCAO+300,000 U/kg UTI groups compared with the MCAO group, while BiP serum levels remained unchanged. The molecular docking assay indicated putative binding between σ1R, BiP, and UTI. The binding assay also revealed that both σ1R and BiP could be combined with UTI. UTI displays a neuroprotective effect via upregulation of σ1R and BiP during ischemia/reperfusion injury, suggesting that UTI modulates σ1R and BiP and their interaction may provide a novel insight into potential therapeutic mechanisms for stroke.

Dysregulation of the miR-30a/BiP axis by cigarette smoking accelerates oral cancer progression

BackgroundCigarette smoking is the most significant cause of oral cancer progression. Cigarette smoke condensate (CSC) has been shown to induce endoplasmic reticulum (ER) stress. Binding immunoglobulin protein (BiP) being as an ER stress regulator, has been reported to be implicated in malignant behaviors. Therefore, the aim of this study was to investigate the role of the ER stress-responsive protein, BiP, in CSC-induced oral squamous cell carcinoma (OSCC) malignancy.MethodsThe biological role of BiP in CSC-induced tumor progression was investigated in OSCC cells (YD38 and SCC25) and in a tumor xenograft mouse model. The expressions of related genes were investigated using quantitative RT-PCR and Western blot analysis. Cell migration and invasion were assessed using scratch wound healing and Transwell invasion assays. The effects of conditioned media from OSCC cells on the angiogenic activities of endothelial cells were analyzed using a tube formation assay. The interaction between miR-30a and BiP mRNA was detected using a luciferase reporter assay.ResultsOur results demonstrated that CSC increased the expression of BiP in time- and dose-dependent manners in YD38 and SCC25 cells, and that silencing BiP abrogated CSC-induced cell invasion and tumor-associated angiogenesis. Notably, the putative miR-30a binding site was observed in the 3′untranslated region (UTR) of BiP mRNA, and miR-30a suppressed BiP expression by targeting 3′UTR of BiP transcript. In addition, CSC increased the expression of BiP in OSCC cells by downregulating miR-30a. We also showed that BiP promoted invasion and tumor-associated angiogenesis by increasing the production and secretion of vascular endothelial growth factor in CSC-exposed OSCC cells. Moreover, BiP inhibition suppressed OSCC growth and reduced tumor vessel density in tumor-bearing mice administered with CSC.ConclusionsThese observations suggest that epigenetic regulation of BiP via miR-30a downregulation is involved in CSC-induced OSCC progression.

Involvement of Cis-Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female Periplaneta americana.

Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the Periplaneta americana Vitellogenin 2 (Vg2) promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp Vg2 promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct −177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from −177 to −139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as Vg2RE (−168GAGTCACGGAGTCGCCGCTG−149). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in Vg2RE for binding the isolated fat body nuclear protein. In Sf9 cells, a luciferase reporter placed under the control of a minimal promoter containing Vg2RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to Vg2RE, and this binding was outcompeted by a 50-fold excess of cold Drosophila melanogaster DR4 and Galleria mellonella JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe Vg2RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.

\u03b2-Catenin/LEF-1 transcription complex is responsible for the transcriptional activation of LINC01278

BackgroundOur previous study shows that LINC01278 inhibits the malignant proliferation and invasion of papillary thyroid carcinoma (PTC) cells by regulating the miR-376c-3p/DNM3 axis. However, the regulation mechanism of LINC01278 expression in PTC cells is still unclear.MethodsThe luciferase reporter and ChIP assays were used to confirm the binding of LEF-1 to the putative promoter site of LINC01278 gene. The RNA immunoprecipitation and RNA pulldown were used to determine the enrichment of LINC01278 in β-catenin protein. The proteasome inhibitors (MG132) was used for detecting the β-catenin ubiquitination-proteasome degradation. Wnt/β-catenin specific agonists (LiCI), inhibitors (WiKI4) and TOP/FOP-flash reporter assay were used for detecting the activation of Wnt/β-catenin signal. Western blot was used to detected the expression of target proteins.ResultsThe online PROMO algorithm determines a putative LEF-1 binding site on LINC01278 promoter, the LEF-1 binds to the putative promoter site of LINC01278 gene, and β-catenin enhances the binding of LEF-1 to the LINC01278 gene promoter. Furthermore, LINC01278 negatively regulated the protein accumulation of β-catenin in the cytoplasm, into nucleus, and ultimately inhibited the transcription of downstream target genes activated by Wnt/β-catenin signal. The results of RNA immunoprecipitation and RNA pulldown proved the direct binding of LINC01278 to β-catenin protein. In addition, the combination of LINC01278 and β-catenin promotes the β-catenin ubiquitination-proteasome degradation.ConclusionIn summary, we found the transcriptional activation of LINC01278 by the β-catenin/LEF-1 transcription factor, and the negative feedback regulation of LINC01278 onβ-catenin signal.

Crosstalk in oxygen homeostasis networks: SKN-1/NRF inhibits the HIF-1 hypoxia-inducible factor in Caenorhabditis elegans.

During development, homeostasis, and disease, organisms must balance responses that allow adaptation to low oxygen (hypoxia) with those that protect cells from oxidative stress. The evolutionarily conserved hypoxia-inducible factors are central to these processes, as they orchestrate transcriptional responses to oxygen deprivation. Here, we employ genetic strategies in C. elegans to identify stress-responsive genes and pathways that modulate the HIF-1 hypoxia-inducible factor and facilitate oxygen homeostasis. Through a genome-wide RNAi screen, we show that RNAi-mediated mitochondrial or proteasomal dysfunction increases the expression of hypoxia-responsive reporter Pnhr-57::GFP in C. elegans. Interestingly, only a subset of these effects requires hif-1. Of particular importance, we found that skn-1 RNAi increases the expression of hypoxia-responsive reporter Pnhr-57::GFP and elevates HIF-1 protein levels. The SKN-1/NRF transcription factor has been shown to promote oxidative stress resistance. We present evidence that the crosstalk between HIF-1 and SKN-1 is mediated by EGL-9, the prolyl hydroxylase that targets HIF-1 for oxygen-dependent degradation. Treatment that induces SKN-1, such as heat or gsk-3 RNAi, increases expression of a Pegl-9::GFP reporter, and this effect requires skn-1 function and a putative SKN-1 binding site in egl-9 regulatory sequences. Collectively, these data support a model in which SKN-1 promotes egl-9 transcription, thereby inhibiting HIF-1. We propose that this interaction enables animals to adapt quickly to changes in cellular oxygenation and to better survive accompanying oxidative stress.